Nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system, detection method, device and application

Abstract

The invention provides a nucleic acid detection paper chip based on an RPA / RT-RPA and CRISPR / Cas12a system, a detection method, a device and application, the paper chip comprises a hydrophobic backing layer located on the lower layer and a hydrophilic reaction layer located on the upper layer, the hydrophilic reaction layer comprises a first hydrophilic reaction zone and a second hydrophilic reaction zone, the first hydrophilic reaction zone is coated with a freeze-dried RPA / RT-RPA premix solution, and the second hydrophilic reaction zone is coated with a freeze-dried RPA / RT-RPA premix solution. And the second hydrophilic reaction region is coated with a freeze-dried CRISPR / Cas12a premixed solution. The invention provides a simple, convenient, rapid and sensitive nucleic acid detection platform by utilizing isothermal amplification of RPA / RT-RPA and targeted nucleic acid recognition of CRISPR / Cas12a, and is particularly suitable for a field detection environment with limited resources.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and in particular relates to a nucleic acid detection paper chip, detection method, device and application based on RPA / RT-RPA and CRISPR / Cas12a system. Background Art

[0002] With the development of modern molecular biology, nucleic acid detection, as an important means of disease diagnosis, pathogen identification and genetic analysis, occupies an indispensable position in clinical medicine and basic research. Traditional nucleic acid detection methods usually rely on polymerase chain reaction (PCR). This method requires a thermal cycler with high temperature control accuracy, and the necessary denaturation, annealing and extension steps of the reaction make the entire amplification detection time long, making it difficult to achieve rapid on-site detection of nucleic acid molecules. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a gene editing technology derived from bacteria and archaea. It is essentially an immune system of bacteria that can recognize and destroy invading viral DNA. crRNA can bind to RNA-induced endonuclease Cas (CRISPR-associated) protein to form a complex. In addition, when the nucleic acid sequence of crRNA is complementary to the nucleic acid sequence of the target genome, the CRISPR / Cas system can cut the nucleic acid sequence. The V-type Cas12 enzyme family is one of them. After specific recognition and cutting, it can quickly cut any non-specific single-stranded DNA (ssDNA) in its vicinity. This unique catalytic property has been used as a diagnostic tool for CRISPR.

[0003] A commonly used detection strategy involves first amplifying the target sequence, thereby generating a large amount of detection templates. Then, the CRISPR / Cas system specifically recognizes these templates, activating the Cas effector protein to cleave the fluorescent probe within the reaction system, thereby enabling the detection of samples with low viral loads. Methods based on isothermal nucleic acid amplification are mainly loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). Currently, most studies combining CRISPR detection with nucleic acid amplification detection utilize tubular liquid reactions involving multiple fluid handling steps, which makes them suboptimal for point-of-care (POC) diagnostics. Paper is a material that is simple to manufacture, portable, and low-cost. Paper-based molecular tests provide an attractive format for developing nucleic acid diagnostic assays for POC applications, thanks to their inherent simplicity, biocompatibility, and the fact that they do not rely on external fluid handling components. Paper-based diagnostic devices have been considered a good alternative for future POC testing, enabling rapid, portable, and accurate on-site point-of-care testing, i.e., paper-based sensors for nucleic acid detection in POCT. Summary of the invention

[0004] In view of this, the present invention aims to overcome the defects in the prior art and proposes a nucleic acid detection paper chip, detection method, device and application based on RPA / RT-RPA and CRISPR / Cas12a system.

[0005] To achieve the above object, the technical solution of the present invention is achieved as follows: In a first aspect of the present invention, a nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system is provided, wherein the paper chip comprises a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer, wherein the hydrophilic reaction layer comprises a first hydrophilic reaction area and a second hydrophilic reaction area, the first hydrophilic reaction area is coated with RPA / RT-RPA premix, and the second hydrophilic reaction area is coated with CRISPR / Cas12a premix.

[0006] In some embodiments of the present invention, the RPA / RT-RPA premix includes but is not limited to enzyme powder, buffer, amplification primers of the target gene, lyophilization protectant and ultrapure water.

[0007] In some embodiments of the present invention, the design principle of the amplification primer sequence of the target gene is: the length of the upstream primer and the downstream primer sequence is 20-50 nt, and the sequence does not form a stable secondary structure. The amplification primer sequence of the target gene is an amplification primer that meets the amplification primer design principle of the present invention for any one of the nucleic acid detection targets.

[0008] In some embodiments of the present invention, the CRISPR / Cas12a premix includes but is not limited to Cas12a protein, crRNA, reaction buffer solution, reducing agent, ssDNA-FQ fluorescent reporter probe, lyophilization protectant and ultrapure water.

[0009] In some embodiments of the present invention, the reducing agent is DTT (dithiothreitol) or tris(2-carboxyethyl)phosphine hydrochloride (TCEP).

[0010] In some embodiments of the present invention, the reaction buffer solution is NEBuffer 2.1 buffer solution.

[0011] In some embodiments of the present invention, the lyophilization protectants in the RPA / RT-RPA premix and the CRISPR / Cas12a premix are independently selected from one or more of sucrose, mannitol, trehalose, bovine serum albumin, glycerol, pH buffer, and glycine. The lyophilization protectant can effectively prolong the activity period of RPA-related enzyme components, Cas12a proteins and components thereof, and ensure the stability and reliability of the detection components.

[0012] In some embodiments of the present invention, the lyoprotectant is any one of the following: (1) Trehalose; (2) A mixture of trehalose and sucrose; (3) A mixture of sucrose and mannitol; (4) A mixture of trehalose and mannitol; (5) A mixture of sucrose, mannitol and trehalose.

[0013] In some embodiments of the present invention, the hydrophobic backing layer and the hydrophilic reaction layer are made of Whatman No. 1 qualitative filter paper.

[0014] In some embodiments of the present invention, the design principle of the crRNA sequence is: the 5' end of the crRNA targeting sequence should have a 5'-TTN-3' or TCTV, TTCV, CTTV sequence, and the number of complementary base pairs between the crRNA and the targeting sequence is not less than 18bp. The sequence of the crRNA is a crRNA sequence that meets the crRNA design principle of the present invention for any one of the nucleic acid detection targets.

[0015] In some embodiments of the present invention, the Cas12a protein is a Cas12a protein having endonuclease activity and accessory nucleic acid cleavage activity. In some embodiments of the present invention, the Cas12a protein is selected from LbCas12a, FnCas12a, AsCas12a, and ScCas12a.

