Cyclopeptide construction method based on tyrosinase and application of cyclopeptide construction method in phage display cyclopeptide library

Abstract

The invention belongs to the technical field of polypeptide cyclization, and particularly provides a tyrosinase-based cyclopeptide construction method which comprises the following steps: S1, designing a polypeptide containing cysteine and tyrosine; and S2, dissolving the polypeptide in a buffer solution, and adding tyrosinase to react to obtain a cyclopeptide product. The construction method can realize intramolecular accurate cyclization, and has the advantages of mild reaction conditions, high biocompatibility and high selectivity. In addition, codon modification and non-natural amino acid doping are not involved, the library construction cost is reduced, the library capacity is improved, and a tool box for cyclopeptide construction is expanded. The method is applied to modification of a bacteriophage display polypeptide library, modification of tyrosinase-mediated cyclization on bacteriophages is achieved, and the biological activity of the bacteriophages is not affected. The cyclopeptide affinity ligand is elutriated for target protein, effective cyclopeptide conjugates and inhibitors are identified, and a new platform is provided for discovery of cyclopeptide drugs.

Description

Technical Field

[0001] The invention belongs to the technical field of polypeptide cyclization, and particularly relates to a tyrosinase-based cyclic peptide construction method and an application thereof in a phage display cyclic peptide library. Background Art

[0002] Cyclic peptides have the advantage of being more easily bound to challenging proteins due to their conformational constraints. The ability to resist hydrolysis by digestive enzymes and the increased ability to penetrate cell membranes make the cyclization of linear precursors an efficient approach to developing therapeutic agents and biorecognition tools. As a powerful platform for exploring high-affinity cyclic peptides, phage display technology has been shown to provide new approaches to discovering multiple modes of strong binding cyclic peptides targeting therapeutic targets by integrating post-translational cyclization modification strategies.

[0003] Chemical modification is a common strategy in peptide cyclization strategies. Among them, disulfide bonds generated by oxidation of multiple cysteine ​​side chains have been used to create tetracyclic peptides. It is common to use crosslinkers such as TBMB and DBMB to construct bicyclic or tricyclic symmetrical chemical skeletons, which have developed immunostimulants, toxin-coupled drugs, and radionuclide drug conjugates, and have made progress in clinical practice. The recognition of many asymmetric linkers such as lysine, N-terminal cysteine ​​or N-terminal amino acids is used to explore the generation of biologically active cyclic peptides with asymmetric skeletons. When using this type of approach to construct a basic cyclic peptide library, the cyclization efficiency is high and the operation is simple, but the intense cross-linking activity inevitably destroys the biological activity of the phage. Embedding electrophilic non-natural amino acids in the random sequence of the polypeptide with the help of genetic encoding is a relatively mild approach. This electrophilic non-natural amino acid has an ortho-reactive group, and ortho-cyclization modification after translation can further construct a cyclic peptide ligand with an asymmetric skeleton. This method is relatively mild to the infection activity of the phage, but the efficiency of introducing electrophilic non-natural amino acids needs to be improved. In order to increase the actual capacity of the cyclopeptide library, enzyme-induced cyclization has contributed new ideas to the display of cyclopeptides. The highly specific recognition characteristics make the biocompatibility of enzyme-catalyzed reactions show less phage toxicity, as evidenced by the construction of a phage-encoded library composed of lanthipeptide analogs facilitated by the early lanthipeptide synthetase. Recently, Sortase has also been reported to be used to connect the fixed sequence LPXTG with cysteine ​​in the random sequence, successfully pioneering the application of this type of ligase in the discovery of active cyclopeptides. However, although it has a certain degree of substrate heterogeneity, the high specificity of enzyme catalysis often means dependence on fixed sequences, so the C-terminal fusion strategy or the introduction of specific motifs brings complexity to the cyclization system and difficulty in operation. Summary of the invention

[0004] The purpose of the present invention is to overcome the instability of disulfide bond-linked cyclic peptides and the shortcomings of other chemical cyclization strategies such as low biocompatibility and poor reaction specificity.

[0005] To this end, the present invention provides a method for constructing a tyrosinase-based cyclic peptide, comprising the following steps:

[0006] S1. Design peptides containing cysteine ​​and tyrosine;

[0007] S2. Dissolve the polypeptide in buffer and add tyrosinase to react to obtain a cyclic peptide product.

[0008] Specifically, the sequence of the above polypeptide is ZAY-X n -CB or ZAC-X n -YB, where Z represents an amino acid with a hydrophobic side chain, Y represents tyrosine, C represents cysteine, and X represents n represents n random amino acids, A and B represent any number of amino acids at the N-terminus and C-terminus, respectively.

[0009] Specifically, the tyrosinase reaction concentration is 0.5-2.0 μM.

[0010] Specifically, the reaction temperature is 25-30° C., and the reaction time is 30-60 minutes.

[0011] The present invention also provides a method for constructing a tyrosinase-based phage display cyclic peptide library, comprising the following steps:

[0012] S1, fusing a polypeptide template containing tyrosine and a cysteine ​​in the sequence to the N-terminus of the phage PⅢ protein to obtain a phage library;

[0013] S2. Add a thiol reducing agent to the phage library to fully reduce the disulfide bonds on the phage, then add tyrosinase to react and obtain a tyrosinase-modified phage-displayed cyclic peptide library.

[0014] Specifically, the concentration ratio of the thiol reducing agent to the polypeptide is ≥1:1.

[0015] Specifically, the thiol reducing agent includes tris(2-carboxyethyl)phosphine salt.

