One-pot nucleic acid detection system as well as detection method and application thereof

Abstract

The invention discloses a one-pot nucleic acid detection system as well as a detection method and application thereof. The system comprises Cas12a protein, crRNA, an amplification primer and PS-DNA, the PS-DNA comprises a nucleic acid fragment and a photodegradable connecting group located in the nucleic acid fragment, and phosphate ester groups of 20-24 nucleotide units in the PS-DNA are sulfated; wherein the number of nucleotide units in the nucleic acid fragment is 40nt-46nt. According to the one-pot nucleic acid detection system, the activity of CRISPR / Cas12a can be regulated and controlled by introducing photosensitive PS-DNA, and RPA amplification and a CRISPR / Cas12a detection system are successfully integrated into a one-pot reaction system. Furthermore, by using the one-pot nucleic acid detection system for nucleic acid detection, not only are the problems of sensitivity, tedious operation steps, amplification interference and the like of the CRISPR technology solved, but also the detection process is simplified, and the detection sensitivity and accuracy are remarkably improved; a new thought and a new solution are provided for popularization and popularization of a CRISPR molecular diagnosis technology in various application scenes.

Description

Technical Field

[0001] The present application relates to the fields of molecular biology and biomedical testing, and specifically to a one-pot nucleic acid detection system and its detection method and application. Background Art

[0002] Nucleic acid detection is a key technology in modern molecular biology and clinical diagnosis, and is widely used in pathogen detection, gene mutation analysis, environmental monitoring and other fields. Traditional nucleic acid detection methods mainly rely on polymerase chain reaction (PCR) technology to amplify target nucleic acid sequences to achieve high-sensitivity detection. However, PCR technology requires complex thermal cycling equipment and cumbersome operation steps, which limits its application in instant diagnosis. In recent years, isothermal nucleic acid amplification technology (such as recombinase polymerase amplification, RPA) has received widespread attention because it can perform nucleic acid amplification at a constant temperature. RPA technology does not require thermal cycling equipment and has the advantages of simple operation and rapid reaction, but its detection specificity still needs to be further improved.

[0003] As a precise gene editing tool, the CRISPR / Cas system has been widely used in the field of genetic diagnosis. In particular, the CRISPR / Cas12a system is used for nucleic acid detection because it produces non-specific single-stranded DNA (ssDNA) cleavage activity after recognizing a specific nucleic acid sequence. However, the direct use of CRISPR / Cas12a for nucleic acid target detection has limited sensitivity (10-100pM), which is difficult to meet the needs of some high-sensitivity detection. Therefore, researchers have tried to combine nucleic acid amplification with CRISPR detection to improve detection sensitivity.

[0004] Traditional methods usually separate nucleic acid amplification and CRISPR detection, which not only increases the number of steps, but also easily introduces aerosol contamination, affecting the accuracy of the test results. In addition, since CRISPR / Cas12a will reverse-cut the PCR primer after identifying the target, simply mixing the RPA reaction and CRISPR reaction system will not improve the detection sensitivity, but will interfere with the amplification process. Summary of the invention

[0005] Based on this, it is necessary to provide a one-pot nucleic acid detection system and its detection method and application.

[0006] The first aspect of the present application provides a one-pot nucleic acid detection system, which includes a Cas12a protein, crRNA, an amplification primer and PS-DNA, wherein the PS-DNA includes a nucleic acid fragment and a photodegradable linker located in the nucleic acid fragment, and the phosphate groups of 20 to 24 nucleotide units in the PS-DNA are thiolated; wherein the number of nucleotide units in the nucleic acid fragment is 40nt to 46nt.

[0007] In some embodiments, the sequence of the nucleic acid fragment is shown in SEQ ID NO: 5.

[0008] In some embodiments, the thiolation-modified sites are as follows:

[0009] A*G*A*C*G*TACAGT*A*A*G*A*CAATAA*G*A*C*C*GAACTT*A*G*C*A*TATGGA*A*T, where * indicates the replacement of non-bridging oxygen atoms in the DNA phosphate backbone with sulfur atoms.

[0010] In some embodiments, the PS-DNA includes 3 to 5 photodegradable linkers; optionally, the sequence of the PS-DNA is A*G*A* / ipc link / C*G*TACAGT*A*A* / ipc link / G*A*CAATAA*G*A* / ipc link / C*C*GAACTT*A*G* / ipc link / C*A*TATGGA*A*T, wherein / ipc link / represents a photodegradable linker.

[0011] In some embodiments, the photodegradable linker has a structure of -OR P1 -O-CH 2 CH 2 CH(-Ph-NO 2 )-OR P2 -O-, where R P1 and R P2 Each independently is -(O=)P(S - )-、-(O=)P(OH)-、-(O=)P(O - )-、-(S=)P(O - )-or-(S=)P(S - )-, Ph is a benzene ring, and at least one photodegradable linker in the PS-DNA includes -(O=)P(S - )-; optionally, -Ph-NO 2 -NO 2 Located in adjacent position.

[0012] In some embodiments, the amplification primers include RPA amplification primers.

[0013] In some embodiments, the one-pot nucleic acid detection system further comprises one or more of a recombinase, a DNA polymerase, RNase-free water, and a fluorescently labeled ssDNA reporter probe.

[0014] The second aspect of the present application provides a one-pot nucleic acid detection method, comprising the following steps:

[0015] The sample to be tested is mixed with the components of the one-pot nucleic acid detection system described in the first aspect of the present application to perform an amplification reaction; wherein the sample to be tested includes a nucleic acid substance, and the nucleic acid substance includes a DNA substance;

[0016] The mixture after the amplification reaction is subjected to ultraviolet light treatment to degrade the PS-DNA into multiple nucleic acid fragments;

[0017] The mixture after UV light treatment is subjected to nucleic acid detection.

