Specific primer pair for sex identification of Chinese softshell turtles, identification method and kit

Abstract

The invention relates to a specific primer pair for sex identification of Chinese softshell turtles and an identification method thereof.The primer pair comprises two pairs of primers which are used for amplifying specific sequences in genome DNA of the Chinese softshell turtles respectively so as to achieve accurate sex identification, and according to the method, the genome DNA of a to-be-detected sample can be amplified through a PCR amplification reaction; when the amplification product is 1000 bp, the sex is judged, when the amplification product is 1000 bp and 2000 bp, the sex is judged, according to the identification method provided by the invention, standard PCR amplification conditions and a reaction system are adopted, high efficiency and accuracy of sex identification are ensured, the invention further provides a kit, and the kit can be used for detecting the sex. The kit comprises a reagent for extracting DNA (deoxyribonucleic acid), a primer combination and a reaction system required by PCR (polymerase chain reaction) amplification as well as an electrophoretic buffer solution and a labeling reagent required by agarose gel electrophoresis, is beneficial to improving the sex identification efficiency and accuracy of the Chinese softshell turtles, and is widely applicable to sex screening and other related researches in the aquaculture industry.

Description

Technical Field

[0001] The invention relates to the technical field of biological identification, and in particular to a specific primer pair for identifying the sex of a Chinese soft-shell turtle, an identification method and a kit. Background Art

[0002] Chinese soft-shell turtle (Pelodiscus sinensis), as a special economic reptile, is an important aquaculture species in my country. In recent years, the national annual output is about 300,000 tons, of which Zhejiang Province accounts for about 40%, and the total output value exceeds 6 billion yuan (China Fisheries Statistical Yearbook, 2019-2021). Compared with female turtles, male turtles have significant advantages in growth rate, individual size, skirt width, etc., and male turtles have higher nutritional value, so they are more popular in the market. The unit price of male Chinese soft-shell turtles is usually 50% to 80% higher than that of females. Therefore, cultivating all-male or high-male seedlings can significantly increase the output and economic benefits of Chinese soft-shell turtle farming and shorten the farming cycle.

[0003] The sex determination mechanism of Chinese soft-shelled turtle belongs to the genetic type (ZZ / ZW), specifically the ZW sex determination system, in which females are ZW type and males are ZZ type. However, the molecular mechanism of sex determination of Chinese soft-shelled turtle is still not completely clear, which also leads to inaccurate and unreliable sex determination methods in breeding practice, bringing certain challenges to breeding benefits.

[0004] At present, the commonly used sex identification techniques of Chinese soft-shelled turtles mostly rely on detecting differences in specific sex-determining genes or chromosomes. PCR amplification technology is usually used to determine the sex of an individual by amplifying specific DNA fragments, such as the DMRT1 gene. Although these technologies are effective to a certain extent, they still have some problems and limitations.

[0005] First, existing sex identification techniques usually rely on the expression of sex-specific genes, such as the DMRT1 gene. These genes may mutate, be missing, or have unstable expression in certain circumstances, which may reduce the accuracy of sex determination or even lead to misjudgment. For example, gene mutation or gene deletion may cause traditional PCR primers to fail to cover all individuals, especially when there is a large genetic diversity among species, the specificity and applicability of traditional primers may be limited.

[0006] Secondly, most existing sex identification techniques rely on exon regions or specific gene sequences, which are susceptible to selection pressure and may have certain expression variations or instability, which increases the difficulty of sex determination. Moreover, these methods usually require high-quality DNA samples, and the determination effect is poor for degraded DNA samples or low-quality samples, which limits their widespread application, especially in the case of field sampling or improper preservation, the effect of sex determination is poor.

[0007] Therefore, the existing gender identification technology has defects such as poor reliability, narrow scope of application, low detection accuracy and cumbersome operation. There is an urgent need for a more stable, accurate and widely applicable gender identification method. Summary of the invention

[0008] The first technical problem to be solved by the present invention is to provide a specific primer pair for sex identification of Chinese soft-shelled turtle, so as to solve the problem in the prior art that traditional primers cannot completely cover all individuals due to gene mutation, gene deletion or genetic diversity between species, thus affecting the accuracy and reliability of sex determination.