[0016] The present invention also provides a method for screening cyclic peptide ligands, comprising the following steps:

[0017] S1, fusing a polypeptide template containing tyrosine and a cysteine ​​in the sequence to the N-terminus of the phage PⅢ protein to obtain a phage library;

[0018] S2, adding a thiol reducing agent to the phage library to fully reduce the disulfide bonds on the phage, and then adding tyrosinase to react to obtain a tyrosinase-modified phage display cyclic peptide library;

[0019] S3, adding the target protein to the phage display cyclic peptide library for co-incubation;

[0020] S4. After incubation, the specifically bound phages are eluted and recovered to screen out the cyclic peptide ligands with specific binding.

[0021] Specifically, the above-mentioned target proteins include but are not limited to PTP-1B, NEK7 and PIP4K2A.

[0022] Specifically, the peptide sequences screened for PTP-1B are as follows:

[0023] NH2-AYFQIGSQQRGC-CONH2;

[0024] The peptide sequences screened for NEK7 are as follows:

[0025] NH2-AYALRQGPGQAC-CONH2;

[0026] NH2-AYFSRAGSQRVC-CONH2;

[0027] The peptide sequences screened for PIP4K2A are as follows:

[0028] NH2-AYIPSEHVRC-CONH2;

[0029] NH2-AYHSRKRHMFQC-CONH2.

[0030] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0031] The tyrosinase-based cyclic peptide construction method provided by the present invention has simple and mild reaction conditions, high biocompatibility, and high reaction selectivity. In addition, it does not involve the modification of complex codons and the incorporation of non-natural amino acids, which greatly reduces the cost of library construction and also increases the library capacity, expanding the toolbox for cyclic peptide construction and providing possibilities for the development of polypeptide drugs, disease detection and treatment.

[0032] This method was applied to the modification of phage-displayed peptide libraries, allowing peptides attached to the capsid protein to undergo precise intramolecular cyclization without affecting the biological activity of the phage, achieving successful modification of tyrosinase-mediated cyclization on the phage. The cyclic peptide affinity ligands were selected for the target protein, and effective cyclic peptide binders and inhibitors were identified, providing a new platform for the discovery of cyclic peptide drugs.

[0033] The present invention will be further described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of tyrosinase-mediated polypeptide cyclization modification.

[0035] Figure 2 This is a characterization diagram of tyrosinase activity under different pH conditions.

[0036] Figure 3 This is the mass spectrometry characterization of tyrosinase cyclization modification on the capsid protein.

[0037] Figure 4 is the catalytic efficiency of tyrosinase at different concentrations on phage.

[0038] Figure 5 This is a characterization diagram of phage titer under different conditions.

[0039] Figure 6 Flowchart for phage display panning.

[0040] Figure 7 This is the NGS sequencing analysis diagram for the PIP4K2A selection results.

[0041] Figure 8 This is the peptide sequence diagram obtained by decoding PIP4K2A through panning sequencing.

[0042] Fig. 9 This is the enriched peptide sequence and corresponding abundance map decoded after sequencing of the target protein PTP-1B.

[0043] Fig.10 This is a diagram of the biolayer interference experiment measurement of ACI1 and the target protein PIP4K2A.

[0044] Fig.11 This is a diagram of the biolayer interference experiment measurement of ACI2 and the target protein PIP4K2A.

[0045] Fig.12 This is a diagram of the biolayer interference experiment measurement of ACP1 and the target protein PTP-1B.

[0046] Fig.13 This is a diagram of the biolayer interference experiment measurement of ACN1 and the target protein NEK7.

[0047] Fig.14 This is a diagram of the biolayer interference experiment measurement of ACN2 and the target protein NEK7.

[0048] Fig.15 This is the result of the in vitro activity inhibition experiment of the cyclic peptide and linear peptide obtained by panning PIP4K2A on the enzyme.

[0049] Fig.16 This is a diagram of the in vitro activity inhibition experiment of ACP1 and AP1 on PTP-1B.

[0050] Fig.17 The affinity and half-inhibitory concentration values ​​of the cyclic peptides obtained by panning for three target proteins. DETAILED DESCRIPTION

[0051] The technical scheme in the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Although the representative embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be limited by the attached claims and their equivalents.

[0052] The present invention provides a method for constructing a tyrosinase-based cyclic peptide, comprising the following steps:

[0053] S1. Design peptides containing cysteine ​​and tyrosine.

[0054] The sequence of the polypeptide is ZAY-X n -CB or ZAC-X n -YB, where Z represents an amino acid with a hydrophobic side chain, Y represents tyrosine, C represents cysteine, and X represents n represents n random amino acids, A and B represent any number of amino acids at the N-terminus and C-terminus, respectively.

[0055] S2. Dissolve the polypeptide in a buffer solution, add tyrosinase, use tyrosinase to oxidize the tyrosine in the polypeptide and then couple it with the cysteine ​​residue in the polypeptide to produce a cyclic peptide molecule to obtain a cyclic peptide product. The product can be analyzed and characterized by high performance liquid chromatography and mass spectrometry.

[0056] Specifically, the buffer is preferably a phosphate / carbonate solution with a pH of 5-9; the tyrosinase reaction concentration is 0.5-2.0 μM; the reaction temperature is 25-30° C., and the reaction time is 30-60 minutes.

[0057] The present invention also provides a method for constructing a tyrosinase-based phage display cyclic peptide library, comprising the following steps:

[0058] S1. A polypeptide template containing tyrosine and one cysteine ​​in the sequence is fused to the N-terminus of the phage PⅢ protein to obtain a phage library.