[0018] In some embodiments, before mixing the sample to be tested with the components of the one-pot nucleic acid detection system, the Cas12a protein and the PS-DNA are pre-reacted for 4 min to 6 min. In some embodiments, the molar ratio of the Cas12a protein to the PS-DNA is 1: (1 to 10).

[0019] In some embodiments, the concentration of the amplification primer is 8 μM to 12 μM.

[0020] In some embodiments, the temperature of the amplification reaction is 35°C to 40°C.

[0021] In some embodiments, the amplification reaction time is 25 min to 30 min.

[0022] In some embodiments, the ultraviolet light intensity of the ultraviolet light treatment is 3W~14W.

[0023] In some embodiments, the ultraviolet light treatment time is 0.5 min to 2 min.

[0024] The third aspect of the present application provides a one-pot nucleic acid detection kit, comprising the components of the one-pot nucleic acid detection system described in the first aspect of the present application.

[0025] The fourth aspect of the present application provides the use of the one-pot nucleic acid detection system described in the first aspect of the present application or the one-pot nucleic acid detection kit described in the third aspect of the present application in the immediate detection of nucleic acid; the immediate detection of nucleic acid is for non-diagnostic purposes.

[0026] The aforementioned one-pot nucleic acid detection system can regulate the activity of CRISPR / Cas12a by introducing photosensitive PS-DNA, and successfully integrates RPA amplification and CRISPR / Cas12a detection system into a one-pot reaction system. Furthermore, the use of this one-pot nucleic acid detection system for nucleic acid detection not only solves the problems of CRISPR technology in sensitivity, cumbersome operation steps, and amplification interference, but also simplifies the detection process, significantly improves the sensitivity and accuracy of the detection, and provides new ideas and solutions for the promotion and popularization of CRISPR molecular diagnostic technology in various application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the implementation methods and examples of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for use in the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0028] Figure 1 This is a schematic diagram of the RPA-CRISPR / Cas12a one-pot nucleic acid detection method based on the photosensitive PS-DNA strategy for regulating Cas12a activity in one embodiment of the present application;

[0029] Figure 2 This is a schematic diagram of the molecular structure of thio modification in one embodiment of the present application;

[0030] Figure 3 This is a study on the effective concentration of PS-DNA in inhibiting CRISPR / Cas12a activity in one embodiment of the present application;

[0031] Figure 4 A schematic diagram of the photosensitive molecule modification of PS-DNA in one embodiment of the present application, as well as a schematic diagram of the molecular structure of the photosensitive molecule light control group in PS-DNA and the photocleavage breakage site under ultraviolet irradiation;

[0032] Figure 5 A is a bar graph of Cas12a trans-cleavage reaction for 30 minutes at different illumination times in one embodiment of the present application, B is a fluorescence kinetic curve graph of Cas12a trans-cleavage reaction within 30 minutes at different illumination times in one embodiment of the present application, C is a bar graph of Cas12a trans-cleavage reaction for 30 minutes at different light intensities in one embodiment of the present application, and D is a fluorescence kinetic curve graph of Cas12a trans-cleavage reaction within 30 minutes at different light intensities in one embodiment of the present application;

[0033] Figure 6A is a bar graph of sensitivity analysis of one-pot nucleic acid detection of RPA-CRISPR / Cas12a based on the strategy of photosensitive PS-DNA regulating Cas12a activity in one embodiment of the present application, and B is a fluorescence kinetic curve graph of sensitivity analysis of one-pot nucleic acid detection of RPA-CRISPR / Cas12a based on the strategy of photosensitive PS-DNA regulating Cas12a activity in one embodiment of the present application;

[0034] Figure 7 A is a bar graph of the specific analysis of one-pot nucleic acid detection of RPA-CRISPR / Cas12a based on the strategy of photosensitive PS-DNA regulating Cas12a activity in one embodiment of the present application, and B is a fluorescence kinetic curve graph of the specific analysis of one-pot nucleic acid detection of RPA-CRISPR / Cas12a based on the strategy of photosensitive PS-DNA regulating Cas12a activity in one embodiment of the present application. DETAILED DESCRIPTION

[0035] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0037] The terms "having", "containing" and "including" used in this application are synonymous, which are inclusive or open-ended and do not exclude additional, uncited members or features. Members or features include materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, states, etc.

[0038] In this application, the technical features or technical solutions described in open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions of the listed contents.

[0039] In this application, if the unit of the data range is followed only by the right endpoint, it means that the units of the left endpoint and the right endpoint are the same. For example, 40~50℃ means that the units of the left endpoint "40" and the right endpoint "50" are both ℃, which have the same meaning as 40℃~50℃. In addition, similar descriptions involving other parameters also apply to the above understanding.

[0040] In this application, if there are multiple steps involved in the method flow, unless there is a clear different description in this document, there is no strict order restriction for the execution of these steps, and they can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0041] In the present application, exemplary descriptions such as "in some implementation modes (or examples)" and "in one implementation mode (or example)" may include but are not limited to the following meanings: these solutions may be combined with other solutions in a suitable manner to form a new technical solution.