[0016] In some embodiments of the present invention, the ssDNA-FQ fluorescent reporter probe is modified with a fluorescent reporter group and a fluorescent quencher group. The fluorescent reporter group includes but is not limited to FAM, VIC, HEX, TET, JOE, Cy5, Cy3, TAMRA. The fluorescent quencher group includes but is not limited to BHQ1, BHQ2, BHQ3.

[0017] Based on the trans-cleavage activity of CRISPR / Cas12a, ssDNA-FQ is non-specifically cut to design the ssDNA-FQ fluorescent reporter probe required for the fluorescence detection system. Because LbCas12a protein has better cutting activity for adenine A and thymine T, the basic sequence of ssDNA-FQ is selected to include but not limited to TTATT, a fluorescent reporter group FAM group is added to the 5' end, and a fluorescent quencher group BHQ1 group is added to the 3' end. Preferably, the structure of the sequence of the ssDNA-FQ fluorescent reporter probe is 5'-FAM-TTATT-BHQ1-3'.

[0018] In some embodiments of the present invention, the final volume of the RPA / RT-RPA premix is ​​50 μL, which includes 29.4 μL buffer and enzyme powder, forward primer, reverse primer, mannitol, sucrose, and ultrapure water is used to make up the final volume of 50 μL, wherein the concentration of the forward primer is 0.1-1 μM, the concentration of the reverse primer is 0.1-1 μM, the concentration of mannitol is 0.001-2.0 g / mL, and the concentration of sucrose is 0.001-2.0 g / mL. The buffer includes 0.5-100 mM Tris acetic acid, 10-200 mM potassium acetate, 10-200 mM magnesium acetate, 1-10 mM DTT, 10-300 uM dNTPs, 1-5 mM ATP, 5% PEG, and 2-200 mM creatine.

[0019] The enzyme powder contains DNA polymerase, DNA recombinase, single-stranded DNA binding protein GP32, recombinant regulatory protein and kinase.

[0020] In some embodiments of the present invention, the CRISPR / Cas12a premix includes components with the following concentrations: 50-800 nM Cas12a protein, 0.2-10 μM crRNA, 1× NEBuffer 2.1 buffer, 1-20 mM DTT, 0.1-10 μM ssDNA-FQ fluorescent reporter probe, 0.001-2.0 g / mL mannitol, 0.001-2.0 g / mL sucrose, and ultrapure water is used to make up a final volume of 25 μL.

[0021] The second aspect of the present invention provides a method for preparing the above-mentioned nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system, comprising the following steps: (1) adhering two hydrophilic layers to the surface of the hydrophobic backing layer to form a first hydrophilic reaction area and a second hydrophilic reaction area to form a carrier; (2) Add the RPA / RT-RPA premix solution to the first hydrophilic reaction area, and add the CRISPR / Cas12a premix solution to the second hydrophilic reaction area, followed by freeze-drying to obtain a nucleic acid detection paper chip, which is then dried and stored at room temperature.

[0022] In some embodiments of the present invention, the freeze-drying condition is to freeze the vector to which the RPA / RT-RPA premix and the CRISPR / Cas12a premix are added at a temperature of -80°C for 20 min, and then freeze-dry it in a freeze dryer at -90°C in vacuum for 5 hours.

[0023] In some embodiments of the present invention, the hydrophobic backing layer is a rectangular platform with a length of 2 cm and a width of 1 cm, and the first hydrophilic reaction area and the second hydrophilic reaction area are divided into independent reaction areas by printing patterns, drawing hydrophobic barriers, etc.

[0024] In some embodiments of the present invention, the first hydrophilic reaction zone and the second hydrophilic reaction zone are both disc-shaped with a diameter of 3 mm, and the addition amounts of the RPA / RT-RPA premix and the CRISPR / Cas12a premix are both 3 μL.

[0025] The third aspect of the present invention provides a method for nucleic acid detection using the above-mentioned nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system, comprising the following steps: S1: Introduce the sample to be tested into the first hydrophilic reaction area of ​​the paper chip and perform RPA / RT-RPA isothermal amplification; S2: Fold the paper chip in half so that the RPA / RT-RPA isothermal amplification product in the first hydrophilic reaction area contacts the second hydrophilic reaction area for CRISPR / Cas12a reaction; S3: The test result is read. If a fluorescent signal is read, the sample to be tested contains the target gene, otherwise the sample to be tested does not contain the target gene.

[0026] In some embodiments of the present invention, the sample to be tested is a mixture of nucleic acid template and magnesium acetate.

[0027] In some embodiments of the present invention, the sample to be tested is a mixture containing 1 μL of nucleic acid template, 0.15 μL of 200 mM magnesium acetate solution, and 0.85 μL of nuclease-free water.

[0028] In some embodiments of the present invention, the conditions for the RPA / RT-RPA isothermal amplification in step S1 are: performing a isothermal amplification reaction at 35-45° C. for 5-30 min.

[0029] In some embodiments of the present invention, the conditions of the CRISPR / Cas12a reaction in step S2 are: incubation at 37° C. for 5-60 min.

[0030] In a fourth aspect of the present invention, a nucleic acid detection device based on RPA / RT-RPA and CRISPR / Cas12a system is provided, comprising the above-mentioned paper chip, camera, darkroom, light source, and bandpass filter; a sample observation window is provided at the top of the darkroom, the camera is installed above the sample observation window, the paper chip is provided at the bottom of the darkroom and below the sample observation window, the bandpass filter is installed between the sample observation window and the paper chip, and a constant temperature heating pad is provided at the bottom of the paper chip.

[0031] In some embodiments of the present invention, the darkroom is made of light-proof material and one end is open for the constant temperature heating pad and the paper chip to enter and exit.

[0032] In some embodiments of the present invention, the constant temperature heating pad is a 37° C. constant temperature heating pad, which is used to heat the paper chip to provide the temperature required for the reaction.

[0033] In some embodiments of the present invention, the wavelength of the light source is 450 nm.

[0034] In some embodiments of the present invention, the bandpass filter is a 525 nm green bandpass filter, which selectively filters light to reduce interference from other colors.

[0035] In some embodiments of the present invention, the nucleic acid detection device also includes a power source for powering the light source, such as a mobile power supply, an external AC power supply, etc.

[0036] In some embodiments of the present invention, the camera can be replaced by a smartphone with a camera on the market. After the reaction is completed, the LED light source illuminates the paper chip after the reaction to stimulate the fluorescence signal. Subsequently, the smartphone is used to capture the fluorescence image after passing through the green bandpass filter. The acquired image data will be quantitatively analyzed by software such as ImageJ to achieve accurate evaluation of the sample.

[0037] The fifth aspect of the present invention provides the use of the above-mentioned paper chip in the detection of nucleic acids for non-disease diagnosis and treatment purposes, such as Norovirus, Salmonella, etc.