[0059] Specific, template: ZY-X n -C; wherein Z represents an amino acid with a hydrophobic side chain, Y represents tyrosine, C represents cysteine, X represents any amino acid, and n represents the number of any amino acid;

[0060] Preferably, the polypeptide sequence fused and expressed on the surface of the phage is: ZYXXXXXXXC (ZY-X7-C) or ZKXXXXXXXXXC (ZY-X9-C). Random amino acid mutations are introduced at the specified position by the NNK method, and the corresponding DNA sequence is designed according to the polypeptide sequence (the amino acid used for Z in the embodiment of the present invention is alanine).

[0061] AY-X7-C: 5'-CATGCTGCCATGGCTGCCTATNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA-3';

[0062] AY-X9-C: 5'-CATGCTGCCATGGCTGCCTATNNKNNKNNKNNKNNK NNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA-3'.

[0063] The number of amino acids in the above DNA sequence can be increased or decreased as needed. All changes in polypeptide configuration and other modification methods made in the present invention should be considered within the scope of protection of this patent.

[0064] S2. Add a thiol reducing agent to the phage library to fully reduce the disulfide bonds on the phage, then add tyrosinase to react and obtain a tyrosinase-modified phage-displayed cyclic peptide library.

[0065] The thiol reducing agent is preferably tris(2-carboxyethyl)phosphine (TCEP), and the concentration ratio of TCEP to the polypeptide is ≥1:1;

[0066] The general formula of the cross-linker structure used to construct the phage display cyclic peptide library is:

[0067]

[0068] Among them, the R group includes H, NH2, and CH3.

[0069] In a detailed embodiment, the method for constructing a phage display cyclic peptide library comprises the following steps:

[0070] S1. The phagemid library was constructed by insertion method using pSEX81 plasmid as template. Two primers YC7M-F: 5'-CATGCTGCCATGGCTGCCTATNNKNNKNNKNNK NNKNNKTGTGCTGGTTCAGGTGGATCCAAA-3' and LM-R: 5'-CATGTTT GGATCCACCTGAACC-3' were used for extension. The extension product and pSEX81 template were digested with restriction enzymes BamHI and Ncol to produce the same sticky ends.

[0071] The vector and the extension fragment with the same sticky ends after enzyme digestion were connected at 16°C for 36 hours using T4 DNA ligase, and the ligation product was transformed into Escherichia coli TG1 competent cells by electroporation to evaluate the ligation and transformation efficiency, and finally an M13 phage library displaying the random polypeptide was obtained.

[0072] S2, towards a titer greater than 10 10 TCEP was added to a phage library containing at least one cysteine ​​and one tyrosine at the N-terminus at a final concentration of 1 mM, and the phage library was reduced at 30°C for 1 hour, followed by the addition of 1 μM tyrosinase at 25°C for 1 hour, and after the reaction, a PEG-NaCl solution was added, and the mixture was placed on ice to precipitate the phage. After precipitation, the phage was centrifuged, the supernatant was removed, and the precipitate was resuspended in a phosphate buffer / carbonate buffer solution to obtain a tyrosinase-modified phage-displayed cyclic peptide library.

[0073] The amount of PEG-NaCl added is 1 / 5 of the total volume; the incubation time on ice can be 2 to 6 hours; and the centrifugation condition can be centrifugation at 8000 rpm for 20 minutes.

[0074] The present invention also provides a method for screening cyclic peptide ligands, comprising the following steps:

[0075] S1, fusing a polypeptide template containing tyrosine and a cysteine ​​in the sequence to the N-terminus of the phage PⅢ protein to obtain a phage library;

[0076] S2, adding a thiol reducing agent to the phage library to fully reduce the disulfide bonds on the phage, and then adding tyrosinase to react to obtain a tyrosinase-modified phage display cyclic peptide library;

[0077] S1-S2 preferably adopts the above-mentioned tyrosinase-based phage display cyclic peptide library construction method.

[0078] S3, adding the target protein to the phage display cyclic peptide library for co-incubation;

[0079] Target proteins include but are not limited to PTP-1B, NEK7 and PIP4K2A.

[0080] S4. After incubation, the specifically bound phages are eluted and recovered to screen out the cyclic peptide ligands with specific binding.

[0081] Specifically, after incubation, unbound and low-affinity phages are washed away, and specifically bound phages are eluted and recovered and amplified for the next round of screening; after multiple rounds of in vitro screening (generally 3-5 rounds), phages bound to the target protein are effectively enriched; single clones of the colonies are picked for DNA sequencing, and the amino acid sequence bound to the target protein is decoded to obtain the desired cyclic peptide ligand.

[0082] The peptide sequences screened for PTP-1B are as follows:

[0083] NH2-AYFQIGSQQRGC-CONH2;

[0084] The peptide sequences screened for NEK7 are as follows:

[0085] NH2-AYALRQGPGQAC-CONH2;

[0086] NH2-AYFSRAGSQRVC-CONH2;

[0087] The peptide sequences screened for PIP4K2A are as follows:

[0088] NH2-AYIPSEHVRC-CONH2;

[0089] NH2-AYHSRKRHMFQC-CONH2.

[0090] After the peptides with higher enrichment are synthesized, they are subjected to cyclization reaction. The affinity between the cyclic peptide ligand and the target protein is verified by biophysical experiments to test the feasibility and effectiveness of the cyclization and screening methods.