[0042] In the present application, the terms "first", "second", "third", etc. in "the first aspect", "the second aspect", "the third aspect", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0043] In the present application, when it comes to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to an integer in the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0044] Currently, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology, as an emerging gene editing and molecular diagnostic tool, has attracted widespread attention due to its high efficiency and specificity. However, the existing CRISPR molecular diagnostic technology still faces some challenges and problems in practical applications, such as limited sensitivity, which makes it difficult to meet the needs of some high-sensitivity detection. The method of combining nucleic acid amplification with CRISPR detection usually performs nucleic acid amplification and CRISPR detection separately, which not only increases the operation steps, but also easily introduces aerosol contamination, affecting the accuracy of the test results. In addition, since CRISPR / Cas12a will reverse-cut the PCR primer after identifying the target, simply mixing the RPA reaction and CRISPR reaction system will not improve the detection sensitivity, but will interfere with the amplification process.

[0045] In order to overcome the above challenges, researchers have made significant progress in multiple technical fields and promoted the development of molecular diagnostic technology. These advances are mainly reflected in the following aspects: ① Physical isolation method: Researchers reduced cross-contamination by physically separating isothermal amplification and CRISPR detection reactions in a closed space. For example, a double-tube system or a reusable pipe design is used to allow amplification reactions and CRISPR reactions to be carried out in different spaces, ensuring the sensitivity and accuracy of the detection. ② Multiphase reaction system: Using liquid phase separation technology with different densities, researchers have achieved simultaneous isothermal amplification and CRISPR detection in one reaction system. This dynamic aqueous multiphase reaction (DAMR) method improves the reaction efficiency through the migration of target nucleic acids. ③ Reaction rate regulation: By reducing the rate of CRISPR reaction, sufficient time is provided for isothermal amplification. For example, adjusting the concentration of Cas12a RNP. ④ Clever design of primers and crRNA: Researchers avoided CRISPR degradation of amplified products by optimizing the design of primers and crRNA. For example, primers modified with phosphosulfate are used to ensure that they are not degraded in the CRISPR reaction, thereby achieving continuous amplification and detection of nucleic acids.

[0046] Based on this, the embodiments of the present application at least provide a one-pot nucleic acid detection system and its detection method and application.

[0047] In some embodiments of the present application, in order to improve the detection sensitivity of the CRISPR / Cas12a system, a method for inhibiting Cas12a activity using photosensitive PS-DNA is proposed by combining ultraviolet light timing regulation with CRISPR / Cas12a activity regulation. The photosensitive PS-DNA molecule contains photosensitive molecules that can be degraded under ultraviolet light irradiation of a specific wavelength. When the nucleic acid amplification reaction (such as the RPA reaction) is carried out, the photosensitive PS-DNA molecule can temporarily inhibit the activity of Cas12a, thereby preventing Cas12a from cutting the target primer or amplification product during the amplification process. This inhibitory effect ensures the smooth progress of the amplification process and avoids the decrease in sensitivity caused by nonspecific cutting. After the amplification is completed, the photosensitive molecules of the photosensitive PS-DNA are decomposed by ultraviolet light irradiation, so that it is degraded and Cas12a is released, thereby initiating the subsequent CRISPR detection reaction. This design not only improves the detection sensitivity of the CRISPR system, but also enables nucleic acid amplification and CRISPR detection to be seamlessly combined in a reaction system.

[0048] In some embodiments of the present application, in order to simplify the process of combining nucleic acid amplification with the CRISPR system, RPA amplification and CRISPR / Cas12a detection are combined in the same reaction tube. By adding photosensitive PS-DNA molecules to the reaction system, the present invention can protect Cas12a protein from being activated during the amplification phase, thereby avoiding non-specific reactions with amplification primers or amplification products. After RPA amplification is completed, the photosensitive PS-DNA molecules are decomposed by ultraviolet light to release the activity of Cas12a and start the target detection reaction of CRISPR / Cas12a. This design not only simplifies the operating steps into a single reaction process, but also reduces the error and contamination risks caused by the cumbersome operating steps, and can achieve efficient and convenient diagnosis in a short time.

[0049] In some embodiments of the present application, in order to solve the interference problem when the CRISPR / Cas12a system is combined with the nucleic acid amplification reaction, the conflict between the CRISPR / Cas12a activity and the amplification process is solved by introducing photosensitive PS-DNA molecules. In the amplification stage, the photosensitive PS-DNA molecules can effectively inhibit the activity of Cas12a protein to prevent it from producing non-specific cutting effects during the amplification process. Only after the RPA amplification is completed, the photodegradation characteristics of the photosensitive PS-DNA are activated by ultraviolet light, and the photosensitive PS-DNA is degraded into short fragments, thereby removing the inhibitory effect on the activity of Cas12a. This design not only ensures the efficient conduction of the amplification reaction, but also avoids the mutual interference between amplification and CRISPR / Cas12a detection, and improves the accuracy and sensitivity of the detection.

[0050] In some embodiments of the present application, since all steps are completed in the same reaction tube, no cumbersome operation or multiple cross-contamination is required, and thus the false negative or false positive results caused by improper operation can be significantly reduced. In addition, since this method can effectively improve the detection sensitivity of the CRISPR / Cas12a system and simplify the operation steps, it is more suitable for instant diagnosis technology, especially in the fields of early disease detection, public health monitoring, food safety, etc., it has shown a wide range of application potential. The tester only needs to add the sample to the reaction tube and complete the test by simple ultraviolet light irradiation, which greatly shortens the diagnosis time and improves the diagnosis efficiency.