[0009] In order to overcome the defects of the above prior art, the present invention provides a specific primer pair for sex identification of Chinese soft-shelled turtle, the primer pair comprises primer 1 and primer 2, and the forward and reverse primers thereof are shown in SEQ ID NOs: 1-4 respectively, comprising: Primer 1 forward: 5′AGTAGCATTTACCAAAGCCTC3′; Primer 1 reverse: 5′CTGTCAAACATTGAATAACTCTG3′; Primer 2 forward: 5′TAATATTGATCTCTGACTCTT3′; Primer 2 reverse: 5'CTGTCAAACATTGAATAACTCTG3'.

[0010] The specific primer pair for sex identification of Chinese soft-shelled turtle in the present application has the following advantages compared with the prior art: the primer pair of the present invention can avoid the limitation of the prior art based on specific sex-determining genes (such as DMRT1 gene) by adopting intron differences as the basis for primer design; the mutation rate of intron regions is lower than that of exon regions, and is not easily affected by gene variation and deletion, so the accuracy and reliability of sex determination can be improved; and the prior art may not be applicable between species or individuals due to gene mutation or variation, while the present invention adopts intron regions as the design basis, and the polymorphism of such regions is more stable, so that the primer pair can effectively adapt to the sex identification needs of different individuals or different species, and has higher adaptability; and the specific sequence provided by intron differences enables the primer pair of the present invention to effectively distinguish male and female individuals during the amplification process, thereby greatly improving the accuracy of sex determination and avoiding possible misjudgment in traditional methods; compared with traditional sex identification methods, the PCR amplification reaction system of the present invention is relatively simple, and has lower quality requirements for DNA samples, is suitable for large-scale screening, and reduces the cost and difficulty of operation of the experiment.

[0011] The second technical problem to be solved by the present invention is to provide a method for identifying the sex of Chinese soft-shelled turtle, so as to solve the problems of poor identification accuracy, complicated operation and narrow application scope existing in the conventional identification methods in the prior art.

[0012] In order to overcome the defects of the above prior art, the present invention provides a method for identifying the sex of Chinese soft-shelled turtle, which is implemented by using the specific primer pair and comprises the following steps: S1: Extract genomic DNA of the Chinese soft-shell turtle sample to be tested; S2: using the primer pair according to claim 1, performing PCR amplification on the genomic DNA obtained in step S1; S3: Detect the band pattern of the product amplified by PCR in step S2 to determine the sex of the Chinese soft-shelled turtle, wherein when the amplified product is 1000 bp, it is determined to be male, and when the amplified product is two bands of 1000 bp and 2000 bp, it is determined to be female.

[0013] Compared with the prior art, the sex identification method of the Chinese soft-shelled turtle in the present application has the following advantages: the sex identification method of the present invention is relatively simple and has a simple operation process. It extracts DNA and performs PCR amplification, does not rely on complex experimental steps, such as chromosome observation or protein detection, and does not need to rely on high-cost equipment; while traditional sex identification methods often rely on specific sex genes or chromosome markers, which are easily affected by gene mutations, deletions or genetic diversity between species. Using the specific primer pairs in the present invention for PCR amplification can effectively improve the accuracy of sex identification and avoid the misjudgment problem in the prior art; secondly, compared with the reliance on specific genes or chromosomes in the prior art, the present invention has good adaptability to Chinese soft-shelled turtles of different individuals and different sexes by using primers designed with intron differences, is not affected by gene variation between species, and is suitable for a wider range of application scenarios. The method of the present invention combines PCR amplification and agarose gel electrophoresis methods to obtain clear test results in a short time, thereby improving the efficiency of large-scale sample detection.

[0014] As a preferred solution, in step S2, the conditions for PCR amplification include: pre-denaturation at 94°C for 5 minutes, 94°C for 30 seconds, annealing at 54-60°C for 45 seconds, extension at 72°C for 90 seconds, repeating the cycle 37 times, and finally extending at 72°C for 5 minutes.