[0091] In a detailed embodiment, the cyclic peptide ligand screening method comprises the following steps:

[0092] S1. The phagemid library was constructed by insertion method using pSEX81 plasmid as template. Two primers YC7M-F: 5'-CATGCTGCCATGGCTGCCTATNNKNNKNNKNNK NNKNNKTGTGCTGGTTCAGGTGGATCCAAA-3' and LM-R: 5'-CATGTTT GGATCCACCTGAACC-3' were used for extension. The extension product and pSEX81 template were digested with restriction enzymes BamHI and Ncol to produce the same sticky ends.

[0093] The vector and the extension fragment with the same sticky ends after enzyme digestion were connected at 16°C for 36 hours using T4 DNA ligase, and the ligation product was transformed into Escherichia coli TG1 competent cells by electroporation to evaluate the ligation and transformation efficiency, and finally an M13 phage library displaying the random polypeptide was obtained.

[0094] S2, towards a titer greater than 10 10 TCEP was added to a phage library containing at least one cysteine ​​and one tyrosine at the N-terminus at a concentration of 1 mM, and the phage library was reduced at 30°C for 1 hour, followed by the addition of 1 μM tyrosinase at 25°C for 1 hour, and after the reaction, a PEG-NaCl solution was added, and the mixture was placed on ice to precipitate the phage. After precipitation, the phage was centrifuged, the supernatant was removed, and the precipitate was resuspended in a phosphate buffer / carbonate buffer solution to obtain a tyrosinase-modified mono-phage displayed cyclic peptide library.

[0095] The amount of PEG-NaCl added is 1 / 5 of the total volume; the incubation time on ice can be 2 to 6 hours; and the centrifugation condition can be centrifugation at 8000 rpm for 20 minutes.

[0096] S3. Add 5 μL of streptavidin magnetic beads to the phage display cyclic peptide library and block with 0.5% Tween20 containing 2% BSA at 25°C for 4 hours. After blocking, remove the magnetic beads, add the target protein, bind overnight at 4°C / 25°C, take 20 μL of streptavidin magnetic beads and block with TBS containing 2% BSA at 37°C for 2 hours, and incubate the conjugate with the blocked streptavidin magnetic beads at 25°C for 30 minutes.

[0097] S4. Wash away unbound and low-affinity phages, elute and recover specifically bound phages and amplify them for the next round of screening. After multiple rounds of in vitro screening, phages bound to the target protein are effectively enriched. Single clones of the colonies are picked for DNA sequencing to decode the amino acid sequence bound to the target protein.

[0098] The following specific examples are used to study the effects of the tyrosinase-based cyclic peptide construction method, phage display cyclic peptide library construction method and application of the present invention.

[0099] Embodiment 1:

[0100] Reference Figure 1 This embodiment provides a method for constructing a tyrosinase-based cyclic peptide, comprising the following steps:

[0101] S1. Design of peptides containing cysteine ​​and tyrosine

[0102] AY-X7-C:AYXXXXXXXC;

[0103] AY-X9-C:AYXXXXXXXXXC.

[0104] A represents alanine, Y represents tyrosine, C represents cysteine, and X represents a random amino acid.

[0105] Preparation of tyrosinase:

[0106] After the megTYR: protease cDNA was transduced into competent cells using E. coli BL21 (DE3), the cells were cultured overnight on LB solid medium. A single bacterium was selected and cultured to saturation on a small scale. 3 mL of the saturated culture was added to 1 L LB liquid medium containing 100 μg / mL ampicillin antibiotics and cultured at 37°C and 220 rpm until the OD 600 Reach 0.6-0.8. Then add 0.2mM IPTG to induce expression overnight at 18℃220rpm. Collect the cells by centrifugation at 6000rpm for 20 minutes and pour out the supernatant. Suspend the cells in 50mL lysis buffer (50mM Tris-HCl, pH 8.0, 500mM NaCl, 10mM imidazole, 0.1mM PMSF) and ultrasonically lyse. Collect the lysate, separate the cell debris by centrifugation at 10000rpm for 20 minutes, filter the supernatant with a 0.45μm filter membrane, and flow through the Trap (Ni 2+ ) column, wash the sample with 10CV of elution buffer (50mM Tris-HCl, pH 8.0, 500mM NaCl, 120mM imidazole), and then elute the protein sample with elution buffer (50mM Tris-HCl, pH 8.0, 500mM NaCl, 600mM imidazole). The eluted sample was analyzed by 12% SDS-PAGE. The purified protein sample was incubated with 50 times copper sulfate for 1 hour to activate tyrosinase. The activated protein was replaced into storage buffer (20mM HEPES, pH 7.5, 150mM NaCl, 20% glycerol) with a concentrator tube and stored at -80°C.

[0107] The activity of tyrosinase was characterized under different pH conditions. Figure 2 shown.

[0108] S2. Dissolve the polypeptide powder in a phosphate buffer with a pH of 7.4, add 1 μM tyrosinase and react at 25°C for 1 hour, use tyrosinase to oxidize the tyrosine in the polypeptide and then couple it with the cysteine ​​residue in the polypeptide to produce a cyclic peptide molecule to obtain a cyclic peptide product.

[0109] Since there is only one cysteine ​​on the polypeptide template that will not form a disulfide bond, there is no need to add TCEP for reduction when performing cyclization on the polypeptide.

[0110] Embodiment 2:

[0111] This embodiment provides a method for constructing a tyrosinase-based phage display cyclic peptide library, comprising the following steps:

[0112] S1. Pattern peptide 1 (AYGTHKWMC) was fixed on the N-terminus of the N1N2 domain of the pIII protein, and then the genetic gene of the recombinant protein was transduced into BL21 (DE3) Escherichia coli by chemical transformation for fusion expression.