[0051] In a first aspect of the present application, a one-pot nucleic acid detection system is provided, which includes a Cas12a protein, crRNA, an amplification primer and PS-DNA, wherein the PS-DNA includes a nucleic acid fragment and a photodegradable linker located in the nucleic acid fragment, and the phosphate group of at least one nucleotide unit in the PS-DNA is thiolated; wherein the number of nucleotide units in the nucleic acid fragment is greater than or equal to 25nt.

[0052] In the present application, unless otherwise specified, a "photodegradable linker" refers to a chemical structural unit that can undergo chemical bond cleavage under light conditions.

[0053] In the present application, unless otherwise specified, "1 nt" means 1 nucleotide unit.

[0054] In some embodiments, the number of nucleotide units in the nucleic acid fragment can be but is not limited to 25nt~50nt; further, the number of nucleotide units in the nucleic acid fragment is 40nt~46nt; for example, the sequence of the nucleic acid fragment is shown in SEQID NO: 5.

[0055] In some embodiments, the Cas12a protein may be a conventional Cas12a in the art, such as LbCas12a.

[0056] In some embodiments, the phosphate groups of 20 to 24 nucleotide units in the PS-DNA are thiolated. In a non-limiting manner, the phosphate groups of 20, 21, 22, 23 or 24 nucleotide units in the PS-DNA are thiolated.

[0057] In some embodiments, the thiolation-modified sites are as follows:

[0058] A*G*A*C*G*TACAGT*A*A*G*A*CAATAA*G*A*C*C*GAACTT*A*G*C*A*TATGGA*A*T, where * indicates the replacement of non-bridging oxygen atoms in the DNA phosphate backbone with sulfur atoms.

[0059] It should be noted that in the present application, the sites of thiolation modification are not limited to the above sites, and can be flexibly designed according to the specific circumstances, that is, the number of nucleotide units in PS-DNA is within the above-disclosed range and through thiolation modification, the effect of inhibiting the Cas12a / crRNA complex can be achieved.

[0060] In some embodiments, PS-DNA includes 3 to 5 photodegradable linkers; without limitation, the photodegradable linkers in PS-DNA may be, but are not limited to, 3, 4 or 5. Further, the sequence of PS-DNA is A*G*A* / ipclink / C*G*TACAGT*A*A* / ipc link / G*A*CAATAA*G*A* / ipc link / C*C*GAACTT*A*G* / ipclink / C*A*TATGGA*A*T, wherein / ipc link / represents a photodegradable linker. It should be noted that the position of the photodegradable linker in PS-DNA is not limited to the above position, and the activity of CRISPR / Cas12a can also be regulated by changing the position of the above photodegradable linker.

[0061] In some embodiments, the photodegradable linker has a structure of -OR P1 -O-CH 2 CH 2 CH(-Ph-NO 2 )-OR P2 -O-, where R P1 and R P2 Each independently is -(O=)P(S - )-、-(O=)P(OH)-、-(O=)P(O - )-、-(S=)P(O - )-or-(S=)P(S - )-, Ph is a benzene ring, and at least one photodegradable linker in the PS-DNA includes -(O=)P(S - )-; optionally, -Ph-NO 2 -NO 2 Located in adjacent position.

[0062] In some embodiments, the amplification primer is an isothermal amplification primer, such as but not limited to an RPA (recombinase polymerase amplification) amplification primer, a LAMP (loop-mediated isothermal amplification) amplification primer.

[0063] In some embodiments, the one-pot nucleic acid detection system further comprises one or more of a recombinase, a DNA polymerase, RNase-free water, and a fluorescently labeled ssDNA reporter probe.

[0064] In some embodiments, the fluorescently labeled ssDNA reporter probe has a fluorescent group and a quencher group. In some embodiments, the 5' end (or 3' end) of the ssDNA reporter probe carries a fluorescent group. In some embodiments, the 3' end (or 5' end) of the ssDNA reporter probe carries a quencher group.

[0065] It should be noted that the fluorescent group in the present application may be a conventional fluorescent group in the art, and the quenching group may be a conventional quenching group in the art.

[0066] In a second aspect of the present application, a one-pot nucleic acid detection method is provided, which comprises the following steps:

[0067] S100: mixing the sample to be tested with the components of the one-pot nucleic acid detection system described in the first aspect of the present application to perform an amplification reaction; wherein the sample to be tested includes a nucleic acid substance, and the nucleic acid substance includes a DNA substance;

[0068] S200: treating the mixture after the amplification reaction with ultraviolet light to degrade the PS-DNA into multiple nucleic acid fragments;

[0069] S300: Perform nucleic acid detection on the mixture after ultraviolet light treatment.

[0070] In some embodiments, a schematic diagram of a one-pot nucleic acid detection method is as follows Figure 1 shown.

[0071] In some embodiments, the sample to be tested may be, but is not limited to, cells, bacteria, tissues or blood. The sample to be tested may be subjected to nucleic acid extraction.

[0072] In some embodiments, the sample to be tested may be a microorganism, such as but not limited to Enterosporidae, Encephalitis helenii, Encephalitis enterica, or Encephalitis rabbitiae.

[0073] In some embodiments, in step S100, before mixing the sample to be tested with the components of the one-pot nucleic acid detection system, the Cas12a protein and the PS-DNA are pre-reacted for 4 min to 6 min.

[0074] In some embodiments, the molar ratio of Cas12a protein to PS-DNA is 1: (1 to 10). In a non-limiting manner, the molar ratio of Cas12a protein to PS-DNA can be, but is not limited to, 1: 1, 1: 2, 1: 3, 1: 4, 1: 5, 1: 6, 1: 7, 1: 8, 1: 9, 1: 10 or a ratio or range between any two of the above ratios.

