Animal-derived component identification primer and kit based on three-generation sequencing technology

Abstract

The invention discloses an animal-derived component identification primer based on a three-generation sequencing technology. The animal-derived component identification primer comprises a primer F as shown in SEQ ID No. 1, namely GTATGACCGCGGTGGCTGGCAC, and a primer R as shown in SEQ ID No. 2, namely CCAAACTGGGATTAGATACCC. The animal-derived component identification primer comprises a primer A, a primer B and a primer C, wherein the primer F is GTATGACCGCGGTGGCTGGCAC, and the primer C is CCAAACTGGGATTAGATACCC. Compared with a conventional DNA bar code method or a fluorescent quantitative PCR method, the primers designed by the invention can realize full-length mitochondrial amplification in different animal-derived DNAs, and the identification of animal-derived components is realized through a pair of primers, so that the detection efficiency of identification of fake animal-derived components in the field of public security food and medicine rings is improved. According to the primer pair designed by the invention, the amplification range covers all mitochondrial gene loci such as D-LOOP, COX1, COX2, COX3 and CYTB, and compared with a short fragment, the primer pair has higher species resolution.

Description

Technical Field

[0001] The invention relates to an animal-derived component identification kit, in particular to an animal-derived component identification primer and kit based on third-generation sequencing technology. Background Art

[0002] In recent years, food safety issues such as adulteration of animal-derived products have seriously affected the vital interests of consumers and aroused widespread public concern. In criminal cases involving counterfeiting, physical evidence inspection and identification are particularly important, but the current animal-derived physical evidence identification has problems such as cumbersome identification steps and difficulty in identifying unknown species using traditional DNA barcoding technology.

[0003] In the Chinese invention patent with patent number ZL 202311523425.6, a primer composition and detection kit for identifying animal-derived ingredients in food are disclosed. The primer pair of this patent targets the target gene sequence in the 12SrRNA+tRNA Val+16SrRNA region of the mitochondria, and the length of the amplified fragment is 1400-1700bp. However, the full length of the mitochondrial genome is about 16000-17000bp. The fragment length selected in this patent is short and the resolution is low, making it difficult to distinguish between closely related species or different populations of the same species.

[0004] In summary, the development of a kit that can quickly and with high resolution identify animal-derived ingredients is a current research hotspot in the field of food safety testing, which will provide more powerful technical support for combating adulteration. Summary of the invention

[0005] The primary technical problem to be solved by the present invention is to provide an animal-derived component identification primer designed based on the third-generation sequencing technology.

[0006] Another technical problem to be solved by the present invention is to provide an animal-derived component identification kit containing the above primers.

[0007] Another technical problem to be solved by the present invention is to provide a method for identifying animal-derived ingredients using the above-mentioned kit.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] A primer for identifying animal-derived ingredients based on third-generation sequencing technology, wherein the primer is primer F shown in SEQ ID No.1: GTATGACCGCGGTGGCTGGCAC, and primer R shown in SEQ ID No.2: CCAAACTGGGATTAGATACCC.

[0010] A kit for identifying animal-derived ingredients based on third-generation sequencing technology, comprising the above-mentioned primers.

[0011] A method for identifying animal-derived ingredients based on third-generation sequencing technology comprises the following steps:

[0012] 1) Extraction of sample genomic DNA: Extraction of genomic DNA using magnetic bead method or column method;

[0013] 2) Sample amplification: Prepare the amplification system as follows: 2xKeyPo SE Master 25 μL, primer F10uM 1.5 μL as shown in SEQ ID No.1, primer R10uM 1.5 μL as shown in SEQ ID No.2, DNA 10-200 ng, and make up to 50 μL with sterile double distilled water;

[0014] 3) Agarose gel electrophoresis detection: Take the amplified product of step 2) and perform agarose gel electrophoresis detection to detect the quality of the amplified product. The size of the amplified band is required to be around 16k, the amplified band is single, and there is no non-specific amplified band;

[0015] 4) Sample pretreatment: Use the MμLtiple samples dsDNA Library Prep Kit for ONTLigation Sequencing kit to construct a multi-sample mixed library using the ligation method, and combine it with the non-amplification barcode kit (EXP-NBD104, EXP-NBD114) to sequence the multi-sample library of double-stranded DNA such as genomic DNA and amplification products;

[0016] 5) Preparation and loading of sequencing chips;

[0017] 6) Data analysis: The DNA sequencing results were compared with the NCBI database using BLAST, and the species with the highest similarity was the species to which the DNA belonged.

[0018] Preferably, in step 2), amplification is performed according to the following conditions: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, and 35 cycles.

[0019] The application of the primers and kit in the preparation of animal-derived ingredient identification products.