[0015] Compared with the prior art, the above technical solution avoids non-specific amplification by precisely controlling the annealing temperature and extension time, ensuring that only the target sequence is amplified, which is crucial for the reliability of the sex identification method. Secondly, through the appropriate number of cycles, the amplification efficiency of the target sequence is maximized, reducing the need for multiple PCR amplifications, making the operation simpler and more efficient. The pre-denaturation step (94°C for 5 minutes) effectively denatures the DNA template in the sample completely, ensuring that the double-stranded structure of the DNA is opened to prepare for PCR amplification. The extension step (72°C for 90 seconds) ensures that the Taq enzyme can efficiently amplify the DNA fragment and ensure the efficient generation of the product. In general, the PCR amplification conditions used optimize the binding efficiency between the primer and the DNA template by precisely controlling the annealing temperature (60°C) and extension time (90 seconds), as well as the appropriate number of cycles (37 times), ensuring the specificity and stability of PCR amplification. Specifically:.

[0016] As a preferred solution, in step S2, the PCR amplification reaction system includes: Taq enzyme, forward primer, reverse primer, DNA template and ddH2O.

[0017] Compared with the prior art, the present invention adopts the above technical scheme and provides a stable, reliable and simple PCR amplification method through precise reaction system ratio, which can efficiently and accurately amplify DNA fragments related to the sex of Chinese soft-shelled turtle, and provides strong technical support for sex identification. It has significant advantages in accuracy, stability and ease of operation, is highly adaptable, and can be effectively used in different experimental environments.

[0018] As a preferred solution, the specific ratio of the PCR amplification reaction system is: 10 μL of Taq enzyme, 0.8 μL of forward primer, 0.8 μL of reverse primer, 0.5 μL of DNA template, 7.9 μL of ddH2O, and the total reaction system volume is 20 μL.

[0019] Compared with the prior art, the above technical solution can ensure that the various components in the PCR reaction system maintain an optimal ratio, thereby improving the efficiency and accuracy of the reaction, thereby improving the reliability of gender identification. By further optimizing the ratio of the PCR reaction system, the present invention provides an efficient, stable and accurate DNA amplification method, which significantly improves the accuracy and reliability of gender identification.

[0020] As a preferred solution, in step S3, the method for detecting the band type of the product obtained by PCR amplification is: detecting by agarose gel electrophoresis, and the concentration of agarose in the agarose gel is 1.5%.

[0021] Compared with the prior art, the above technical solution uses 1.5% agarose gel, which is suitable for separating DNA fragments of 1000bp and 2000bp in size. This concentration can provide appropriate migration space for the target fragments and effectively distinguish the 1000bp and 2000bp band types in the PCR products. The clear electrophoresis band types can avoid misjudgment and ambiguous results, making gender identification more accurate and reliable. Samples of different genders (male and female) can be clearly distinguished by the difference in band types.

[0022] The third technical problem to be solved by the present invention is to provide a kit for sex identification of Chinese soft-shelled turtle, so as to solve the problems in the prior art of incomplete kit components and inconvenience for on-site identification.

[0023] In order to overcome the above defects of the prior art, the present invention also provides a kit for sex identification of Chinese soft-shelled turtle, the kit comprising: Reagents for DNA extraction; A primer combination for PCR amplification, the primer combination comprising the primers described in claim 1; The reaction system used for PCR amplification includes a DNA template, Taq enzyme and ddH2O.

[0024] Compared with the prior art, the kit for sex identification of Chinese soft-shelled turtle in the present application has the following advantages: the sex identification kit in the prior art often lacks the necessary DNA extraction reagent or the precise ratio of the PCR reaction system, which may require the purchase of different reagents during the operation, increasing the complexity and cost of the operation, while the kit of the present invention integrates the DNA extraction reagent, the specific primer and the PCR reaction system into a complete kit, simplifies the operation process, improves the convenience of user use, and through the use of the kit, can significantly reduce the difficulty of the experimenter's operation, reduce the dependence on external reagents, enhance its operability and repeatability, and ensure the accuracy of sex identification. This makes the sex identification method of Chinese soft-shelled turtle more suitable for large-scale screening and popularization, and solves the problems of incomplete kit components and cumbersome operation in the prior art.

[0025] As a preferred solution, the kit also includes electrophoresis buffer and labeling reagents required for agarose gel electrophoresis.