[0075] In some embodiments, the concentration of the amplification primer is 8 μM to 12 μM. In a non-limiting manner, the concentration of the amplification primer can be, but is not limited to, 8 μM, 9 μM, 10 μM, 11 μM, 12 μM, or a value or range between any two of the above values.

[0076] In some embodiments, the temperature of the amplification reaction is 35° C. to 40° C. In a non-limiting manner, the temperature of the amplification reaction can be, but is not limited to, 35° C., 37° C., 40° C., or a value or range between any two of the above values.

[0077] In some embodiments, the amplification reaction time is 25 min to 30 min. In a non-limiting manner, the amplification reaction time can be, but is not limited to, 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, or a value or range between any two of the above values.

[0078] In some embodiments, in step S200, the ultraviolet light intensity of the ultraviolet light treatment is 3 W to 14 W. In a non-limiting manner, the ultraviolet light intensity of the ultraviolet light treatment may be, but is not limited to, 3 W, 4 W, 5 W, 6 W, 7 W, 8 W, 9 W, 10 W, 11 W, 12 W, 13 W, 14 W, or a value or range between any two of the above values.

[0079] In some embodiments, the time of ultraviolet light treatment is 0.5 min to 2 min. In a non-limiting manner, the time of ultraviolet light treatment can be, but is not limited to, 0.5 min, 1 min, 1.5 min, 2 min, or a value or range between any two of the above values.

[0080] In the third aspect of the present application, a one-pot nucleic acid detection kit is provided, which includes the components of the one-pot nucleic acid detection system described in the first aspect of the present application.

[0081] In the fourth aspect of the present application, there is provided the use of the one-pot nucleic acid detection system described in the first aspect of the present application or the one-pot nucleic acid detection kit described in the third aspect of the present application in the immediate detection of nucleic acid; the immediate detection of nucleic acid is for non-diagnostic purposes.

[0082] In some embodiments, point-of-care testing can be a point-of-care diagnosis.

[0083] Some examples are provided below.

[0084] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance given in the present application, and can also be based on the experimental manual or normal conditions in the art, or can also be based on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0085] In the following examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operating accuracy are allowed.

[0086] The reagents and their sources involved in the following examples are as follows:

[0087] LbCas12a (Shanghai Tolo Port, V32108E), RPA nucleic acid amplification reagent (TwisDx, TABAS03KIT).

[0088] The nucleic acid sequences including single-stranded ssDNA-FQ fluorescent reporter probe, crRNA, PS-DNA, primers, etc. were synthesized by Guangzhou Aiji Biotechnology Co., Ltd.

[0089] The relevant genome sequences designed in this application (E.Bi, GeneBank: KF148056.1), Hellen's encephalitis microsporidia (E.hellem, GeneBank: L39108.1), intestinal encephalitis microsporidia (E.intestinalis, Genebank: L3911.1), rabbit encephalitis microsporidia (E.cuniculi, Genebank: KF169729.1), and the plasmids were synthesized by Guangzhou Aiki Biotechnology Co., Ltd.

[0090] Example 1

[0091] 1. Design RPA isothermal amplification primers and crRNA for target DNA

[0092] 1. Selection of target DNA

[0093] The partial DNA fragment sequence of E.Bi (Enterosporidium biformis) genome (GeneBank: KF148056.1) was selected as the template DNA, and its sequence was searched using NCBI. The sequence is as follows: (SEQ ID NO: 1)

[0094] CGGTGGAACGGCGAACGGCTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAAACTAACCACGGTAACCTGTGGCTAAAAGCGGAGAATAAGGCGCAACCCTATCAGCTTGTTGGTAGTG TAAAGGACTACCAAGGCCATGACGGGTAACGGGAAAATCAGGGTTTGATTCCGGAGAGGGAGCCTGAGAGATGGCTCCCACGTCCAAGGACGGCAGCAGGCGCGAAACTTGTCCACTCCTTACG GGGGAGACAGTCATGAGACGTGAGTATAAGACCTGAGTGTAAAGACCTTAGGTGAAGCAATTGGAGGGCAAGCTTTGGTGCCAGCAGCCGCGGTAACTCCAACTCCAAGAGTGTCTATGGT GGATGCTGCAGTTAAAGGGTCCGTAGTCGTGAATGCAATTAAATGTCGTTGTTCAATAGCGATGAGTTTGCTAATGTTTGCGGAACGGATAGGGAGTGTAGTATAGACTGGCGAAGAATGAAA

[0095] Primers for RPA amplification were designed based on the E.Bi template DNA sequence, wherein the front primer E.Bi-RPA-F is GCGAACGGCTCAGTAATGTTGCGGTAATTT (SEQ ID NO: 2); the rear primer E.Bi-RPA-R is TGATTTCCCGTTACCCGTCATGGCCTTGGT (SEQ ID NO: 3).

[0096] 2. Design of crRNA

[0097] The crRNA targeting E.Bi template DNA was designed, and the sequence of the crRNA was: UAAUUUCUACUAAGUGUAGAUGUCUCUGUGUGUAAACUAAC (SEQ ID NO: 4). Among them, the crRNA sequence UAAUUUCUACUAAGUGUAGAU is the inherent backbone DNA sequence of crRNA; the crRNA sequence GUCUCUGUGUGUAAACUAAC is the partial sequence for recognizing E.Bi template DNA.