[0113] S2. Tyrosinase was prepared by the same method as in Example 1. The purified fusion protein in S1 was placed in a 7.4 buffer at a final concentration of 0.1 mM, 1 mM TCEP was added and reacted at 30°C for 1 hour to expose the sulfhydryl groups on the protein, and finally 1 μM tyrosinase was added at 25°C to initiate the cyclization reaction. After incubation for 1 hour, the modified protein was separated and purified using molecular sieves, and the molecular weight of the pure product was determined by MS ( Figure 3 ). The MS data showed that the protein sample after enzyme catalysis had a corresponding mass shift compared to the unmodified protein, indicating that the fusion line peptide on the pIII protein was cyclized, and also indicating that the substrate tolerance of tyrosinase is adapted to the capsid protein as a peptide fusion carrier.

[0114] Embodiment 3:

[0115] This example provides a set of phage-displayed cyclic peptide libraries, which are constructed using the following steps.

[0116] 1. Construction of phage library

[0117] 1.1. The polypeptide sequence displayed on the surface of the phage is: AYXXXXXXXC (AY-X7-C) or AKXXXXXXXXXC (AY-X9-C). By the NNK method, random amino acid mutations are introduced at the specified position, and the corresponding DNA sequence is designed according to the polypeptide sequence.

[0118] AY-X7-C: 5'-CATGCTGCCATGGCTGCCTATNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA-3';

[0119] AY-X9-C: 5'-CATGCTGCCATGGCTGCCTATNNKNNKNNKNNKNNK NNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA-3'.

[0120] The library fragment was inserted into the phagemid vector pSEX81 using the BamHI and NcoI restriction sites.

[0121] 1.2. Construction of AY-X7-C library

[0122] Primers YC7M-F: CATGCTGCCATGGCTGCCTATNNKNNKNNKN NKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAAH and LM-R: CATG TTTGGATCCACCTGAACC were designed, 10×E×Taq buffer was added, the system was filled with water, and the system was naturally cooled to 25°C in 95°C water for annealing. The annealed sample was then added with DNTP Mix (10mM), Klenow enzyme, NEB buffer2, and water to the system, and then extended according to the program of 37°C for 10 minutes, 65°C for 15 minutes, and 37°C for 15 minutes. The extended sample was double-digested with BamHI and NcoI, and the digestion product was recovered by PAGE gel; at the same time, the pSEX81 vector was double-digested with BamHI and NcoI and recovered by 2% agarose gel, and then the vector and the target fragment were connected with T4 DNA ligase. The ligated plasmid was transformed into competent E. coli TG1 by electroporation to evaluate the ligation and transformation efficiency. The transformant was incubated with 1 mL of LB medium at 37°C and 220 rpm for one hour, 10 μL of the sample was diluted to determine the titer, and 20 single clones were randomly selected for DNA sequencing.

[0123] 1.3. Construction of AY-X9-C library

[0124] Primers YC9M-F: CATGCTGCCATGGCTGCCTATNNKNNKNNKN NKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAAH and LM-R: CATGTTTGGATCCACCTGAACC were designed. The AY-X9-C library was constructed using the same steps as S1.2.

[0125] 2. Preparation of phage cyclic peptide library

[0126] The transformed sample constructed in step 1 was inoculated into 500 mL of LB medium containing 50 μg / mL carbenicillin, and 400 mL of the medium was cultured at 37°C and 220 rpm until the OD 600 After the mixture was diluted to 0.8-1.0, it was mixed with 50% glycerol and placed in a -80°C refrigerator for subsequent use; the remaining 100 mL was cultured until the OD 600After the pH value is 0.4-0.6, helper phage is added to infect at 37°C for 2 hours, and then 0.5mM IPTG is added to culture at 37°C for 12-14 hours, and the bacterial precipitate is removed by centrifugation at 4°C and 8000rpm for 20 minutes to collect the supernatant, and 1 / 5 volume of PEG-NaCl is added to precipitate the supernatant containing phage (it can be placed on ice for precipitation for 4-6 hours or at 4°C overnight), and the precipitate is collected by centrifugation at 4°C and 8000rpm for 20 minutes, and 2mL PBS buffer is added for resuspending, and 1mM TCEP is added to reduce the phage library, and then divided into 6 groups, 0, 0.1μM, 0.3μM, 0.6μM, 0.9μM, and 1μM tyrosinase are added for cyclization at 25°C for 1 hour, and 1 / 5 volume of PEG-NaCl is added to precipitate the phage library, and the precipitate is collected by centrifugation at 4°C and 10000rpm for 1 minute. Finally, the precipitate is resuspended with PBS buffer to obtain a phage cyclic peptide library, and the recovery rate of each group is detected. The results are as follows Figure 4 As shown, 1 μM was selected for subsequent experiments.

[0127] 3. Determination of the titer of phage cyclic peptide library

[0128] Take 10 μL of the test solution and add 990 μL of 2×YT liquid medium to dilute it. Take 10 μL of the dilution solution and add 990 μL of 2×YT liquid medium to dilute it. Then dilute it step by step to 10 -8 -10 -10 , take 10 μL of the dilution and add it to 150 μL of TG1 Escherichia coli in the logarithmic growth phase, place it at 37°C for 30 minutes, then evenly spread the culture on the surface of a solid plate containing 50 μg / mL carbenicillin, invert it in a 37°C constant temperature incubator and culture it for 12 hours, take it out and count it to calculate its titer. The result is as follows Figure 5 shown.