[0038] In some embodiments of the present invention, the target gene of the Norovirus is (5'-3'): (SEQ ID NO: 1).

[0039] In some embodiments of the present invention, the sequences of amplification primers for detecting norovirus are as follows: Forward primer: ATGTTCAGATGGATGAGATT (SEQ ID NO: 2); Reverse primer: TCGACGCCATCTTCATTCAC (SEQ ID NO: 3).

[0040] In some embodiments of the present invention, the target gene of Salmonella is (5'-3'): (SEQ ID NO: 4).

[0041] In some embodiments of the invention, the Salmonella primer sequence is as follows: Upstream primer: AACTGGAAGCGAAATTTCCTGATTTACT (SEQ ID NO: 5); Downstream primer: CGAATTTTATGACAAATATAACGCGCCAT (SEQ ID NO: 6).

[0042] Compared with the prior art, the present invention has the following advantages: (1) Simple and constant temperature: The traditional PCR method requires complex temperature control equipment. The present invention combines the detection methods of RPA / RT-RPA and CRISPR / Cas12a and uses a constant temperature amplification reaction to get rid of the dependence on high-temperature equipment. The detection process is simple and fast, and is suitable for on-site environments without high-end equipment.

[0043] (2) Rapid: The entire time for RPA / RT-RPA and CRISPR / Cas12a nucleic acid detection (including constant temperature amplification, CRISPR / Cas12a detection and signal reading) does not exceed half an hour, significantly shortening the detection cycle.

[0044] (3) High sensitivity and high specificity: The nucleic acid detection method of the present invention has dual signal amplification and specificity of RPA / RT-RPA and CRISPR / Cas12a. Therefore, the present invention has higher detection sensitivity and specificity. The detection sensitivity reaches 1 copy / reaction, and it can specifically detect the target nucleic acid, while there is no detection signal for other non-target substances such as the new coronavirus, herpes simplex virus, human papillomavirus, Salmonella, Staphylococcus aureus, group B streptococcus, human genome, tropical Candida, rotavirus, etc.

[0045] (4) Stability: The detection system of the prior art involves cumbersome sample addition steps. During the liquid sample addition process, nucleic acid cross contamination may occur. Most of the reagents used need to be stored at -20°C, which brings inconvenience to the storage and transportation of the reagents, thereby increasing the detection cost. The present invention uses freeze-drying technology to select paper-based materials suitable for the two freeze-drying systems so that they can accommodate RPA and CRISPR components and can be stored at room temperature for easy use and transportation. By folding the paper base, the RPA amplification product can be directly transferred to the CRISPR reaction area without additional operation, avoiding potential cross contamination. It does not rely on cold chain for long-term storage and is easy to restore on paper for field applications.

[0046] (5) Portability: The present invention uses paper-based materials to make the detection platform have good portability and does not rely on expensive equipment. It has low production and use costs and is suitable for large-scale low-cost screening, especially for rapid detection needs in grassroots hospitals and remote areas.

[0047] (6) Low cost: Through simple paper processing and structural design, an efficient detection process can be achieved without the need for expensive equipment. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of adding RT-RPA and CRISPR / Cas12a related component premixes to the paper chip for freeze drying; Figure 2The optimization results of the conditions for detecting nucleic acids on paper chips using RT-RPA and CRISPR / Cas12a, (A) numerical graphs of the spontaneous fluorescence background of different paper substrates; (B) numerical graphs of the fluorescence of nucleic acids detected on different paper substrates and their signal-to-noise ratios; (C) numerical graphs of the fluorescence of different single and combined lyophilized protective agents; Figure 3 The sensitivity results of RT-RPA and CRISPR / Cas12a paper chips for nucleic acid detection; Figure 4 The specific results of RT-RPA and CRISPR / Cas12a paper chips for detecting norovirus; Figure 5 The specific results of RT-RPA and CRISPR / Cas12a paper chips for detecting Salmonella; Figure 6 The results of RT-RPA and CRISPR / Cas12a paper chips detecting nucleic acids in oyster samples. In the figure, *** indicates extremely significant statistical differences; Figure 7 Schematic diagram of a portable detection device for nucleic acid detection on a paper chip for RT-RPA and CRISPR / Cas12a; Figure 8 The sensitivity results of the nucleic acid detection device based on RPA / RT-RPA and CRISPR / Cas12a system for detecting norovirus.

[0049] Reference numerals: 1. Paper chip; 2. Camera; 3. Darkroom; 4. Light source; 5. Bandpass filter; 6. Sample observation window; 7. Constant temperature heating pad; 8. Power supply. DETAILED DESCRIPTION

[0050] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0051] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0052] Where values ​​are described herein as a range, it should be understood that such disclosure includes disclosure of all possible sub-ranges within that range, as well as specific values ​​falling within that range, regardless of whether a specific value or a specific sub-range is explicitly stated.

[0053] In this document, "multiple" and the like, unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0054] In this document, the terms “preferred” and “more preferred” are only used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0055] In this document, the words "further" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present invention.

[0056] In this article, the term "and / or" is a description of the association relationship of objects, indicating that three relationships may exist. For example, A and / or B means: A or B, or A and B.

[0057] As used herein, the term "about" means + / - 10%, preferably + / - 5%, more preferably + / - 1% of the specified value.

[0058] The terms “include,” “including,” “have,” “contain,” etc. used in this article are open-ended terms, meaning including but not limited to.

[0059] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention pertains. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention.

[0060] In a first aspect of the present invention, a nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system is provided, wherein the paper chip comprises a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer, wherein the hydrophilic reaction layer comprises a first hydrophilic reaction area and a second hydrophilic reaction area, the first hydrophilic reaction area is coated with RPA / RT-RPA premix, and the second hydrophilic reaction area is coated with CRISPR / Cas12a premix.

[0061] Specifically, the preparation method of the paper chip includes but is not limited to: The paper chip was constructed using Whatman No.1 qualitative filter paper, which consists of two layers: a lower hydrophobic backing layer and an upper hydrophilic reaction layer. For the lower hydrophobic backing layer, a rectangular Whatman No.1 qualitative filter paper with a size of 2 cm × 1 cm was cut. A black wax pencil was used to draw the hydrophobic area on the filter paper. Black paraffin was added to a conical flask and heated with a metal bath to melt the paraffin. The melted paraffin was poured into a plastic Petri dish. The filter paper was then slowly immersed in the melted paraffin to form a wax-impregnated area, and the wax-impregnated filter paper was then placed on a clean aluminum foil to cool for at least 2 minutes. The cooled filter paper was cut into 2 cm × 1 cm cuboids with a clean paper cutter. For the upper hydrophilic reaction layer, Whatman No.1 qualitative filter paper was prepared into circular paper discs with a diameter of 3 mm using a hole puncher. Two of the hydrophilic circular paper discs were adhered to the left and right sides of the rectangular backing layer. The circular paper discs were vertically symmetrical in the rectangle and used as the first hydrophilic reaction zone and the second hydrophilic reaction zone in the upper part; The hydrophobic area can also be made of black hydrophobic tape to form a lower hydrophobic backing layer. The first hydrophilic reaction area and the second hydrophilic reaction area are circular paper disks with a diameter of 3 mm.

