Soybean salt tolerance related gene GmVP6 as well as encoded protein and application thereof

Abstract

The invention discloses a soybean salt-tolerant related gene GmVP6 and an encoded protein and application thereof, in particular to application of the soybean salt-tolerant related gene GmVP6 in improvement of soybean salt tolerance, and the nucleotide sequence of the soybean salt-tolerant related gene GmVP6 is shown as SEQ ID No.1. The invention further discloses a preparation method of the soybean salt-tolerant related gene GmVP6. The soybean salt tolerance related gene GmVP6 is subjected to overexpression, so that the salt tolerance of soybeans is improved, and the soybean salt tolerance related gene GmVP6 has important significance in effectively utilizing large-area saline-alkali soil in China and improving the soybean yield.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a soybean salt-tolerance-related gene GmVP6 and its encoded protein and application. Background Art

[0002] Soybean (Glycine max (L.) Merr.) originated in China and belongs to the Fabaceae, Fabaceae, Glycine max genus. It is one of the most important grain and oil crops and feed crops in the world. As a multifunctional crop, soybean can be used to make various bean foods, such as tofu, soy yogurt, ice cream, etc. It can also be processed into livestock feed. It is also an important source of plant protein. With the development of the national economy and the improvement of people's living standards, my country's demand for soybeans is increasing. However, my country's soybean production is relatively low, with a self-sufficiency rate of less than 20%. It mainly relies on imported soybeans to meet domestic soybean demand.

[0003] Globally, soil salinization is one of the key factors restricting crop productivity, and has a great negative impact on soybean yield and quality. Cultivated soybeans are relatively insensitive to salt-alkali stress. When the salt-alkali stress value exceeds the tolerance of soybeans, it will significantly inhibit soybean growth, thus having a certain impact on soybean yield. How to reasonably utilize my country's salinized arable land to increase soybean production capacity is an issue that we urgently need to solve.

[0004] One of the effective ways to fully utilize saline-alkali land resources is to explore salt-tolerant and high-yield genes and cultivate salt-tolerant soybean varieties. Breeding and promoting salt-tolerant soybean varieties is an important strategy to fully utilize saline-alkali farmland in my country. Important crops such as corn, rice, and wheat have made important progress in studying salt-tolerant genes by overexpression. Glutathione S-transferases (GSTs) are a class of highly conserved functional enzymes that play an important role in the response of plants to abiotic stress. Studies have shown that the GsGSTU13 gene is an important salt-tolerant gene in wild soybeans. Overexpression of the GsGSTU13 gene in rice enhances the reactive oxygen scavenging ability of the overexpressed strains and improves the salt tolerance of rice. The GmPP2C89 gene is upregulated by NaCl. Under salt induction, the GmPP2C89 overexpression strain enhances the salt tolerance of the overexpression strain by activating the antioxidant pathway and the ABA pathway. Overexpression of GmTGA26 gene upregulates the expression levels of NHX family gene GmNHX5 and SOS signaling pathway key gene GmSOS1, thereby regulating intracellular Na + Although some progress has been made in recent years in the study of soybean salt tolerance, the salinization of cultivated land has intensified due to irrigation methods and climate change, and it is urgent to identify and characterize more soybean salt tolerance genes.

[0005] V-ATPase is a special enzyme located on the plant vacuole membrane that can hydrolyze pyrophosphate to release energy. It plays an important role in maintaining the stability of the cell's osmotic pressure, the electrochemical potential inside and outside the membrane, and the secondary active transport of small molecules in the cell. The VP gene family was first identified in Arabidopsis thaliana. It has multiple functions, such as affecting plant morphology, increasing plant biomass and yield, increasing plant tolerance to drought and salt, increasing tolerance to heavy metal elements, participating in plant sugar metabolism, and improving element utilization efficiency. Overexpression of AVP1 in Arabidopsis thaliana, tomato, and rice enhanced the plant's salt tolerance. Type I H in Arabidopsis thaliana + Upregulation of -PPase results in a higher proton electrochemical gradient, which helps to enhance the release of ions and sugars into the vacuole, reduce water potential, and increase salt tolerance compared with the wild type. AVP1 was overexpressed in cotton, and its ROS activity under salt stress was measured. The analysis showed that cotton lines overexpressing AVP1 showed higher salt tolerance. Transgenic wheat with ZxNHX / VP1-1 gene was grown under salt stress. The phenotypic, antioxidant and osmotic regulation ability analysis, as well as ion homeostasis and agronomic traits showed that ZxNHX / VP1-1 significantly improved the salt tolerance of wheat. ZmVPP5 is expressed in multiple parts of maize plasma membrane, vacuole membrane and nucleus. Overexpression of ZmVPP5 in yeast cells showed hypersensitivity to salt stress. Transgenic maize lines overexpressing ZmVPP5 also showed a salt-tolerant phenotype. According to these previous studies, the VP gene family plays a vital role in enhancing plant salt tolerance. However, the function of the VP gene family in soybean is still unclear. Summary of the invention