[0098] 2. Design and inhibition concentration of PS-DNA that can inhibit CRISPR / Cas12a activity

[0099] 1. Design a 43nt PS-DNA that can inhibit CRISPR / Cas12a activity. The sequence and modification sites of the PS-DNA are as follows:

[0100] A*G*A*C*G*TACAGT*A*A*G*A*CAATAA*G*A*C*C*GAACTT*A*G*C*A*TATGGA*A*T,

[0101] The "*" represents thiolation (PS), which means replacing the non-bridging oxygen atoms in the DNA phosphate backbone with sulfur atoms. The specific structure is as follows: Figure 2 shown.

[0102] 2. In order to study the inhibitory effect of PS-DNA on CRISPR / Cas12a activity, a DNA sequence without PS modification was designed as a control, named uDNA. The sequence of uDNA is:

[0103] AGACGTACAGTAAGACAATAAGACCGAACTTAGCATATGGAA (SEQ ID NO: 5).

[0104] 3. Study on the minimum concentration of PS-DNA to inhibit CRISPR / Cas12a activity

[0105] To study the minimum effective concentration of PS-DNA to inhibit CRISPR / Cas12a activity, the Cas12a / crRNA complex with a concentration of 200nM and PS-DNA of different concentrations were first pre-reacted at room temperature for 5 minutes, and the same concentration of uDNA and CRISPR / crRNA complex were pre-reacted at room temperature for 5 minutes as a control. The concentrations of PS-DNA and uDNA were 0μM, 0.2μM, 0.4μM, 0.6μM, 0.8μM, 1μM, 1.2μM, and 2μM, respectively. After the reaction of PS-DNA and uDNA with Cas12a / crRNA at room temperature was completed, the Cas12a trans-cutting reaction system was configured on ice according to Table 1. After all components were mixed evenly, the reaction tube was placed in a real-time fluorescence quantitative PCR instrument, the excitation wavelength of the FAM channel was set to 400nm, the emission wavelength was set to 520nm, and the fluorescence signal was collected every 15 seconds. The reaction was carried out at 37°C for 30 minutes, during which the changes in the fluorescence signal intensity in the system were continuously monitored to determine the lowest effective concentration of PS-DNA to inhibit CRISPR / Cas12a activity. Figure 3It can be seen that as the concentration of PS-DNA increases, the weaker the ability of Cas12a / crRNA to cut the single-stranded DNA fluorescent reporter probe in the trans-cutting reaction system, the lower the fluorescence signal, indicating that the higher the concentration of PS-DNA, the better the effect of inhibiting CRISPR / Cas12a activity. At the same time, 1.5μM and 2μM uDNA also have a slight effect on the Cas12a trans-cutting reaction system, but it mainly comes from the competition between high-concentration uDNA and single-stranded DNA fluorescent reporter probes for binding to the cleavage site of Cas12a protein. By calculating the inhibition ratio of PS-DNA and uDNA in different concentration groups, it can be determined that for a Cas12a / crRNA complex with a concentration of 200nM, 2μM PS-DNA is the minimum effective concentration for effectively inhibiting the trans-cutting activity of 200nM Cas12a.

[0106] Table 1: PS-DNA inhibition of CRISPR / Cas12a trans-cleavage activity reaction system

[0107]

[0108] 3. Design of UV-cleavable PS-DNA and conditions for UV-cleavage of photosensitive PS-DNA to regulate CRISPR / Cas12a activity

[0109] 1. In order to achieve the regulation of Cas12a activity by ultraviolet light and realize the controllable timing of the RPA-CRISPR / Cas12a one-pot nucleic acid detection system, a PS-DNA containing a photosensitive molecule was designed and named photosensitive PS-DNA. Its sequence is as follows:

[0110] A*G*A* / ipc link / C*G*TACAGT*A*A* / ipc link / G*A*CAATAA*G*A* / ipc link / C*C*GAACTT*A*G* / ipc link / C*A*TATGGA*A*T.

[0111] Among them, / ipc link / is a photosensitive molecule that can be degraded by ultraviolet light, and its structural formula is as follows Figure 4 shown.

[0112] 2. Conditions for UV-cleavage of photosensitive PS-DNA to regulate CRISPR / Cas12a activity

[0113] First, configure the reaction system on ice according to Table 2, where 2μM photosensitive PS-DNA and 200nM CRISPR / Cas12a need to be pre-reacted at room temperature for 5 minutes. After the reaction system is configured, place it under a UV lamp for illumination at different time points. Among them, the UV light intensity is set to 14W, and the illumination time is 0 minutes, 0.5 minutes, 1 minute and 2 minutes respectively. After the illumination, place the reaction tube in a real-time fluorescence quantitative PCR instrument, set the excitation light wavelength of the FAM channel to 400nm, the emission light wavelength to 520nm, and collect fluorescence signals every 15 seconds. The reaction was carried out at 37°C for 30 minutes, during which the changes in the fluorescence signal intensity in the system were continuously monitored. Figure 5 Middle A and Figure 5 As shown in B, Figure 5 -A is a bar graph of Cas12a trans-cleavage reaction for 30 minutes, Figure 5 Figure B is a fluorescence kinetic curve of Cas12a trans-cleavage reaction within 30 minutes. Figure 5 Middle A and Figure 5 As shown in Figure B, when the UV light intensity is 14 W, photolysis of photosensitive PS-DNA can be completed after 0.5 minutes of irradiation, restoring the activity of the Cas12a / crRNA complex.