[0062] In some embodiments of the present invention, the RPA / RT-RPA premix includes but is not limited to enzyme powder, buffer, amplification primers of the target gene, lyophilization protectant and ultrapure water.

[0063] In some embodiments of the present invention, the design principle of the amplification primer sequence of the target gene is: the length of the upstream primer and the downstream primer sequence is 20-50 nt, and the sequence does not form a stable secondary structure. The amplification primer sequence of the target gene is an amplification primer that meets the amplification primer design principle of the present invention for any one of the nucleic acid detection targets.

[0064] In some embodiments of the present invention, the CRISPR / Cas12a premix includes but is not limited to Cas12a protein, crRNA, NEBuffer 2.1 buffer solution, a reducing agent (such as DTT (dithiothreitol)), a ssDNA-FQ fluorescent reporter probe, a lyophilization protective agent and ultrapure water.

[0065] In some embodiments of the present invention, the lyoprotectant is composed of one or more of sucrose, mannitol, trehalose, bovine serum albumin, glycerol, pH buffer, and glycine, which can effectively prolong the activity period of RPA-related enzyme components, Cas12a protein and its components, and ensure the stability and reliability of the detection components.

[0066] In some embodiments of the present invention, the lyoprotectant is any one of the following: (1) Trehalose; (2) A mixture of trehalose and sucrose; (3) A mixture of sucrose and mannitol; (4) A mixture of trehalose and mannitol; (5) A mixture of sucrose, mannitol and trehalose.

[0067] In some embodiments of the present invention, the design principle of the crRNA sequence is: the 5' end of the crRNA targeting sequence should have 5'-TTN-3', or TCTV, TTCV, CTTV sequence, and the number of complementary base pairs between the crRNA and the targeting sequence is not less than 18bp. The sequence of the crRNA is a crRNA sequence that meets the crRNA design principle of the present invention for any one of the nucleic acid detection targets.

[0068] In some embodiments of the present invention, the Cas12a protein is a Cas12a protein having endonuclease activity and accessory nucleic acid cleavage activity. In some embodiments of the present invention, the Cas12a protein is selected from LbCas12a, FnCas12a, AsCas12a, and ScCas12a.

[0069] In some embodiments of the present invention, the ssDNA-FQ fluorescent reporter probe is modified with a fluorescent reporter group and a fluorescent quencher group. The fluorescent group includes but is not limited to FAM, VIC, HEX, TET, JOE, Cy5, Cy3, TAMRA. The fluorescent quencher group includes but is not limited to BHQ1, BHQ2, BHQ3.

[0070] Based on the trans-cleavage activity of CRISPR / Cas12a, ssDNA-FQ is non-specifically cut to design the ssDNA-FQ fluorescent reporter probe required for the fluorescence detection system. Because LbCas12a protein has better cutting activity for adenine A and thymine T, the basic sequence of ssDNA-FQ is selected to include but not limited to TTATT, a fluorescent reporter group FAM group is added to the 5' end, and a fluorescent quencher group BHQ1 group is added to the 3' end. Preferably, the structure of the sequence of the ssDNA-FQ fluorescent reporter probe is 5'-FAM-TTATT-BHQ1-3'.

[0071] In some embodiments of the present invention, the final volume of the RPA / RT-RPA premix is ​​50 μL, which includes 29.4 μL buffer and enzyme powder, forward primer, reverse primer, mannitol, sucrose, and ultrapure water is used to make up the final volume of 50 μL, wherein the concentration of the forward primer is 0.1-1 μM, the concentration of the reverse primer is 0.1-1 μM, the concentration of mannitol is 0.001-2.0 g / mL, and the concentration of sucrose is 0.001-2.0 g / mL. The buffer includes 0.5-100 mM Tris acetic acid, 10-200 mM potassium acetate, 10-200 mM magnesium acetate, 1-10 mM DTT, 10-300 uM dNTPs, 1-5 mM ATP, 5% PEG, and 2-200 mM creatine.

[0072] The enzyme powder contains DNA polymerase, DNA recombinase, single-stranded DNA binding protein GP32, recombinant regulatory protein and kinase.

[0073] In one embodiment of the present invention, the components in the RPA / RT-RPA premix are: 29.4 μL buffer, a forward primer with a final concentration of 0.4 μM, a reverse primer with a final concentration of 0.4 μM, 0.01 g / mL sucrose, 0.03 g / mL mannitol, and ultrapure water to make up a final volume of 50 μL.

[0074] In some embodiments of the present invention, the CRISPR / Cas12a premix includes components with the following concentrations: 50-800 nM Cas12a protein, 0.2-10 μM crRNA, 1× NEBuffer 2.1 buffer, 1-20 mM DTT, 0.1-10 μM ssDNA-FQ fluorescent reporter probe, 0.001-2.0 g / mL mannitol, 0.001-2.0 g / mL sucrose, and ultrapure water is used to make up a final volume of 25 μL.

[0075] In one embodiment of the present invention, the components in the CRISPR / Cas12a premix are: 500 nMCas12a protein, 1 μM crRNA, 1× NEBuffer 2.1 buffer, 10 mM DTT, 1 μM ssDNA-FQ fluorescent reporter probe, 0.01 g / mL sucrose, 0.03 g / mL mannitol, and ultrapure water is added to a final volume of 25 μL.

[0076] The second aspect of the present invention provides a method for preparing the above-mentioned nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system, comprising the following steps: (1) adhering two hydrophilic layers to the surface of the hydrophobic backing layer to form a first hydrophilic reaction area and a second hydrophilic reaction area to form a carrier; (2) Add the RPA / RT-RPA premix solution dropwise to the first hydrophilic reaction area, and add the CRISPR / Cas12a premix solution dropwise to the second hydrophilic reaction area, then freeze-dry the vector, and store the freeze-dried vector at room temperature.

[0077] In one embodiment of the present invention, the hydrophobic backing layer is a rectangular platform with a length of 2 cm and a width of 1 cm, and the first hydrophilic reaction area and the second hydrophilic reaction area are divided into independent reaction areas by printing patterns, drawing hydrophobic barriers, etc.