[0129] Embodiment 4:

[0130] Reference Figure 6 This embodiment provides a method for screening cyclic peptide ligands, which specifically includes the following steps.

[0131] 1. Construction of phage display cyclic peptide library

[0132] The same method as in Example 3 was used to construct.

[0133] 2. Selection

[0134] Add 5 μL of streptavidin magnetic beads to the cyclic peptide library and block with 0.5% Tween 20 containing 2% BSA at 25°C for 4 hours. After blocking, remove the magnetic beads, add the target protein (PTP-1B, NEK7, PIP4K2A), bind overnight at 4°C / 25°C, take 20 μL of streptavidin magnetic beads and block with TBS containing 2% BSA at 37°C for 2 hours, incubate the conjugate with the blocked streptavidin magnetic beads at 25°C for 30 minutes, then wash and remove the unbound and low-affinity phages, add 200 μL of PH=2.2 Gly-HCl (containing 1% BSA) and elute at 25°C 60rpm for 10 minutes, then add 30 μL Neutralize with Tris-HCl at pH 9.1, collect the eluate, take 10 μL of the eluate, dilute it according to the above step 4), infect TG1 in the logarithmic growth phase and measure the titer; then amplify it for the next round of screening; after 3 rounds of in vitro screening, the phage clones binding to the target protein are effectively enriched.

[0135] 3. Sequencing

[0136] The three rounds of screening products were infected with TG1 Escherichia coli and the plasmid was extracted. The second-generation sequencing library was constructed with two primers, TS-F: AATGATACGGCGACCACCGAGATCTACACTATAGCCTTCGTCGGCAGC GTCAGATGTGTATAAGAGACAGCCGGCTCGTATGTTGTGTG and TS-R: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG AGATGTGTATAAGAGACAGGTCGTCTTTCCAGACGTTAG, to decode the amino acid sequence bound to the target protein. The results are shown in Figure 7-9 shown.

[0137] 4. Solid phase synthesis of peptide sequences

[0138] 4.1. Swelling resin:

[0139] Weigh 0.5 g of RinkAmide Resin with a degree of substitution of 0.93, pour it into a reaction bottle, and add 30 mL of DMF to swell for 1 hour.

[0140] 4.2 Deprotection

[0141] The DMF in the reaction bottle was drained, and a 20% piperidine / DMF solution was added to remove Fmoc. The reaction was continued for 15 minutes, and the reaction was repeated once. The reaction was drained, and the reaction was washed with DMF for 5 times and drained.

[0142] 4.3 Condensation reaction

[0143] The condensation was carried out using a combination of HOBT / HBTU / DIEA activators, 3 equivalents of HOBT / HBTU and Fmoc-amino acid were added, dissolved in DMF and added to the reaction bottle, DIEA was added, nitrogen was agitated, the reaction was carried out for 2 hours, and then the mixture was dried.

[0144] 4.4. Detection and washing

[0145] Take a little resin from the reaction bottle, put it into a small test tube, wash it with DMF, add ninhydrin solution and heat it at 100℃ for 3 minutes, take it out and observe the color of the resin. If the resin does not turn purple or blue, it indicates that the condensation reaction is complete. Stop the reaction, drain, and wash it with DMF 3 times. If the color of the resin is detected to be blue or purple or other colors, it means that the reaction is not complete. Drain and wash it 3 times, weigh the same amount of the current reaction and put it into the reaction column to react again until the detection reaction is complete.

[0146] 4.5. Repeated condensation

[0147] Repeat steps 4.2-4.4 for the subsequent amino acid connections. The amounts of different amino acids are weighed using the same algorithm, and the amounts of HOBT / HBTU / DIEA remain unchanged.

[0148] 4.6. Shrinkage

[0149] After the last amino acid is connected, repeat step 2), then wash with DCM 3 times, methanol 3 times, drain, and place the resin in a fume hood to dry.

[0150] 4.7 Acetylation

[0151] Add 20 mL of a mixed solution of pyridine: anhydrous dichloroethylene: acetic anhydride = 1:2:1, react at room temperature for 1 hour, and drain.

[0152] 4.8 Inspection

[0153] Take a small amount of resin from the reaction bottle, put it into a small test tube, add ninhydrin solution and heat at 100℃ for 3 minutes, take out and observe the color of the resin. If the resin does not turn purple or blue, it indicates that the acetylation reaction is complete. Stop the reaction, wash with DMF 3 times, DCM 3 times, and methanol 3 times, and dry. If the color of the resin is detected to be blue, purple or other colors, it means that the reaction is not complete. Continue to add acetylation reagent to react until the reaction is complete.

[0154] 4.9. Cut off

[0155] Add 20 mL of cutting agent (TFA / Tris / H2O=19 / 0.5 / 0.5) to the reaction bottle, stir and react for 2 hours, collect the filtrate, remove the liquid inside by rotary evaporation, add ether to precipitate, at this time the polypeptide is precipitated to form a polypeptide ether suspension, transfer the above liquid to a 50 mL centrifuge tube, centrifuge at 7000 rpm for 5 minutes, pour off the supernatant, add ether to wash, repeat 2 times, vacuum dry, remove the ether residue, and the obtained solid is the crude target polypeptide.

[0156] 4.10 Purification

[0157] The crude product is dissolved in water or methanol, filtered, and separated and purified by high performance liquid chromatography to finally obtain a pure target polypeptide with a purity of more than 95%.