[0006] The purpose of the present invention is to provide a soybean salt-tolerance related gene GmVP6 and its encoded protein and application, and to overexpress the soybean salt-tolerance related gene GmVP6 to improve the salt tolerance of soybean.

[0007] The technical solution adopted by the present invention to solve its technical problem is: The invention discloses an application of a soybean salt tolerance related gene GmVP6 in improving the salt tolerance of soybean. The nucleotide sequence of the soybean salt tolerance related gene GmVP6 is shown in SEQ ID No.1.

[0008] Soybean is an important oil crop and food crop in my country, and has a history of more than 5,000 years. However, its yield is affected by many factors, including the restriction of saline-alkali land. Therefore, cultivating new soybean varieties with salt tolerance is of great significance for effectively utilizing large areas of saline-alkali land in my country and increasing soybean yield. However, the regulation of soybean salt tolerance by the GmVP gene family in soybean has not been reported. In the present invention, we analyzed the potential function of the GmVP6 gene, which is highly expressed in the root system. Under salt stress, heterologous expression of GmVP6 in Arabidopsis leads to an increase in the number of lateral roots, fresh weight of the aboveground part, and fresh weight of the underground part. At the same time, the MDA content of the GmVP6 overexpression strain is lower than that of the wild type under salt stress, while the POD and SOD activities are higher than those of the wild type, that is, the overexpression of the GmVP6 gene enhances the active oxygen scavenging ability of the overexpression strain and improves the salt tolerance of the crop, which provides a new idea for improving the salt tolerance of soybean by genetic engineering.

[0009] Up-regulate the expression level of soybean salt tolerance related gene GmVP6, thereby improving soybean salt tolerance.

[0010] The invention discloses a use of a soybean salt-tolerance-related gene GmVP6 as a target for improving the salt-tolerance of soybean. The nucleotide sequence of the soybean salt-tolerance-related gene GmVP6 is shown in SEQ ID No.1.

[0011] A method for improving the salt tolerance of soybeans, wherein the soybean salt tolerance-related gene GmVP6 in the soybeans is overexpressed and modified, thereby improving the salt tolerance of the soybeans.

[0012] The nucleotide sequence of the soybean salt tolerance related gene GmVP6 is shown in SEQ ID No.1.

[0013] A soybean salt tolerance related gene GmVP6, the nucleotide sequence of which is shown in SEQ ID No.1.

[0014] A protein encoded by a soybean salt tolerance related gene GmVP6 is obtained by transcription and translation of the soybean salt tolerance related gene GmVP6 of the nucleotide sequence shown in SEQ ID No. 1, and its amino acid sequence is shown in SEQ ID No. 2. The GmVP6 gene is mainly expressed in roots.

[0015] The beneficial effects of the present invention are: GmVP6 positively regulates the salt tolerance of the plant, has breeding potential, and lays a foundation for cultivating salt-tolerant and high-yield soybeans and in-depth research on GmVP6 regulating soybean salt tolerance and its related mechanisms; the salt tolerance of soybeans can be improved through genetic engineering modification, and new soybean varieties with salt tolerance can be cultivated, which is of great significance for effectively utilizing large areas of saline-alkali land in my country and increasing soybean yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The expression pattern analysis and spatiotemporal expression pattern diagram of the GmVP gene family; A: Expression pattern of the GmVP gene family in tissues; B: Expression pattern of the GmVP gene family in roots under salt stress; C: Expression level of the GmVP6 gene in different tissues; Figure 2 The diagrams of obtaining overexpression transgenic lines and observing their phenotypes are shown below; A: PCR identification, B: RT-qPCR identification, C: Arabidopsis phenotype treated with soil salt, D: Arabidopsis phenotype treated with culture medium salt; Figure 3 This is a graph showing the effects of different concentrations of salt treatment on the fresh weight of the aboveground part, the fresh weight of the underground part, the root length, and the lateral root of the overexpressing transgenic lines; Figure 4 This is a graph showing the effects of different concentrations of salt treatment on the germination rate and greening rate phenotypes of the overexpressing transgenic lines; Figure 5 This is a statistical chart comparing the germination rate and greening rate of the overexpressed transgenic lines under different concentrations of salt treatment; Figure 6 This is a graph showing the ROS activity measurement of the overexpressed transgenic strain; A: malondialdehyde (MDA) concentration B: superoxide dismutase (SOD) activity C: peroxidase (POD) activity. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described in detail below through specific embodiments.