[0078] In one embodiment of the present invention, the drop amount of the RPA / RT-RPA premix and the CRISPR / Cas12a premix is ​​3 μL.

[0079] In some embodiments of the present invention, the freeze-drying condition is to freeze the vector to which the RPA / RT-RPA premix and the CRISPR / Cas12a premix are added at a temperature of -80°C for 20 min, and then freeze-dry it in a freeze dryer at -90°C in vacuum for 5 hours.

[0080] The third aspect of the present invention provides a method for nucleic acid detection using the above-mentioned nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system, comprising the following steps: S1: Introduce the sample to be tested into the first hydrophilic reaction area of ​​the paper chip and perform RPA / RT-RPA isothermal amplification; S2: Fold the paper chip in half so that the RPA / RT-RPA isothermal amplification product in the first hydrophilic reaction area contacts the second hydrophilic reaction area for CRISPR / Cas12a reaction; the simple folding operation allows the amplification product to be directly transferred to the CRISPR reaction area, avoiding the risk of cross contamination.

[0081] S3: The test result is read. If a fluorescent signal is detected, the sample to be tested contains the target gene, otherwise the sample to be tested does not contain the target gene.

[0082] In some embodiments of the present invention, the sample to be tested is a mixture of nucleic acid template and magnesium acetate.

[0083] In one embodiment of the present invention, the sample to be tested contains a mixture of 1 μL of nucleic acid template, 0.15 μL of 200 mM magnesium acetate solution, and 0.85 μL of nuclease-free water.

[0084] In some embodiments of the present invention, the conditions for the RPA / RT-RPA isothermal amplification in step S1 are: performing a isothermal amplification reaction at 37-42° C. for 5-30 min.

[0085] In some embodiments of the present invention, the conditions of the CRISPR / Cas12a reaction in step S2 are: incubation at 37° C. for 5-60 min.

[0086] Specifically, as a specific embodiment of the present invention, the specific method for detecting nucleic acid is as follows: (1) RPA / RT-RPA constant temperature amplification: For paper-based RPA / RT-RPA reactions, a sample mixture containing 1 μL nucleic acid template, 0.15 μL magnesium acetate solution (concentration of 200 mM), and 0.85 μL nuclease-free water was introduced into the first hydrophilic reaction area that had been lyophilized on the paper chip; The paper chip was then placed in a 35 mm diameter Petri dish. To create a humidity chamber for the reaction system, a 35 mm diameter round paper was moistened with water and placed at the bottom of the Petri dish.

[0087] The RPA / RT-RPA reverse transcription constant temperature amplification program is as follows: constant temperature at 37-45°C, reaction time 5-30 min; For negative controls, target replaced ultrapure water in the reaction mixture; (2) CRISPR / Cas12a detection: After the RPA / RT-RPA reaction, the paper chip is folded along its midline to bring the amplified target into direct contact with the second hydrophilic reaction area, thereby initiating a CRISPR / Cas12a reaction.

[0088] Reaction conditions: constant temperature 37°C, incubation 5-60 min; (3) Signal reading and analysis: After the reaction is completed, observe the fluorescence signal on the paper chip and use the MiniChemi chemiluminescence fluorescence imaging analysis system for imaging. Use fluorescence or color or grayscale analysis software to acquire and analyze fluorescence intensity data. By analyzing the fluorescence intensity of the control group and the experimental group, a statistically significant difference analysis was performed using the T test. P < 0.05 means that the research results are statistically significant (*), P < 0.01 means there is a significant statistical difference (**), and P < 0.001 means there is an extremely significant statistical difference (***).

[0089] In a fourth aspect of the present invention, a nucleic acid detection device based on RPA / RT-RPA and CRISPR / Cas12a system is provided, comprising the above-mentioned paper chip, camera, darkroom, light source, and green bandpass filter; a sample observation window is provided at the top of the darkroom, the camera is installed above the sample observation window, the paper chip is provided at the bottom of the darkroom and below the sample observation window, the green bandpass filter is installed between the sample observation window and the paper chip, preferably close to the sample observation window, and a constant temperature heating pad is provided at the bottom of the paper chip.

[0090] In some embodiments of the present invention, the darkroom is made of light-proof material and one end is open for the constant temperature heating pad and the paper chip to be placed in.

[0091] In some embodiments of the present invention, the constant temperature heating pad is a 37° C. constant temperature heating pad, which is used to heat the paper chip to provide the temperature required for the reaction.

[0092] In some embodiments of the present invention, the wavelength of the light source is 450 nm.

[0093] In some embodiments of the present invention, the green bandpass filter is a 525 nm bandpass filter, which selectively filters light to reduce interference from other colors.

[0094] In some embodiments of the present invention, the nucleic acid detection device also includes a power source for powering the light source, such as a mobile power supply, an external AC power supply, etc.

[0095] In some embodiments of the present invention, the camera can be replaced by a smartphone with a camera on the market. After the reaction is completed, the LED light source illuminates the reacted paper chip to excite the fluorescent signal. Subsequently, the smartphone is used to capture the fluorescent image after passing through the green bandpass filter. The acquired image data will be quantitatively analyzed by ImageJ software in the mobile phone to achieve accurate evaluation of the sample.

[0096] The present invention will be described in detail below with reference to the embodiments.

[0097] Example 1: Feasibility study of nucleic acid detection using paper chips based on RT-RPA and CRISPR / Cas12a The present invention obtains the genomic sequence of nucleic acid through NCBI, uses bioinformatics methods to compare and analyze a large number of sequences, and determines the nucleic acid-specific conserved sequence, i.e., the nucleic acid detection target. Taking Norovirus as an example: The target gene of Norovirus is (5'-3'): (SEQ ID NO: 1).

[0098] According to the RPA primer design principles, specific primers were designed using Primer Premier 5.0 software according to the instructions of Twist DX. The primer information for Norovirus is as follows: Upstream primer: ATGTTCAGATGGATGAGATT (SEQ ID NO: 2); Downstream primer: TCGACGCCATCTTCATTCAC (SEQ ID NO: 3).

[0099] Detection mechanism: On the paper chip, RT-RPA isothermal amplification primers reverse transcribe and amplify the viral RNA in the sample to be tested to obtain an amplification reaction product. The paper base is then folded, and CRISPR / Cas12a recognizes the detection target sequence on the amplification reaction product under the guidance of crRNA, thereby activating the accessory cleavage activity of Cas12a, cutting the ssDNA fluorescent probe in the detection system. After the probe molecules are cut, a large amount of detectable fluorescent signals are generated; under green fluorescence irradiation, visual fluorescence changes are displayed.