[0114] Similarly, the reaction system was configured on ice according to Table 2, in which 2μM photosensitive PS-DNA and 200nM CRISPR / Cas12a needed to be pre-reacted at room temperature for 5 minutes. After the reaction system was configured, it was placed under a UV lamp for illumination at different intensities. Among them, the UV illumination time was set to 0.5 minutes, and the illumination intensities were 0W, 3.5W, 7W, 10.5W and 14W, respectively. After the illumination, the reaction tube was placed in a real-time fluorescence quantitative PCR instrument, and the excitation light wavelength of the FAM channel was set to 400nm, the emission light wavelength was set to 520nm, and the fluorescence signal was collected every 15 seconds. The reaction was carried out at 37°C for 30 minutes, during which the changes in the fluorescence signal intensity in the system were continuously monitored. Figure 5 Middle C and Figure 5 As shown in D, Figure 5 Middle C is a bar graph of Cas12a trans-cleavage reaction for 30 minutes. Figure 5 D in the figure is a fluorescence kinetic curve of Cas12a trans-cleavage reaction within 30 minutes. Figure 5 Middle C and Figure 5 As shown in Figure D, under the condition of ultraviolet light irradiation for 0.5 minutes, the irradiation intensity of 7W can complete the photolysis of photosensitive PS-DNA and restore the activity of Cas12a / crRNA complex.

[0115] Table 2: Photosensitive PS-DNA regulated CRISPR / Cas12a trans-cleavage activity reaction system

[0116]

[0117] 4. Sensitivity test of the RPA-CRISPR / Cas12a one-pot nucleic acid detection method based on the strategy of photosensitive PS-DNA regulating Cas12a activity

[0118] The E.Bi double-stranded DNA template in step one is gradiently diluted with RNase-free water to obtain DNA solutions containing different concentrations of nucleic acid fragments, with concentrations of 1.5pM, 150fM, 15fM, 1.5fM, 150aM, and 15aM, respectively. The reaction system is configured on ice according to Table 3, in which 2μM photosensitive PS-DNA and 200nM CRISPR / Cas12a need to be pre-reacted at room temperature for 5 minutes. After the reaction system is configured, it is placed in a PCR instrument at 37°C for 30 minutes for RPA isothermal amplification. After the isothermal amplification is completed, the PCR tube is placed under ultraviolet light for illumination, with an ultraviolet intensity of 7W and an illumination time of 30 seconds. After the illumination is completed, the reaction tube is placed in a real-time fluorescence quantitative PCR instrument, the excitation light wavelength of the FAM channel is set to 400nm, the emission light wavelength is set to 520nm, and the fluorescence signal is collected every 15 seconds. The reaction is carried out at 37°C for 30 minutes, during which the changes in the fluorescence signal intensity in the system are continuously monitored. As Figure 6 Middle A and Figure 6 As shown in B, the sensitivity of the RPA-CRISPR / Cas12a one-pot nucleic acid detection system for detecting DNA nucleic acid is 1aM.

[0119] Table 3: RPA-CRISPR / Cas12a one-pot nucleic acid detection reaction system

[0120]

[0121] 5. Specificity test of the RPA-CRISPR / Cas12a one-pot nucleic acid detection method based on the strategy of photosensitive PS-DNA regulating Cas12a activity

[0122] Partial DNA fragments of the genomes of Enterobacteria biformis (E.Bi), E.hellem, E.intestinalis, and E.cuniculi were used as detection templates, respectively, and their sequences were shown in SEQ ID NO: 6-8, respectively. The reaction system was configured on ice according to Table 4, wherein 2 μM photosensitive PS-DNA and 200 nM CRISPR / Cas12a needed to be pre-reacted at room temperature for 5 minutes. After the reaction system was configured, it was placed in a PCR instrument at 37 ° C for 30 minutes for RPA isothermal amplification. After the isothermal amplification was completed, the PCR tube was placed under ultraviolet light for illumination, with an ultraviolet intensity of 7 W and an illumination time of 30 seconds. After the illumination was completed, the reaction tube was placed in a real-time fluorescence quantitative PCR instrument, the excitation wavelength of the FAM channel was set to 400 nm, the emission wavelength was set to 520 nm, and the fluorescence signal was collected every 15 seconds. The reaction was carried out at 37°C for 30 minutes, during which the changes in the fluorescence signal intensity in the system were continuously monitored. Figure 7 As shown in Figure A, at 30 minutes after the start of the reaction, the fluorescence intensity of the experimental group containing the E.bi target nucleic acid was significantly higher than that of the negative control group and other pathogen groups. Figure 7 As shown in the fluorescence kinetic curve in Figure B, the fluorescence of the laboratory containing the E.Bi target increases rapidly after the reaction starts, while the fluorescence intensity of the negative control group and other pathogen groups hardly increases over time. The above experiments show that the RPA-CRISPR / Cas12a one-pot nucleic acid detection method of this application has high specificity and there is no cross reaction during the detection process.