[0018] In the present invention, unless otherwise specified, the raw materials and equipment used can be purchased from the market or are commonly used in the art. The methods in the following embodiments, unless otherwise specified, are all conventional methods in the art.

[0019] Example 1: Cloning and expression pattern analysis of soybean salt tolerance regulatory gene GmVP6 There are 8 GmVP gene family members in the soybean genome, namely GmVP1, GmVP2, GmVP3, GmVP4, GmVP5, GmVP6, GmVPL1, and GmVPL2. Bioinformatics analysis of the 8 members of the soybean GmVP gene family revealed that the soybean GmVP gene family is divided into two subfamilies. Then, the expression levels of the members in different soybean tissues were analyzed, and it was found that the expression patterns of the soybean GmVP gene family in different tissues and organs were different, among which the GmVP6 gene was mainly expressed in the root system ( Figure 1 A in the figure) also predicted the expression pattern of the GmVP gene family under salt stress, and found that in the root system, under salt treatment conditions, GmVP6 was induced by salt and had a high expression level. As the salt treatment time increased, the expression level gradually increased ( Figure 1B in Figure 1). Therefore, we selected GmVP6 as a candidate gene. To further verify the expression pattern of the GmVP6 gene, we used RT-VP6-F and RT-VP6-R (Table 1) to perform RT-qPCR to analyze the expression of the GmVP6 gene in different tissues and verified that GmVP6 was mainly expressed in the root system ( Figure 1 C). A GmVP6 vector driven by the pUBQ10 promoter was constructed for cloning.

[0020] Table 1 Primer sequences Primer name Primer sequence (5'-3') RT-VP6-F GCAATGCTTACAGCCCAGTT (SEQ ID No.3) RT-VP6-R TGCAGCAACAGCAATTCCAT (SEQ ID No.4) qRT-At-FP (internal reference) GTCGTACAACCGGTATTGTGCT (SEQ ID No.5) qRT-At-RP (internal reference) TGTCTCTTACAATTTCCCGCTCT (SEQ ID No. 6) Example 2: Obtaining overexpression transgenic Arabidopsis and studying its salt tolerance 1. Obtaining overexpression transgenic Arabidopsis To further investigate the role of GmVP6 in plant salt tolerance, we constructed transgenic Arabidopsis lines overexpressing GmVP6 driven by the pUBQ10 promoter. The wild-type and background Arabidopsis plants used in this study were Columbia-0 (Col-0) ecotypes, and Arabidopsis was transformed by inflorescence infection. Three homozygous transgenic lines were selected for further study by RT-qPCR and PCR detection of the transformants ( Figure 2 A in Figure 2 B in the figure).

[0021] Steps to obtain overexpression transgenic Arabidopsis Using the cDNA of Tianlong No. 1 soybean as a template, the pUBQ-VP6-F and pUBQ-VP6-R primers were used to amplify the gene GmVP6 (SEQ ID No. 1). The amplification reaction system is shown in Table 2, and the PCR amplification procedure is shown in Table 3. Figure 4 ) were digested with Spe Ⅰ and Sma Ⅲ. The correct fragment was connected with the digested vector to obtain the recombinant vector pUBQ-VP6.

[0022] pUBQ-VP6-F and pUBQ-VP6-R sequence information: pUBQ-VP6-F:5'-AGTTTTTCTGATTAACAGACTAGTATGGTTGTGCTGAGCGAG-3' (SEQ ID No. 7); pUBQ-VP6-R:5'-GACCTGAGGTAATTATAACCCGGGTCAGAGTAATTTAAAGAT-3' (SEQ ID No. 8).