[0020] The primers and kit of the present invention can be applied to identification in the field of public safety, such as identification of false animal-derived ingredients in the fields of food, medicine, environment, etc.

[0021] Compared with conventional DNA barcoding or fluorescent quantitative PCR methods, the primers designed by the present invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, and identify animal-derived ingredients through a pair of primers, thereby improving the detection efficiency of identification of fake animal-derived ingredients in the public security food, drug and environmental protection fields. The primer pairs designed by the present invention cover all mitochondrial loci such as D-LOOP, COX1, COX2, COX3, CYTB, etc. in the amplification range, and have higher species resolution than short fragments. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 for the mitochondrial genome structure;

[0023] Figure 2 This is the electrophoresis detection diagram of Example 2 of the present invention;

[0024] Figure 3 This is the electrophoresis detection diagram of Example 3 of the present invention;

[0025] Figure 4 This is the electrophoresis detection diagram of Example 4 of the present invention. DETAILED DESCRIPTION

[0026] The technical contents of the present invention are described in detail below in conjunction with the accompanying drawings and specific embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any method and material similar or equivalent to the recorded content can be applied to the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0027] The definitions of abbreviations and key terms used in the present invention are as follows:

[0028] Nanopore Sequencing: A new type of DNA sequencing technology that relies on passing a single DNA molecule through a nanoscale hole (nanopore) to read its base sequence. The core component of nanopore sequencing is a nanoscale hole formed by a protein or synthetic material. The hole is embedded in a thin film with electrodes on both sides of the film. When a DNA molecule passes through the nanopore, it blocks the passage of electric current, and different bases (A, T, C, G) block the current in different ways. By detecting the change in current, the DNA sequence passing through the nanopore can be inferred.

[0029] Species Identification: It refers to the identification and determination of the species to which an organism belongs through specific biological methods. It is a key technology in many fields such as ecology, conservation biology, agriculture, and forensics. With the development of technology, the methods of species identification have been continuously improved, covering a variety of methods from traditional morphology to modern molecular biology.

[0030] Example 1 Primer design for identification of animal-derived ingredients based on third-generation sequencing technology

[0031] The present invention analyzes the full-length mitochondrial genome sequences of common animal-derived adulteration species such as pigs, cattle, sheep, chickens, ducks, horses, donkeys, geese, mice, rabbits, camels, dogs, cats, and foxes. The NCBI accession number information of each species is as follows:

[0032] >NC_022418.1 Anas poecilorhyncha mitochondrion, complete genome

[0033] >NC_011196.1 Anser anser mitochondrion, complete genome

[0034] >NC_053523.1 Gallus gallus isolate bGalGal1 mitochondrion,

[0035] complete sequence, whole genome shotgun sequence

[0036] >NC_006853.1 Bos taurus mitochondrion, complete genome

[0037] >NC_009629.2 Camelus ferus mitochondrion, complete genome

[0038] >NC_002008.4 Canis lupus familiaris mitochondrion, complete genome

[0039] >NC_005044.2 Capra hircus isolate V07-146 mitochondrion, completegenome

[0040] >NC_001788.1 Equus asinus mitochondrion, complete genome

[0041] >NC_001640.1 Equus caballus mitochondrion, complete genome

[0042] >NC_001700.1 Felis catus mitochondrion, complete genome

[0043] >NC_005089.1 Mus muscμLus mitochondrion, complete genome

[0044] >NC_001913.1 Oryctolagus cunicμLus mitochondrion, complete genome

[0045] >NC_000845.1 Sus scrofa mitochondrion, complete genome

[0046] >NC_008434.1 VμLpes vμLpes mitochondrion, complete genome

[0047] By sequence consistency comparison, the highly conserved region sequences of mitochondria of different species were analyzed, and universal primers were designed based on the highly conserved regions as the amplification primers for the full-length mitochondria, SEQ ID No.1 primer F: GTATGACCGCGGTGGCTGGCAC; SEQ ID No.2 primer R: CCAAACTGGGATTAGATACCC.

[0048] The present invention takes advantage of the third-generation sequencing technology, which can cover the read length range of hundreds of bp to Mbp, and designs the above-mentioned primer set for identifying fake animal-derived ingredients in public security food, medicine, and environment. The primer set can amplify the full-length mitochondria of various species, and the amplified products include all mitochondrial loci such as D-LOOP, COX1, COX2, COX3, CYTB, etc. Figure 1 The mitochondrial genome structure shown. This method covers a wealth of gene sequence information and can effectively identify closely related species with similar sequences or different populations within the same species.