[0100] The following is the method for detecting nucleic acids using RT-RPA and CRISPR / Cas12a methods on paper chips: 1. Reagents (1) RT-RPA isothermal amplification primers; (2) Cas12 protein: LbCas12a; (3) crRNA; (4) Constant temperature amplification reagents include: enzyme lyophilized powder, rehydration buffer, and activator (magnesium acetate); (5) NE Buffer 2.1: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, pH 7.9; (6) A single-stranded DNA reporter molecule modified with a fluorescent reporter group and a fluorescent quencher group.

[0101] 2. Testing process (1) Freeze-drying process: The pre-preparation method of RT-RPA premix is ​​as follows: it contains enzyme lyophilized powder (including DNA polymerase, DNA recombinase, single-stranded DNA binding protein GP32, recombinant regulatory protein, kinase), upstream primer with a final concentration of 0.4μM, downstream primer with a final concentration of 0.4μM, buffer (Tris acetate 8 mM, potassium acetate 50 mM, magnesium acetate 40 mM, DTT 1mM, dNTPs 200uM, ATP 1mM, PEG 5%, creatine 30 mM), and sucrose with a final concentration of 0.01g / mL, mannitol with a final concentration of 0.03g / mL, and the rest is supplemented to 50μL with nuclease-free water. Magnesium acetate is not added to the mixture.

[0102] The CRISPR / Cas12a premix was prepared in advance with the following components: 0.5 μM Cas12a at a final concentration, 1 μM crRNA, 1× NE Buffer 2.1, 10 mM DTT, 1 μM ssDNA-FQ fluorescent reporter probe, 0.01 g / mL sucrose at a final concentration, 0.03 g / mL mannitol at a final concentration, and ultrapure water. 3 μL of the above RT-RPA premix and CRISPR / Cas12a premix were added to the different areas reserved for the filter paper, and the filter paper was freeze-dried using a desktop freeze dryer. The freeze-dried filter paper was stored at room temperature for further experiments.

[0103] (2) RT-RPA isothermal amplification: For the paper chip RT-RPA reaction, a sample mixture containing 1 μL nucleic acid template, 0.15 μL magnesium acetate solution (concentration of 200 mM) and 0.85 μL nuclease-free water was introduced into the freeze-dried RT-RPA reagent area (first hydrophilic reaction area) on the paper substrate. The RT-RPA isothermal amplification program was: constant temperature of 37°C, reaction for 15 min. The reaction was carried out in a sealed culture dish to prevent aerosol contamination. The experimental group with water as the template served as the negative control group; (3) CRISPR / Cas12a detection: Fold the paper chip so that the amplification product on the paper chip contacts the Cas12a component in the second hydrophilic reaction area of ​​the paper chip, and then incubate at 37°C for 5-60 min.

[0104] (4) Signal reading and analysis: After the reaction is completed, observe the fluorescent signal on the paper and use the MiniChemi chemiluminescence fluorescence imaging analysis system. Use ImageJ software to analyze the fluorescence intensity. By analyzing the fluorescence intensity of the control group and the experimental group, a statistically significant difference analysis was performed using the T test. P < 0.05 means that the research results are statistically significant, P < 0.01 means that there is a significant statistical difference, that is, positive, and P < 0.001 means that there is an extremely significant statistical difference.

[0105] (5) Test results: like Figure 1 As shown, the RT-RPA and CRISPR / Cas12a components are mixed with a pipette and then dripped into the center of two paper-based materials (i.e., the first hydrophilic reaction area and the second hydrophilic reaction area) to form a droplet-shaped circular area. The freeze dryer freeze-dries the liquid sample on the paper chip material. The sample is dehydrated by lowering the temperature and pressure, and the dry sample and paper chip structure are retained. After the freeze-dried paper chip, the sample is fixed on the paper chip, retaining its morphology and function for subsequent use.

[0106] Figure 2Included Figure 2 A. Figure 2 B and Figure 2 C, mainly involves paper chip fluorescence background, reaction optimization and screening optimization of lyophilization protective agents.

[0107] in, Figure 2 A shows the background fluorescence intensity (unit: au) of different materials (including A4 wood pulp paper, cellulose paper, ordinary filter paper, Whatman No.1 qualitative filter paper, and glass fiber filter paper RB65, BT03 and BT50) as carriers. As can be seen from the figure, Whatman No.1 qualitative filter paper has the lowest fluorescence intensity and shows the best performance (minimum background interference). In contrast, A4 wood pulp paper shows higher background fluorescence.

[0108] Figure 2 B compares the fluorescence signal intensity of different papers during the reaction. The evaluation criteria include the fluorescence signal intensity of positive and negative samples and the signal-to-noise ratio (SNR). The signal-to-noise ratio (SNR) is defined as the ratio of the fluorescence signal intensity of the positive sample to the fluorescence signal intensity of the negative sample. The performance of the positive control (black column) and the negative sample (grey column) was measured respectively. Whatman No.1 qualitative filter paper is not only superior in background fluorescence, but also has significantly higher fluorescence signal intensity of positive samples than other materials. At the same time, the difference multiple of the fluorescence signal between positive and negative is also high, indicating that it has an advantage in sensitivity.

[0109] Figure 2 C compared the effects of different types of lyoprotectants on the fluorescence signal. The purpose was to evaluate the effects of different lyoprotectants, including sucrose, mannitol, trehalose, sucrose + mannitol, mannitol + trehalose, trehalose + sucrose, sucrose + mannitol + trehalose, alone or in different combinations, on the lyophilization system.

[0110] For the CRISPR / Cas12a reaction system, the reaction mixture contains Cas12a protein (500 nM), crRNA (1 μM), 1× NEBuffer 2.1 buffer solution, DTT (10 mM), ssDNA-FQ fluorescent reporter probe (1 μM) and different lyophilized protective agents, and finally nuclease-free water is added to make up to 25 μL. At this time, the final concentrations of sucrose, mannitol and trehalose in the 25 μL system are 0.01 g / mL, 0.03 g / mL and 0.14 g / mL, respectively. The sample after freeze-drying is in a dry powder state. When the reaction needs to be activated, 23 μL of nuclease-free water is added to reconstitute the lyophilized powder, and then 2 μL of nucleic acid template is added to start the CRISPR / Cas12a reaction. By comparing the effects of different lyophilized protective agents on the Cas12a cutting efficiency and the final fluorescence signal intensity, the formula with high cutting efficiency and strong fluorescence signal is selected as the best lyophilized protective agent formula.