[0023] Table 2 Amplification mixed system Reagents Dosage pUBQ-VP6-F (10 μM) 1 μL pUBQ-VP6-R (10 μM) 1 μL Prime STAR High-Fidelity DNA Polymerase 1 μL dNTP Mix 6 μL Template DNA 1-2 μL 5× Primer STAR Buffer 10 μL Sterile ultrapure water Add to 50 μL Table 3 PCR amplification program The constructed pUBQ-VP6 vector was transferred into GV3101 competent cells to obtain the target strain; The positive single clone Agrobacterium with the correct band size was inoculated into 1 ml LB liquid medium containing 50 mg / L rifampicin (Rif) and 50 mg / L kanamycin sulfate (Kan) resistance, and cultured overnight at 28°C and 220 rpm in a shaking incubator. Then, the culture was inoculated into 200 ml LB liquid medium containing 50 mg / L rifampicin (Rif) and 50 mg / L kanamycin sulfate (Kan) resistance, and cultured at 28°C and 220 rpm in a shaking incubator until the OD value was 0. 600 Between 1.2-1.8; Select 4-6 week old well-growing Arabidopsis plants, cut off the opened flowers and fruit pods to ensure infection efficiency. Pour enough water the night before infection to ensure normal growth of Arabidopsis plants; The cultured Agrobacterium culture was centrifuged at 4000 rpm and 4°C for 10 min, the supernatant was removed, and the culture was resuspended in the infection suspension (Table 5) to adjust the infection liquid OD to 600 Between 0.8-1.0; Immerse the inflorescence of Arabidopsis plants in the Agrobacterium resuspension for 30-60 seconds. After soaking, put them back on the tray and cover them with a plastic cover to maintain humidity. Keep them in the dark for 24 hours and harvest them when the seeds are mature. The harvested T1 generation seeds were spotted on 1 / 2 MS medium containing 20 mg / L Tim and 15 mg / L glyphosate resistance (Table 6) for the first step of screening. After one week, the seedlings that could grow normally were identified as positive seedlings and moved into soil for cultivation. After they grew up, DNA was extracted for PCR identification and harvested. Homozygous transgenic lines were obtained after the T3 generation, and DNA was extracted for PCR identification and RNA was extracted for determination of its expression level.

[0024] Table 5 Infection suspension configuration Reagents Infection suspension preparation / 1 L sucrose 50 g MS salt 2.2 g 2-(N-Morpholino)ethanesulfonic acid monohydrate (MES) 0.5 g 6-BA (1 mg / mL) 9.9 μL Silicone surfactant (Silwet L-77) 200 μL KOH Adjust pH to 5.7 Table 6 1 / 2MS medium configuration Study on Salt Tolerance of Soybean GmVP6 Gene The T3 homozygous Arabidopsis lines OE-0, OE-1 and OE-2 (experimental group) overexpressing GmVP6 and the wild-type line WT of the Columbia ecotype Arabidopsis (control group) were identified, with the wild type as a negative control. The results showed that the T3 homozygous Arabidopsis lines OE-0, OE-1 and OE-2 (experimental group) were all overexpression lines ( Figure 2 A in Figure 2 The homozygous Arabidopsis lines OE-0, OE-1 and OE-2 (experimental groups) overexpressing GmVP6 and the wild-type line WT of the Columbia ecotype (control group) were cultured together in a square plate medium without NaCl for 4 days, and then transferred to square plate medium containing different concentrations of NaCl (Table 7) for 7 days.

[0025] Table 7 Square plate culture medium The three selected transgenic lines OE-0, OE-1 and OE-2 were treated with salt and phenotypes were observed. It was found that under salt treatment conditions, the transgenic lines grew better than WT ( Figure 2 C in Figure 2 Based on this phenotype, the aboveground fresh weight, underground fresh weight, root length, lateral root number and related indices of Arabidopsis thaliana under this treatment were measured.