[0026] Compared with the prior art, the above-mentioned technical scheme is adopted, and by including the electrophoresis buffer and the labeling reagent in the kit, the kit of the present invention provides a more complete and convenient gender identification scheme. In actual operation, there is no need to worry about the electrophoresis conditions and labeling issues, and gender identification can be completed more quickly and simply, thereby improving the efficiency, accuracy and repeatability of the experiment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is a technical flow chart of the present invention; Figure 2 2 is a technical schematic diagram of the present invention; Figure 3 This is the electrophoresis diagram of the specificity of intron primers detected using DNA of Chinese soft-shell turtle of known sex (agarose gel concentration 1.5%); Figure 4 The electrophoresis diagram of female DNA and primer (exon), primer 1 (MSV1), and primer 2 (MSV2) at different gradient annealing temperatures to detect primer specificity; Figure 5 This is the electrophoresis diagram of male DNA and primer (exon), primer 1 (MSV1), and primer 2 (MSV2) at different gradient annealing temperatures to detect primer specificity. DETAILED DESCRIPTION

[0028] First, those skilled in the art should understand that these implementations are only used to explain the technical principles of the embodiments of the present application, and are not intended to limit the protection scope of the embodiments of the present application. Those skilled in the art can make adjustments to them as needed to adapt to specific application scenarios.

[0029] The present invention provides a specific primer pair for sex identification of Chinese soft-shell turtle, the primer pair comprising primer 1 and primer 2, the forward and reverse primers thereof are shown in SEQ ID NOs: 1-4 respectively, comprising: Primer 1 forward: 5′AGTAGCATTTACCAAAGCCTC3′; Primer 1 reverse: 5′CTGTCAAACATTGAATAACTCTG3′; Primer 2 forward: 5′TAATATTGATCTCTGACTCTT3′; Primer 2 reverse: 5'CTGTCAAACATTGAATAACTCTG3'.

[0030] The present invention also provides a method for identifying the sex of a Chinese soft-shelled turtle. Figure 1 , Figure 2 As shown, Figure 2 The invention is based on the basic principle of molecular sex identification of Chinese soft-shelled turtles, which is based on the MSV gene. Males have two copies of the MSVZ allele, while females have one copy of each of the MSVZ and MSVW alleles. In Chinese soft-shelled turtles, some intron sequences between MSVZ and MSVW are different. The specific primers for these specific regions of the invention can realize sex identification of these species. The PCR products are analyzed by agarose gel electrophoresis, and the separation of the fragments can be used for genotyping of males (ZZ) and females (ZW). The identification method is implemented by the specific primer pair, and includes the following steps: S1: Extract genomic DNA of the Chinese soft-shell turtle sample to be tested; S2: using the primer pair according to claim 1, performing PCR amplification on the genomic DNA obtained in step S1; S3: Detect the band pattern of the product amplified by PCR in step S2 to determine the sex of the Chinese soft-shelled turtle, wherein when the amplified product is 1000 bp, it is determined to be male, and when the amplified product is two bands of 1000 bp and 2000 bp, it is determined to be female.

[0031] As a preferred solution, in step S2, the conditions for PCR amplification include: pre-denaturation at 94°C for 5 minutes, 94°C for 30 seconds, annealing at 54-60°C for 45 seconds, extension at 72°C for 90 seconds, repeating the cycle 37 times, and finally extending at 72°C for 5 minutes.

[0032] As a preferred solution, in step S2, the PCR amplification reaction system includes: Taq enzyme, forward primer, reverse primer, DNA template and ddH2O.

[0033] As a preferred solution, the specific ratio of the PCR amplification reaction system is: 10 μL of Taq enzyme, 0.8 μL of forward primer, 0.8 μL of reverse primer, 0.5 μL of DNA template, 7.9 μL of ddH2O, and the total reaction system volume is 20 μL.

[0034] As a preferred solution, in step S3, the method for detecting the band type of the product obtained by PCR amplification is: detecting by agarose gel electrophoresis, and the concentration of agarose in the agarose gel is 1.5%.