[0158] According to the enriched polypeptide sequences obtained from the sequencing results, the following polypeptides were synthesized, including but not limited to:

[0159] The peptide sequences screened for PTP-1B are as follows:

[0160] NH2-AYFQIGSQQRGC-CONH2(ACP1);

[0161] The peptide sequences screened for NEK7 are as follows:

[0162] NH2-AYALRQGPGQAC-CONH2(ACN1);

[0163] NH2-AYFSRAGSQRVC-CONH2(ACN2);

[0164] The peptide sequences screened for PIP4K2A are as follows:

[0165] NH2-AYIPSEHVRC-CONH2(ACI1);

[0166] NH2-AYHSRKRHMFQC-CONH2(ACI2).

[0167] 5. The synthesized polypeptide was cyclized and purified by HPLC, and freeze-dried using a vacuum freeze dryer for subsequent experiments.

[0168] Embodiment 5:

[0169] In this example, the performance of the cyclic peptide prepared in Example 4 was tested, as follows.

[0170] 1. Biolayer interference experiment to determine the affinity between target protein and linear peptide and cyclic peptide

[0171] ACI1 was diluted to 50nM, 100nM, 200nM, 400nM, and 800nM with 0.05% PBS-Tween 20, and the target protein PIP4K2A was diluted to 20μg / mL with 0.05% PBS-Tween 20. At the same time, no target protein and no peptide ligand were set as the background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted. After three parallel experiments, the average value was calculated to obtain the affinity between the ACI1 cyclic peptide ligand and PIP4K2A, which was 0.45±0.03μM ( Fig.10 ); The affinity between the ACI2 cyclic peptide ligand and PIP4K2A was also calculated to be 0.76±0.05μM ( Fig.11 ).

[0172] ACP1 was diluted to 62.5nM, 125nM, 250nM, 500nM, and 1000nM with 0.05% PBS-Tween 20, and the target protein PTP-1B was diluted to 20μg / mL with 0.05% PBS-Tween 20. At the same time, no target protein and no peptide ligand were set as the background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted. After three parallel experiments, the average value was calculated to obtain the affinity between the ACP1 cyclic peptide ligand and PTP-1B, which was 0.32±0.03μM ( Fig.12 ).

[0173] ACN1 was diluted to 0.1mM, 0.2mM, 0.5mM, 1mM, and 2mM with 0.05% PBS-Tween 20, and the target protein NEK7 was diluted to 20μg / mL with 0.05% PBS-Tween 20. At the same time, no target protein and no peptide ligand were set as the background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted. After three parallel experiments, the average value was calculated to obtain the affinity between the ACN1 cyclic peptide ligand and NEK7, which was 0.62±0.18μM ( Fig.13 ); Similarly, ACN2 was diluted to 0.25mM, 0.5mM, 1mM, 2mM, and 4mM with 0.05% PBS-Tween 20, and the target protein NEK7 was diluted to 20μg / mL with 0.05% PBS-Tween20. At the same time, no target protein and no peptide ligand were set as the background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted. After three parallel experiments, the average value was calculated to obtain the affinity between the ACN2 cyclic peptide ligand and NEK7, which was 1.17±0.40μM ( Fig.14 ).

[0174] 2. Determination of half-inhibitory concentration of targeted kinases

[0175] The cyclic peptide ACI1 and the corresponding linear peptide AI1 were prepared into 0.1μM, 0.2μM, 0.5μM, 1μM, 2μM, 5μM, 10μM, 20μM, 50μM, 100μM, and 200μM, respectively. 1μL of each concentration was added to a 96-well plate, and 90μL of a mixture containing enzyme and buffer (25mM HEPES, pH 7.8, 0.3mM EGTA, 0.1% CHAPS, 5mM MgCl2, 12.5mM NaCl, 1mM TCEP) was added to each well. After the addition was completed, the plate was placed in a constant temperature incubator at 24°C and incubated for 20 minutes. After adding 5 μL of ATP (200 μM) and substrate (PI(5)P-diC8, 300 μM) to each well, the wells were incubated again at 24°C for 60 minutes. Then, 5 μL of ADP-Glo ​​reagent was added to each well and incubated at 24°C for 45 minutes to quench the reaction. Finally, 5 μL of kinase detection solution containing luciferase was added. The luminescence intensity of the sample was measured using a chemiluminometer, and the residual enzyme activity was calculated using the formula and the corresponding IC 50 value.

[0176] The residual enzyme activity of PIP4K2A at different ACI1 and AI1 (uncyclized ACI1) ligand concentrations was determined as follows: Fig.15 As shown in Table 1, the half-inhibitory concentration of ACI1 on the kinase activity of PIP4K2A was calculated to be 0.93±0.05 μM, and the half-inhibitory concentration of AI1 on the kinase activity of PIP4K2A was >100 μM.

[0177] Table 1 Residual enzyme activity of PIP4K2A at different ACI1 and AI1 ligand concentrations

[0178] Concentration (μM) ACI1 residual enzyme activity (%) AI1 residual enzyme activity (%) 0.1 98.93 98.35 0.2 95.26 98.88 0.5 89.55 97.94 1 81.52 96.42 2 67.19 96.13 5 45.85 95.82 10 41.84 92.22 20 31.28 89.16 50 24.96 78.43 100 23.11 62.35 200 21.13 46.76

[0179] The half-inhibitory concentrations of ACI2 and AI2 (uncyclized ACI2) on the kinase activity of PIP4K2A were calculated using the same method. Fig.15 As shown in Table 2 , the half-inhibitory concentration of ACI2 on the kinase activity of PIP4K2A was 11.6±2.74 μM, and the half-inhibitory concentration of AI1 on the kinase activity of PIP4K2A was >100 μM.