[0026] 2.1 Aboveground fresh weight, underground fresh weight, root length, lateral roots We added 1 ml ddH2O to Arabidopsis seeds in 1.5 ml centrifuge tubes for vernalization at 4°C for two days before sowing, planted them in 1 / 2 MS medium and grew them for 4 days before transferring them to medium containing 0 / 50 / 75 / 100 mM / L After growing in NaCl 1 / 2 MS medium for 7 days, the taproot length, lateral root number, fresh weight of aboveground part and fresh weight of underground part were measured. The root length and lateral root number of Arabidopsis thaliana after 7 days of salt treatment were measured, and it was found that there was no difference under normal conditions. However, under salt treatment conditions, the transgenic lines OE-0, OE-1 and OE-2 did not show significant differences in root length compared with WT, but the number of lateral roots was significantly more than WT ( Figure 3 ). Subsequently, the aboveground fresh weight and underground fresh weight of the treated Arabidopsis were measured. The results showed that under normal conditions, the fresh weight of the transgenic strains was no different from that of the WT, but after salt treatment, the aboveground fresh weight and underground fresh weight of the transgenic strains were significantly higher than those of the WT ( Figure 3 ).

[0027] 2.2 Germination rate and greening rate To investigate the salt tolerance of transgenic lines, we vernalized Arabidopsis seeds in 1.5 ml centrifuge tubes at 4°C for two days before sowing, and then planted them in 0 / 50 / 100 / 150 mM / L The germination rate and greening rate of the seeds were recorded every 24 hours in NaCl 1 / 2 MS medium. The statistical results showed that there was no significant difference in germination rate and greening rate between WT and transgenic lines under the condition of no NaCl, but with the increase of salt stress concentration, that is, when exogenously applied 100 mM / L and 150 mM / L After NaCl treatment, the germination rate and greening rate of the transgenic lines were significantly higher than those of the WT ( Figure 4 , Figure 5 These results indicated that the transgenic lines of GmVP6 gene were more tolerant to salt stress.

[0028] 2.3 Determination of salt treatment related indicators For the determination of physiological and biochemical indices under salt treatment, Arabidopsis seeds were vernalized for two days at 4°C in a 1.5 ml centrifuge tube with 1 ml ddH2O before sowing, planted in 1 / 2 MS medium for 4 days, and then transferred to medium containing 0 / 50 / 75 / 100 mM / L The cells were grown in NaCl 1 / 2 MS medium for 7 days, and relevant physiological indices were measured.

[0029] MDA is a product of lipid peroxidation in the cell membrane. The accumulation of MDA will cause certain damage to the membrane and cells of the plant, resulting in a decrease in its tolerance to stress. Under normal conditions, the MDA concentration of the transgenic strains was no different from that of the WT. However, under salt stress conditions, the MDA activity of the GmVP6 transgenic Arabidopsis strains was lower than that of the WT, and the accumulation was less, that is, the degree of oxidative damage to the GmVP6 transgenic Arabidopsis strains under salt stress was low ( Figure 6 A in the figure). Under normal conditions, the activities of POD and SOD in the transgenic lines were similar to those in the WT. Under salt stress conditions, the activities of various oxides in both the WT and transgenic lines increased, and the enzyme activities of the GmVP6 transgenic lines in the root system were significantly higher than those in the WT ( Figure 6 B in Figure 6 C in.

[0030] 2.4 Related data processing Statistical significance analysis was performed using SPSS, Origin, and Graphpad.

[0031] The above-described embodiment is only a preferred solution of the present invention and does not limit the present invention in any form. There are other variations and modifications without exceeding the technical solution described in the claims.

[0032] SEQ ID No.1: SEQ ID No.2: 。

Claims

1. An application of soybean salt tolerance related gene GmVP6 in improving soybean salt tolerance, characterized in that: The nucleotide sequence of soybean salt tolerance related gene GmVP6 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: Up-regulate the expression level of soybean salt tolerance related gene GmVP6, thereby improving soybean salt tolerance.

3. A use of soybean salt tolerance related gene GmVP6 as a target for improving soybean salt tolerance, characterized in that: The nucleotide sequence of soybean salt tolerance related gene GmVP6 is shown in SEQ ID No.

1.

4. A method for improving the salt tolerance of soybeans, characterized in that: The salt tolerance of soybean is improved by overexpressing the soybean salt tolerance related gene GmVP6 in soybean.

5. The method according to claim 4, characterized in that The nucleotide sequence of the soybean salt tolerance related gene GmVP6 is shown in SEQ ID No.

1.

6. A soybean salt tolerance related gene GmVP6, characterized in that: The nucleotide sequence is shown in SEQ ID No.

1.

7. A protein encoded by soybean salt tolerance related gene GmVP6, characterized in that: The soybean salt tolerance related gene GmVP6 is obtained by transcription and translation of the nucleotide sequence shown in SEQ ID No.1, and its amino acid sequence is shown in SEQ ID No.2.

Images