[0035] Compared with the prior art, the identification method of the present invention has the following technical advantages: High adaptability and wide applicability: Intron differential primers can determine gender based on the universality and stability of intron regions in the genome. Therefore, they can not only meet the gender determination needs of different individuals, but also be widely used in different species. Compared with traditional technologies that rely on specific gender genes, the intron differential primers used in the present invention are not affected by gene expression levels and can adapt to the diversity or variation of gender marker genes. The principle is as follows: Intron regions usually have high polymorphism and are not directly affected by selection pressure. Therefore, even if there are large genetic differences between species or individuals, the intron region can still stably provide differentiated sequence information. This allows intron differential primers to play a role between different individuals, different genders and even different species, avoiding the limitations of relying on specific genes.

[0036] Avoids the problems of gene mutation and unstable expression: Traditional gender determination techniques, such as the PCR method based on the DMRT1 gene, often rely on the expression of sex-specific genes, which may mutate, be deleted or be unstable in expression in some species, leading to misjudgment or failure of determination. The intron differential primers of the present invention do not rely on the expression of sex-specific genes, and are therefore not affected by gene mutation or variation, and can provide more stable and reliable determination results; the principle is as follows: intron regions are usually not translated into proteins during gene transcription, and are not directly involved in functional expression like exon regions. Therefore, they are more prone to mutation than exons and expressed genes and are not affected by selection pressure. These variations provide obvious markers for different individuals or different sexes, so that the gender determination process is not interfered by gene mutation, deletion or expression changes.

[0037] Easy operation and low cost: Compared with the traditional method of sex determination based on exons or specific genes, the intron differential primer technology has lower operation complexity. The PCR amplification process of this technology is relatively simple, and the quality requirements of DNA samples are low, which is suitable for large-scale screening. At the same time, the primer design in the intron region does not require complex optimization for the expression of specific genes, thus reducing the overall cost of the experiment; its principles include: the sequence diversity in the intron region makes the primer design relatively simple, and does not require complex considerations for the translation and expression of exon genes. During the PCR amplification process, the intron differential primers can effectively amplify the target sequence in a shorter time, and do not rely on the complex processing of DNA samples, so it can improve the efficiency of the experiment and reduce costs.

[0038] Ability to handle low-quality or degraded DNA samples: Intron regions are usually longer than exon regions and are not involved in protein synthesis. Therefore, even when the DNA sample is degraded or of poor quality, intron differential primers can still effectively amplify the target region, thereby achieving accurate gender determination. This is especially important for field sampling, improperly preserved specimens, or aged samples; the principles include: because intron regions are more stable than exon regions and do not rely on post-transcriptional modifications, even if the DNA in the sample is partially degraded, intron differential primers can still successfully amplify the target region on the residual DNA fragments. This makes the method suitable for a variety of samples with poor DNA quality, enhancing the breadth and flexibility of its practical application.

[0039] Improved accuracy of gender identification: Intron differential primers can provide high specificity and diversity, greatly improving the accuracy of gender determination. Compared with other methods, the present invention can more easily distinguish individuals of different genders and reduce the occurrence of misjudgment by targeting differences in intron regions; its principles include: polymorphisms in intron regions provide clear markers, which usually have significant differences between different genders. By accurately designing intron differential primers, the accuracy of gender determination can be improved. Compared with traditional methods that rely on expression levels, intron differential primer technology is more stable and can effectively avoid misjudgments caused by fluctuations in gene expression or mutations.

[0040] The present invention also provides a kit for identifying the sex of Chinese soft-shelled turtle, the kit comprising: Reagents for DNA extraction; A primer combination for PCR amplification, the primer combination comprising the primers described in claim 1; The reaction system used for PCR amplification includes a DNA template, Taq enzyme and ddH2O.

[0041] As a preferred solution, the kit also includes electrophoresis buffer and labeling reagents required for agarose gel electrophoresis.