[0180] Table 2 Residual enzyme activity of PIP4K2A at different ACI2 and AI2 ligand concentrations

[0181]

[0182]

[0183] 3. Determination of half-inhibitory concentration for targeting PTP-1B

[0184] The cyclic peptide ACP1 and the linear peptide AP1 were prepared into 0.1μM, 0.2μM, 0.5μM, 1μM, 2μM, 5μM, 10μM, 20μM, 50μM, and 100μM, respectively. 1μL of each concentration was added to a 96-well plate, and 90μL of a mixture containing enzyme and buffer was added to each well. After the addition was completed, it was placed in a 37°C constant temperature incubator for 10 minutes. After adding 10μL of substrate (pNPP, 6mM) to each well, it was placed in a 37°C constant temperature incubator for incubation for 30 minutes again, and then sodium hydroxide aqueous solution (final concentration of 1M) was added to the wells to quench the reaction. Finally, the OD value was measured at 405nm using an enzyme reader, and the residual enzyme activity was calculated using the formula and the corresponding IC 50 value.

[0185] The half-inhibitory concentrations of ACP1 and AP1 on the dephosphorylation activity of PTP-1B were calculated. Fig.16 As shown, the half-inhibitory concentration of ACP1 on the dephosphorylation activity of PTP-1B was 1.06±0.25 μM, and the half-inhibitory concentration of AP1 on the dephosphorylation activity of PTP-1B was 52.94±4.17 μM.

[0186] Table 3 Residual enzyme activity of PTP-1B at different ACP1 and AP1 ligand concentrations

[0187]

[0188]

[0189] The total results of affinity and half-inhibitory concentration are as follows Fig.17 shown.

[0190] In summary, the present invention provides a strategy of cyclization and phage display fusion dominated by the catalytic activity of tyrosinase. Furthermore, effective cyclotide binders and inhibitors were identified selectively for medical proteins using a cyclotide library. These results reveal the first application of tyrosinase-mediated post-translational cyclization modification on a phage display platform, and the hits of several high-affinity cyclotides indicate that this system has the potential to become an ideal cyclotide drug discovery platform.

[0191] The above examples are merely illustrative of the present invention and do not constitute a limitation on the protection scope of the present invention. All designs that are the same or similar to the present invention fall within the protection scope of the present invention.

Claims

1. A method for constructing a tyrosinase-based cyclic peptide, characterized in that: The following steps are involved: S1. Design peptides containing cysteine ​​and tyrosine; S2. Dissolve the polypeptide in buffer and add tyrosinase to react to obtain a cyclic peptide product.

2. The method for constructing a tyrosinase-based cyclic peptide according to claim 1, characterized in that: The sequence of the polypeptide is ZAY-X n -CB or ZAC-X n -YB, where Z represents an amino acid with a hydrophobic side chain, Y represents tyrosine, C represents cysteine, and X represents n represents n random amino acids, A and B represent any number of amino acids at the N-terminus and C-terminus, respectively.

3. The method for constructing a tyrosinase-based cyclic peptide according to claim 1, characterized in that: The tyrosinase reaction concentration is 0.5-2.0 μM.

4. The method for constructing a tyrosinase-based cyclic peptide according to claim 1, characterized in that: The reaction temperature is 25-30° C., and the reaction time is 30-60 minutes.

5. A method for constructing a tyrosinase-based phage display cyclic peptide library, characterized in that: The following steps are involved: S1, fusing a polypeptide template containing tyrosine and a cysteine ​​in the sequence to the N-terminus of the phage PⅢ protein to obtain a phage library; S2. Add a thiol reducing agent to the phage library to fully reduce the disulfide bonds on the phage, then add tyrosinase to react and obtain a tyrosinase-modified phage-displayed cyclic peptide library.

6. The method for constructing a tyrosinase-based phage display cyclic peptide library according to claim 5, characterized in that: The concentration ratio of the thiol reducing agent to the polypeptide is ≥1:

1.

7. The method for constructing a tyrosinase-based phage display cyclic peptide library according to claim 5, characterized in that: The thiol reducing agent includes tris(2-carboxyethyl)phosphine salt.

8. A method for screening cyclic peptide ligands, characterized in that: The following steps are involved: S1, fusing a polypeptide template containing tyrosine and a cysteine ​​in the sequence to the N-terminus of the phage PⅢ protein to obtain a phage library; S2, adding a thiol reducing agent to the phage library to fully reduce the disulfide bonds on the phage, and then adding tyrosinase to react to obtain a tyrosinase-modified phage display cyclic peptide library; S3, adding the target protein to the phage display cyclic peptide library for co-incubation; S4. After incubation, the specifically bound phages are eluted and recovered to screen out the cyclic peptide ligands with specific binding.

9. The method for screening cyclic peptide ligands according to claim 8, characterized in that: The target proteins include but are not limited to PTP-1B, NEK7 and PIP4K2A.

10. The method for screening cyclic peptide ligands according to claim 9, characterized in that: The peptide sequences screened for PTP-1B are as follows: NH2-AYFQIGSQQRGC-CONH2; The peptide sequences screened for NEK7 are as follows: NH2-AYALRQGPGQAC-CONH2; NH2-AYFSRAGSQRVC-CONH2; The peptide sequences screened for PIP4K2A are as follows: NH2-AYIPSEHVRC-CONH2; NH2-AYHSRKRHMFQC-CONH2.

Images