[0111] Figure 2 The picture in the upper right corner of C shows the appearance of the samples under different lyoprotectant conditions. The curve shows the trend of fluorescence intensity over time. Trehalose, trehalose + sucrose, sucrose + mannitol, trehalose + mannitol, sucrose + mannitol + trehalose showed good fluorescence signal intensity. Sucrose alone and mannitol alone performed generally: for example, the effect of using only sucrose or mannitol was poor. The fluorescence signal was lowest without lyoprotectant, indicating the importance of lyoprotectant in improving sample stability.

[0112] Example 2: Study on the sensitivity of RT-RPA and CRISPR / Cas12a paper chips for nucleic acid detection In order to determine the sensitivity of the paper chip method for detecting nucleic acids based on RT-RPA and CRISPR / Cas12a in the present invention, nucleic acid samples with known concentrations were diluted in a gradient manner. 0 copies / μL, 10 1 copies / μL, 10 2 copies / μL, 10 3 copies / μL, 10 4 copies / μL, 10 5 copies / μL, 10 6 copies / μL, 10 7 copies / μL, 10 8 The clones were taken as templates, and water was taken as negative control. Amplification and detection were performed according to the detection reagents and detection methods in Example 1.

[0113] The results are as follows Figure 3As shown, a T-test was used for significance analysis. When the concentration was ≥ 1 copy / μl, P < 0.001, and the data of the experimental group and the control group were significantly different, indicating that when the method of the present invention was used for detection, the detection sensitivity of the nucleic acid was 1 copy / μl.

[0114] Example 3: Study on the specificity of RT-RPA and CRISPR / Cas12a paper chips for detecting viral nucleic acids Taking norovirus as an example, according to the detection reagent and detection method in Example 1, norovirus, Salmonella, group B Streptococcus (GBS), Staphylococcus aureus (S. aureus), Candida tropicalis (C. tropicalis), Escherichia coli (E. coli), SARS-CoV-2, rotavirus (RV), human papillomavirus (HPV) and human genomic DNA were detected respectively, and water was used as the negative control group to analyze the specificity of the detection method provided by the present invention.

[0115] The specific method is to use the nucleic acid and the above-mentioned other microorganisms or human cell genomes as templates, perform amplification reaction and CRISPR / Cas12a detection according to the detection system and detection procedure in Example 1, and read the fluorescence signal through a multi-color fluorescence instrument.

[0116] The results are as follows Figure 4 As shown in Figure 2, only norovirus had significant fluorescence signals compared with the negative control group, while Salmonella, group B Streptococcus (GBS), Staphylococcus aureus ( S. aureus ), Candida tropicalis ( C. tropicalis ), Escherichia coli ( E. coli ), SARS-CoV-2, rotavirus (RV), human papillomavirus (HPV) and human genomic DNA had no significant signal enhancement (no statistical difference), indicating that the nucleic acid detection method established by the present invention has a high specificity.

[0117] Example 4: Study on the specificity of RT-RPA and CRISPR / Cas12a paper chips for detecting bacterial nucleic acids Taking Salmonella as an example, according to the detection reagent and detection method in Example 1, Salmonella, norovirus, SARS-CoV-2, rotavirus (RV), group B streptococcus (GBS), Staphylococcus aureus ( S. aureus ), Candida tropicalis ( C. tropicalis ), Escherichia coli ( E. coli ) etc., with water as the negative control group, to analyze the specificity of the detection method provided by the present invention.

[0118] The target gene of Salmonella is (5'-3'): (SEQ ID NO: 4).

[0119] According to the RPA primer design principles, specific primers were designed using Primer Premier 5.0 software according to the instructions of Twist DX. The primer information for Salmonella is as follows: Upstream primer: AACTGGAAGCGAAATTTCCTGATTTACT (SEQ ID NO: 5); Downstream primer: CGAATTTTATGACAAATATAACGCGCCAT (SEQ ID NO: 6).

[0120] The specific method is to use the nucleic acid and the other microorganisms mentioned above as templates, perform amplification reaction and CRISPR / Cas12a detection according to the detection system and detection procedure in Example 1, and read the fluorescence signal through a multi-color fluorescence instrument.

[0121] The results are as follows Figure 5 As shown in the figure, only Salmonella had a significant fluorescence signal compared with the negative control group, while norovirus, SARS-CoV-2, rotavirus (RV), group B Streptococcus (GBS), Staphylococcus aureus ( S. aureus ), Candida tropicalis ( C. tropicalis ), Escherichia coli ( E. coli ) and the like had no significant signal enhancement (no statistical difference), indicating that the nucleic acid detection method established by the present invention has specific recognition ability for Salmonella and is not interfered by other microorganisms or human genomes. Therefore, the detection system provided by the present invention is not only suitable for viral nucleic acid detection, but also can be used for the detection of other biological samples such as bacteria, and has broad application prospects.

[0122] Example 5: Detection results of nucleic acid in real oyster samples (1) Sample processing and RNA extraction: Use sterile scissors, surgical forceps or other equivalent instruments to dissect the digestive glands from the soft tissues of shellfish on a rubber pad and place them in a clean culture dish. Collect 1.0 g. Use a sterile blade or equivalent homogenizer to homogenize the digestive glands and transfer them to a centrifuge tube. Add 1.0 mL of proteinase K (0.1 mg / mL) solution and mix well. Use a thermostatic shaker or equivalent device at 37 °C, 320 times / min, and shake for 60 min. Place the test tube in a water bath or equivalent device at 60 °C for 15 min. Centrifuge at room temperature, 3000 r / min, for 5 min, transfer the supernatant to a clean test tube, and measure and record the number of mL of supernatant for subsequent RNA extraction.

[0123] Add the virus extract to the centrifuge tube, add an equal volume of Trizol reagent to the virus extract, mix well, shake vigorously, place at room temperature for 5 min, add 0.2 times the volume of chloroform, vortex vigorously mix for 30 s (not too strong to avoid the formation of an emulsion layer, or you can mix by hand), centrifuge at 12000 r / min for 5 min, transfer the upper aqueous phase to a new centrifuge tube, and do not suck out the middle layer. Add an equal volume of isopropanol to the centrifuge tube, mix well by inversion, place at room temperature for 5 min, centrifuge at 12000 r / min for 5 min, discard the supernatant, invert on absorbent paper, and dry the liquid (different samples must be dried in different places on the absorbent paper). Add an equal volume of 75% ethanol and wash the RNA precipitate twice by inversion. Centrifuge at 4 ℃, 12000 r / min for 10 min, carefully discard the supernatant, invert on absorbent paper, and dry the liquid (different samples must be dried in different places on the absorbent paper). Or carefully pour off the supernatant and use a micropipette to dry it. Use a different pipette tip for each sample. Do not touch the precipitate with the pipette tip. Dry at room temperature for 3 min. Do not dry too much to prevent RNA from being insoluble. Add 16 μL of RNase-free ultrapure water, mix gently to dissolve the RNA on the tube wall, centrifuge at 2000 r / min for 5 seconds, and store on ice for later use. The present invention uses the RT-RPA and CRISPR / Cas12a detection system of Example 1 to detect 9 oyster digestive gland samples (using constant temperature amplification primers and crRNA), and compares the CRISPR / Cas detection results with the qPCR detection results (CT value).