[0042] Compared with the prior art, the identification method, specific primer pair and kit of the present invention mainly include the following differences: Gender determination based on intron difference primers: Existing gender determination technologies usually rely on gender-specific genes (such as the DMRT1 gene) or are based on differences in exon regions. Unlike these methods, the present invention uses differential primers in intron regions for gender determination. Intron regions have high sequence diversity and stability, are not affected by selection pressure, and can provide significant sequence difference markers for individuals of different genders, avoiding the limitations of relying on gene expression. The present invention designs specific primers by targeting sequence differences in intron regions. Gender determination is performed using polymorphisms in intron regions rather than relying on gender-specific genes or gene expression. A universal and stable gender determination method is provided, which is applicable to a variety of species and individuals, especially when the expression of gender-specific genes is unstable or missing.

[0043] Improve adaptability and wide applicability: Traditional gender determination methods have poor adaptability among different species or individuals, especially when the gender-specific gene expression of some species is unclear or variable, it is difficult for traditional methods to make accurate determinations. However, the present invention uses intron differential primers, which are independent of gene expression levels and have higher adaptability, and can be widely used in the determination of different species and their different genders; and the present invention avoids the instability of gender-specific gene expression by selecting intron regions. This method can perform gender determination across species, has a wider adaptability, and is suitable for the determination of different species and individuals of different genders. It is particularly suitable for species and individuals where gender-specific gene expression is missing or unclear.

[0044] Solve the problem of misjudgment caused by gene mutation or unstable expression: Traditional gender determination methods may be affected by gene mutation, unstable expression or gene deletion, leading to misjudgment. However, the present invention avoids these problems and provides more stable and reliable gender determination by designing intron differential primers, which are independent of gene expression or function; and the present invention does not rely on the expression level of exons or sex-specific genes, thus avoiding misjudgment caused by mutation or unstable expression. By utilizing the polymorphism of the intron region, a more stable determination method that is not subject to selection pressure is provided to ensure the accuracy of gender determination.

[0045] Gender determination for low quality or degraded DNA samples: Traditional gender determination technology usually requires high-quality DNA samples, and it is often impossible to make accurate determinations for low-quality or degraded DNA. However, the present invention can successfully obtain amplification products in lower-quality DNA samples by selecting intron regions for amplification, adapting to more sample types, especially in samples in the field or with poor storage conditions; and because the intron regions of the present invention are long and do not participate in protein synthesis, even if the DNA sample is degraded, the intron differential primers can still effectively amplify the target region. A solution for low-quality or degraded DNA samples is provided, expanding the scope of application of the technology.

[0046] The following is a further description of the above contents of the present invention by combining the above technical solutions with specific data through embodiments: Example 1: Operation steps for sex identification of Chinese soft-shelled turtle S1: Sample collection and DNA extraction: Chinese soft-shell turtle samples of known sex (8 males and 8 females) were selected, and genomic DNA was extracted from each sample.

[0047] Genomic DNA was extracted from the embryonic samples of Chinese soft-shell turtle using a standard DNA extraction kit. After extraction, the DNA was dissolved in 20 μL of sterile ultrapure water and stored in a -20°C refrigerator until use.

[0048] The volume of DNA solution for each sample was 0.5 μL, which was used for subsequent PCR amplification experiments.

[0049] S2: Primer Design Primers were designed based on the specific intron sequence MSV in the chromosome of Chinese soft-shelled turtle using the biological primer design software PrimerPremier5.

[0050] The designed primers include: Primer 1 forward: 5'AGTAGCATTTACCAAAGCCTC3'; Primer 1 reverse: 5'CTGTCAAACATTGAATAACTCTG3'; Primer 2 forward: 5'TAATATTGATCTCTGACTCTT3'; Primer 2 reverse: 5'CTGTCAAACATTGAATAACTCTG3'.

[0051] All primers were synthesized by Shanghai Bioengineering Technology Service Co., Ltd.

[0052] PCR amplification: Set the total volume of the PCR reaction system to 20 μL, including the following components: Taq enzyme 10μL; forward primer 0.8μL; reverse primer 0.8μL; DNA template 0.5μL; ddH2O 7.9μL.

[0053] PCR reaction program: 94°C pre-denaturation for 5 min, 94°C for 30 s, 54-60°C annealing for 45 s, 72°C extension for 90 s, 37 cycles, and finally 72°C extension for 5 min.