[0123] Helen's encephalitis microsporidia sequence (SEQ ID NO: 6):

[0124] CACCAGGTTGATTCTGCCTGACGTGGATGCTATTCTCTGGGGCTAAGCCATGCATGTTTATGAAGCCTTTATGGGGGATTGACGGACGGCTCAGTGATAGTACGATGATTTGATTGGGAGCCTGGATGTAACTGTGGGAAACTGCAGGTAAGTTCTGGGGGTGGT AGTTGTAGCTACTGCGTACCGAGTAAGTTGTAGGCCTATCAGCTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCAGGGTTTGATTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTCCAAGGATGGCAGCAGGCCGAAACTTG

[0125] Enteric encephalitis microsporidia sequence (SEQ ID NO: 7):

[0126] CACCAGGTTGATTCTGCCTGACGTGGATGCTATTCTCTGGGACTAAGCCATGCATGTTGATGAACCTTGTGGGGGATTGACGGACGGCTCAGTGATAGTACGATGATTTGGTTGGCGGGAGAGCTGTAACTGCGGGAAACTGCAGGTAGGGGGCTAGGAGT GTTTTGACACGAGCCAAGTAAGTTGTAGGCCTATCAGCTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGGGAGACGGGGGATCGGGGTTTGATTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTCCAAGGATGGCAGCAGGCCGAAACTTG

[0127] Rabbit encephalitis microsporidia sequence (SEQ ID NO: 8):

[0128] CACCAGGTTGATTCTGCCTGACGTGGATGCTATTCTCTGGGGCTAAGCCATGCATGCTTGTGAACTCTTTGTGGGGGATTAGCGGACGGCTCAGTGATAGCACGATGATTTGTTTGCGGGATGAGCAGTAGCTGCGGGAAACTGCAGATAGTGGTCTGCC CCTGTGGGGGTTGGCAAGTAAGTTGTGGGCCTATCAGCTGGTAGTTAGGGTAATGGCCTAACTAGGCGCAGACGGGATACGGGGGATCAGGGTTTGGTTCCGGAGAGGGAGCCTGAGAGATGGCTACTACGTCCAAGGATGGCAGCAGGCCGAAACTTG

[0129] Table 4: RPA-CRISPR / Cas12a one-pot nucleic acid detection reaction system

[0130]

[0131] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0132] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the scope of the claims.

Claims

1. A one-pot nucleic acid detection system, characterized in that: The one-pot nucleic acid detection system includes Cas12a protein, crRNA, amplification primer and PS-DNA, wherein the PS-DNA includes a nucleic acid fragment and a photodegradable linker located in the nucleic acid fragment, and the phosphate groups of 20 to 24 nucleotide units in the PS-DNA are thiolated; Wherein, the number of nucleotide units in the nucleic acid fragment is 40nt~46nt.

2. The one-pot nucleic acid detection system according to claim 1, characterized in that: The sequence of the nucleic acid fragment is shown in SEQ ID NO:

5.

3. The one-pot nucleic acid detection system according to claim 2, characterized in that: The thio-modified sites are as follows: A*G*A*C*G*TACAGT*A*A*G*A*CAATAA*G*A*C*C*GAACTT*A*G*C*A*TATGGA*A*T, where * indicates the replacement of non-bridging oxygen atoms in the DNA phosphate backbone with sulfur atoms.

4. The one-pot nucleic acid detection system according to claim 3, characterized in that: The PS-DNA includes 3 to 5 photodegradable linking groups; Optionally, the sequence of the PS-DNA is A*G*A* / ipc link / C*G*TACAGT*A*A* / ipc link / G*A*CAATAA*G*A* / ipc link / C*C*GAACTT*A*G* / ipc link / C*A*TATGGA*A*T, wherein / ipc link / represents a photodegradable linker.

5. The one-pot nucleic acid detection system according to claim 1, characterized in that: The structure of the photodegradable linking group is -OR P1 -O-CH2CH2CH(-Ph-NO2)-OR P2 -O-, where R P1 and R P2 Each independently is -(O=)P(S - )-、-(O=)P(OH)-、-(O=)P(O - )-、-(S=)P(O - )-or-(S=)P(S - )-, Ph is a benzene ring, and at least one photodegradable linker in the PS-DNA includes -(O=)P(S - )-; Optionally, the -NO2 in -Ph-NO2 is located at the ortho position.

6. The one-pot nucleic acid detection system according to any one of claims 1 to 5, characterized in that: It meets one or more of the following characteristics: The amplification primers include RPA amplification primers; The one-pot nucleic acid detection system also includes one or more of a recombinase, a DNA polymerase, RNase-free water, and a fluorescently labeled ssDNA reporter probe.

7. A one-pot nucleic acid detection method, characterized in that: The following steps are involved: The sample to be tested is mixed with the components of the one-pot nucleic acid detection system according to any one of claims 1 to 6 to perform an amplification reaction; wherein the sample to be tested includes a nucleic acid substance, and the nucleic acid substance includes a DNA substance; The mixture after the amplification reaction is subjected to ultraviolet light treatment to degrade the PS-DNA into multiple nucleic acid fragments; The mixture after UV light treatment is subjected to nucleic acid detection.

8. The one-pot nucleic acid detection method according to claim 7, characterized in that: It meets one or more of the following conditions: Before mixing the sample to be tested with the components of the one-pot nucleic acid detection system, the Cas12a protein and the PS-DNA are pre-reacted for 4 min to 6 min; The molar ratio of the Cas12a protein to the PS-DNA is 1: (1-10); The concentration of the amplification primer is 8 μM to 12 μM; The temperature of the amplification reaction is 35°C to 40°C; The amplification reaction time is 25min to 30min; The ultraviolet light intensity of the ultraviolet light treatment is 3W~14W; The ultraviolet light treatment time is 0.5min~2min.

9. A one-pot nucleic acid detection kit, characterized in that: It comprises the components of the one-pot nucleic acid detection system as described in any one of claims 1 to 6.

10. Use of the one-pot nucleic acid detection system according to any one of claims 1 to 6 or the one-pot nucleic acid detection kit according to claim 9 in real-time detection of nucleic acid; the real-time detection of nucleic acid is for non-diagnostic purposes.

Images