[0124] The results are as follows Figure 6 As shown, the detection accuracy of RT-RPA and CRISPR / Cas12a for positive and negative samples was 100%, indicating that the RT-RPA and CRISPR / Cas12a detection system of the present invention has 100% sensitivity, accuracy and specificity for nucleic acid detection in real oyster samples.

[0125] Example 6: Schematic diagram of a portable detection device for detecting nucleic acids using a paper chip of RT-RPA and CRISPR / Cas12a and its sensitivity study The present invention has developed a portable, smartphone-assisted fluorescence detection system that can detect nucleic acids efficiently and sensitively. This system combines paper chip RT-RPA amplification technology with CRISPR / Cas12a detection method and runs on a constant temperature heating pad at 37°C. The constant temperature heating pad can be continuously powered by a small power bank to provide the temperature conditions required for the reaction. In order to perform fluorescence imaging analysis, the present invention designed a nucleic acid detection device based on RPA / RT-RPA and CRISPR / Cas12a system, such as Figure 7 shown.

[0126] The device includes a paper chip 1, a camera 2, a darkroom 3, a light source 4, and a bandpass filter 5; a sample observation window 6 is provided at the top of the darkroom 3, the camera 2 is installed above the sample observation window 6, the paper chip 1 is provided at the bottom of the darkroom 3 and is located below the sample observation window 6, the bandpass filter 5 is installed between the sample observation window 6 and the paper chip 1, preferably close to the sample observation window 6, and a 37°C constant temperature heating pad 7 is provided at the bottom of the paper chip 1.

[0127] The darkroom 3 is made of light-proof material, and one end is open for the constant temperature heating pad 7 and the paper chip 1 to be placed in. The constant temperature heating pad 7 is used to heat the paper chip 1 to provide the temperature required for the reaction. The light source 4 is an LED lamp with a wavelength of 450 nm, which is used to illuminate the detection area of ​​the paper chip 1. The bandpass filter 5 is a 525 nm green bandpass filter to reduce background noise, selectively filter light, and reduce interference from other colors. The nucleic acid detection device also includes a power supply 8 for powering the light source, such as a mobile power supply, an external AC power supply, etc. The camera 2 can be replaced by a smart phone camera currently on the market, and the image information is collected and the test results are analyzed through the smart phone. The device is small and portable, equipped with an LED light source and an external power supply, and can be used to shoot with a smart phone outside the experimental environment, greatly expanding its scope of application.

[0128] A known concentration of NoV RNA (10 0 , 10 1 , 10 2 , 10 4 , 10 6 The detection sensitivity and analytical performance of the device were evaluated by 3D scanning electron microscope (SCEM) and the results showed that the device could detect NoV RNA well with an LOD of 1 copy / µL. Figure 8 As shown, the effectiveness and practicability of the portable device are verified.

[0129] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system, characterized in that: The paper chip includes a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer, the hydrophilic reaction layer includes a first hydrophilic reaction area and a second hydrophilic reaction area, the first hydrophilic reaction area is coated with an RPA / RT-RPA premix, and the second hydrophilic reaction area is coated with a CRISPR / Cas12a premix.

2. The nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to claim 1, characterized in that: The RPA / RT-RPA premix includes, but is not limited to, enzyme powder, buffer, amplification primers of the target gene, lyophilization protectant and ultrapure water.

3. The nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to claim 2, characterized in that: The CRISPR / Cas12a premix includes but is not limited to Cas12a protein, crRNA, reaction buffer solution, reducing agent, ssDNA-FQ fluorescent reporter probe, lyophilization protective agent and ultrapure water.

4. The nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to claim 3, characterized in that: The freeze-drying protective agent is composed of one or more of sucrose, mannitol, trehalose, bovine serum albumin, glycerol, pH buffer and glycine.

5. The nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to claim 4, characterized in that: The lyoprotectant is any one of the following: (1) Trehalose; (2) A mixture of trehalose and sucrose; (3) a mixture of sucrose and mannitol; (4) A mixture of trehalose and mannitol; (5) A mixture of sucrose, mannitol and trehalose.

6. A method for preparing a nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to any one of claims 1 to 5, characterized in that: The steps include: (1) adhering two hydrophilic layers to the surface of the hydrophobic backing layer to form a first hydrophilic reaction area and a second hydrophilic reaction area to form a carrier; (2) Add the RPA / RT-RPA premix solution to the first hydrophilic reaction area, add the CRISPR / Cas12a premix solution to the second hydrophilic reaction area, and then freeze-dry to obtain a nucleic acid detection paper chip, which is then dried and stored at room temperature.

7. The method for preparing a nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to claim 6, characterized in that: The freeze-drying conditions are as follows: freezing the vector to which the RPA / RT-RPA premix and the CRISPR / Cas12a premix are added at a temperature of -20°C to -90°C for 1-60 min, and then freeze-drying in a freeze dryer at -60°C to -95°C in a vacuum freeze dryer for 0.5-24 h.

8. A method for nucleic acid detection using the nucleic acid detection paper chip based on RPA / RT-RPA and CRISPR / Cas12a system according to any one of claims 1 to 5, characterized in that: The steps include: S1: Introduce the sample to be tested into the first hydrophilic reaction area of ​​the paper chip and perform RPA / RT-RPA isothermal amplification; S2: Fold the paper chip in half so that the RPA / RT-RPA isothermal amplification product contacts the second hydrophilic reaction area for CRISPR / Cas12a reaction; S3: The test result is read. If a fluorescent signal is detected, the sample to be tested contains the target gene, otherwise the sample to be tested does not contain the target gene.

9. A nucleic acid detection device based on RPA / RT-RPA and CRISPR / Cas12a system, characterized in that: It comprises the paper chip, camera, darkroom, light source and bandpass filter as described in any one of claims 1 to 5; a sample observation window is arranged on the top of the darkroom, the camera is installed above the sample observation window, the paper chip is arranged at the bottom of the darkroom and below the sample observation window, the bandpass filter is installed between the sample observation window and the paper chip, and a constant temperature heating pad is arranged at the bottom of the paper chip.

10. Use of the paper chip according to any one of claims 1 to 5 in nucleic acid detection for purposes other than disease diagnosis and treatment.

Images