[0054] S3: Electrophoresis analysis of PCR products: The PCR amplification products were subjected to agarose gel electrophoresis using 1.5% agarose gel and 1×TAE electrophoresis buffer. After electrophoresis, the results were recorded and photographed using an ultraviolet imaging system to analyze the bands of the amplification products.

[0055] The sex was determined by electrophoresis: if the PCR product was only a 1000 bp band, it was determined to be male; if the PCR product was two bands of 1000 bp and 2000 bp, it was determined to be female.

[0056] The test results showed that the electrophoresis results of 8 male samples and 8 female samples were completely consistent with the actual gender.

[0057] Application of the kit: Contents of the kit: In this embodiment, the kit is used to implement the above-mentioned gender identification method. The kit includes the following components:

[0058] DNA extraction reagent: Chemical reagent used to extract genomic DNA from Chinese soft-shelled turtle samples.

[0059] PCR primer combination: comprising the forward primer and reverse primer described in claim 1.

[0060] PCR amplification reaction system: includes DNA template, Taq enzyme and ddH2O, which is convenient for experimental operation.

[0061] Kit formula: The kit may also include electrophoresis buffer (1×TAE buffer) and labeling reagents (such as DNA dyes) required for agarose gel electrophoresis. The kit can complete the entire process from DNA extraction, PCR amplification to electrophoresis analysis in one stop, greatly simplifying the experimental steps and improving experimental efficiency.

[0062] Experimental results and effects Primer verification: The designed primers of the present invention were used to perform PCR amplification experiments, and 8 male samples and 8 female samples were tested. The electrophoresis results were as follows: Figure 3 As shown, the male sample showed only a single band of 1000 bp, while the female sample showed two bands of 1000 bp and 2000 bp, and the results were completely consistent with the actual gender.

[0063] Specifically, Figure 3-5 As shown, Figures 4 to 5 The electrophoresis results of PCR amplification performed at different annealing temperatures using primers 1 and 2 (MSV1 and MSV2) of the present invention and general exon primers (exon) are shown. Figure 3-5 In the figure, M stands for Marker, 1, 2, 7, 8, 13, 14 are exon primers (exon); 3, 4, 9, 10, 15, 16 are primer 1 (MSV1); 5, 6, 11, 12, 17, 18 are primer 2 (MSV2).

[0064] Figure 3 The electrophoresis results of PCR amplification of Chinese soft-shelled turtle samples using two different primers (primer 1 and primer 2) are shown. The samples shown in the figure include male (♂) and female (♀) Chinese soft-shelled turtle DNA samples, reflecting the application effect of the two primers in sex identification. It can be seen that when using primer 1, the PCR amplification product of the male sample shows a 1000bp band, while the female sample has two bands: one is 1000bp and the other is 2000bp; this shows that when using primer 1, the male sample produces a PCR product of a specific size, while the female sample has two amplification products, reflecting the difference in DNA sequence between males and females. When using primer 2, the male sample also shows a single band of 1000bp, while the female sample shows two bands of 1000bp and 2000bp. Like the primer, primer 2 can also effectively distinguish male and female samples. Under the action of these two primers, the DNA banding patterns of male and female samples can be clearly distinguished through PCR amplification. The male sample showed only a 1000 bp band, indicating a single DNA signature, whereas the female sample had two different PCR amplification products (1000 bp and 2000 bp bands), further demonstrating the sex specificity of the female DNA sample. Figure 3 It is shown that by using the specific primers (primer 1 and primer 2) of the present invention, the sex of Chinese soft-shelled turtle can be successfully identified. The band pattern of the product obtained by PCR amplification can clearly distinguish males (1000bp single band) and females (1000bp and 2000bp two bands), which provides a reliable method for the sex identification of Chinese soft-shelled turtle and verifies the effectiveness and technical advantages of the primers of the present invention.

[0065] Figure 4 and Figure 5 The PCR amplification results of female and male samples are shown separately, and different annealing temperatures were used for the experiments. Figure 4The figure shows the PCR amplification electrophoresis pattern of the female sample, which includes two bands of 1000 bp and 2000 bp, indicating that primer 1 (MSV1) exhibits the best amplification effect at 54°C, while primer 2 (MSV2) performs better at 60°C. Figure 5 The PCR amplification results of the male sample are shown in the figure, which only shows a single band of 1000 bp, further verifying the high efficiency and accuracy of the primers of the present invention in identifying the sex of Chinese soft-shelled turtle.

[0066] By analyzing the PCR electrophoresis diagrams at different annealing temperatures, it can be concluded that the primer 1 (MSV1) designed in the present invention performs best at 54°C, while the primer 2 (MSV2) has the best amplification effect at 60°C, which indicates that the intron primers can stably amplify clear bands at different temperatures, further verifying the reliability of the present invention in gender identification.

[0067] In summary, the sex identification method and kit of the present invention, relying on the specific primers designed based on the intron region difference, can effectively improve the accuracy of sex determination, and have wide adaptability and better stability. Compared with the prior art, the present invention can effectively solve the problems in the prior art, such as gene mutation, unstable expression and other problems, and ensure the reliability of the identification results. The method of the present invention is simple, low-cost, and can process low-quality or degraded DNA samples, and has a wide range of application prospects.

[0068] In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "in the present embodiment", "specific example", or "some examples" etc. means that the specific features, mechanisms, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, mechanisms, materials or characteristics described may be combined in a suitable manner in any one or more embodiments or examples. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0069] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present application should be included in the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the protection scope of the claims.

Claims

1. A specific primer pair for sex identification of Chinese soft-shell turtle, characterized in that: The primer pair includes primer 1 and primer 2, and the forward and reverse primers thereof are shown in SEQ ID NOs: 1-4, respectively, including: Primer 1 forward: 5′AGTAGCATTTACCAAAGCCTC3′; Primer 1 reverse: 5′CTGTCAAACATTGAATAACTCTG3′; Primer 2 forward: 5′TAATATTGATCTCTGACTCTT3′; Primer 2 reverse: 5'CTGTCAAACATTGAATAACTCTG3'.

2. A method for identifying the sex of a Chinese soft-shelled turtle, characterized in that: The identification method is implemented by the specific primer pair according to claim 1. The following steps are involved: S1: Extract genomic DNA of the Chinese soft-shelled turtle sample to be tested; S2: using the primer pair according to claim 1, performing PCR amplification on the genomic DNA obtained in step S1; S3: Detect the band pattern of the product amplified by PCR in step S2 to determine the sex of the Chinese soft-shelled turtle, wherein when the amplified product is 1000 bp, it is determined to be male, and when the amplified product is two bands of 1000 bp and 2000 bp, it is determined to be female.

3. The method for identifying the sex of a Chinese soft-shelled turtle according to claim 2, characterized in that: In step S2, the conditions for PCR amplification include: pre-denaturation at 94°C for 5 minutes, 94°C for 30 seconds, annealing at 54-60°C for 45 seconds, extension at 72°C for 90 seconds, repeating the cycle 37 times, and finally extending at 72°C for 5 minutes.

4. The method for identifying the sex of a Chinese soft-shelled turtle according to claim 2, characterized in that: In step S2, the PCR amplification reaction system includes: Taq enzyme, forward primer, reverse primer, DNA template and ddH2O.

5. The method for identifying the sex of a Chinese soft-shelled turtle according to claim 4, characterized in that: The specific ratio of the PCR amplification reaction system is: 10 μL of Taq enzyme, 0.8 μL of forward primer, 0.8 μL of reverse primer, 0.5 μL of DNA template, 7.9 μL of ddH2O, and the total reaction system volume is 20 μL.

6. The method for identifying the sex of a Chinese soft-shelled turtle according to claim 4, characterized in that: In step S3, the method for detecting the band type of the product obtained by PCR amplification is: detecting by agarose gel electrophoresis, and the concentration of agarose in the agarose gel is 1.5%.

7. A kit for identifying the sex of Chinese soft-shelled turtle, characterized in that: The kit comprises: Reagents for DNA extraction; A primer combination for PCR amplification, the primer combination comprising the primers described in claim 1; The reaction system used for PCR amplification includes a DNA template, Taq enzyme and ddH2O.

8. The kit according to claim 7, characterized in that The kit also includes electrophoresis buffer and labeling reagents required for agarose gel electrophoresis.

Images