[0049] Example 2 Method for whole mitochondrial genome sequencing of animal samples using the primer set designed by the present invention

[0050] 1. Reagents and samples: Species DNA (ZYAGEN); KeyPo SE Master mix (Vazyme);

[0051] Primer F is shown as SEQ ID No.1, and primer R is shown as SEQ ID No.2.

[0052] 2. Equipment and instruments: third-generation sequencer, PCR instrument

[0053] 3. Experimental steps:

[0054] 1) Sample amplification:

[0055] The amplification system was prepared as follows: 25 μL of 2xKeyPo SE Master, 1.5 μL of primer F (10 uM), 1.5 μL of primer R (10 uM), 10-200 ng of DNA, and sterile double-distilled water to make up to 50 μL.

[0056] Amplification was performed according to the following program: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, and 35 cycles.

[0057] 2) Agarose gel electrophoresis detection:

[0058] Take 5 μL of the amplified product from the previous step for agarose electrophoresis to detect the quality of the amplified product. The amplified band size is required to be about 16 kb. During electrophoresis, a single specific band should be present without non-specific amplified bands, such as Figure 2 As shown in the electrophoresis detection diagram.

[0059] 3) Sample pretreatment: Use the MμLtiple samples dsDNA Library Prep Kit for ONTLigation Sequencing kit, adopt the ligation method to build a multi-sample mixed library, and combine the non-amplification barcode kit (EXP-NBD104, EXP-NBD114) to sequence the multi-sample library of double-stranded DNA such as genomic DNA and amplification products. The main components are shown in Table 1.

[0060] Table 1

[0061] Serial number Name of each component Location Storage temperature 12 Responses 24 Responses A Magnetic beads Box 1 Refrigerate (2~8℃) 2×0.9mL 2×1.8mL B Cleaning fluid (containing ethanol) Box 1 Refrigerate (2~8℃) 10×1mL 10×2mL C Nuclease-free water Box 2 Freezing (-20℃) 2×1mL 2×2mL D End Repair Buffer Box 2 Freezing (-20℃) 1×50μL 1×100μL E End repair enzymes Box 2 Freezing (-20℃) 1×40μL 1×80μL F TA Connection Master Mix Box 2 Freezing (-20℃) 1×200μL 1×400μL G T4 Quick Ligation Buffer Box 2 Freezing (-20℃) 1×75μL 1×150μL H T4 Fast Ligase Box 2 Freezing (-20℃) 1×35μL 1×70μL

[0062] Procedure: (1 to 1.5 μg gDNA or 300 fmol PCR product is recommended.

[0063] S1: Prepare the mixture in a 0.2 ml PCR tube, mix gently, and then centrifuge briefly.

[0064] Table 2

[0065]

[0066]

[0067] S2: PCR reaction system: 20℃, 10min; 65℃, 5min; 20℃∞.

[0068] S3: Magnetic bead purification: Use 54.5 μL of magnetic beads, wash with washing solution (containing ethanol) B, and elute with 15 μL of nuclease-free water.

[0069] a. Add the reaction system to an equal volume of magnetic beads (1.5 mL centrifuge tube) and gently mix by flicking or pipetting; incubate at room temperature for 10 min.

[0070] b. Transfer the test tube to the magnetic rack and let it stand for 2 minutes; carefully discard the supernatant (be careful not to touch the magnetic beads).

[0071] c. Add 200 μL of washing solution B (containing ethanol) to the tube; after a while, carefully discard the supernatant (be careful not to touch the magnetic beads).

[0072] d. Repeat the steps (using cleaning solution B (containing ethanol) for a second cleaning to remove impurities).

[0073] e. Centrifuge briefly in a mini centrifuge and carefully discard any remaining liquid with a pipette; open the tube cap and air dry for 30 seconds (do not allow to dry out and crack).

[0074] f. Add 15 μL of nuclease-free water for elution and flick to mix; incubate at room temperature for 5 min.

[0075] g. Place the tube back on the magnetic stand until the magnetic beads are attracted to one side of the magnetic stand or the mixed solution becomes clear; transfer 14 μL of the supernatant to a clean PCR tube.

[0076] h. Take 1 μL of DNA for Qubit fluorescence quantification.

[0077] S4: Take equal amounts of samples, add corresponding barcodes and record (NBD01-NBD24), prepare the mixed system in a 0.2 ml PCR tube, mix gently, and then centrifuge briefly.

[0078] Table 3

[0079] Components Volume (μL) End-repaired DNA 12.5 Native Barcode 2.5 F TA connection master mix 15 C Nuclease-free water 30

[0080] S5: PCR reaction system: 25℃, 15min; 65℃, 10min; 20℃∞.

[0081] S6: Magnetic bead purification: Mix all barcoded samples, purify with 1× magnetic beads, wash with washing solution (containing ethanol) B, and elute with 50 μL nuclease-free water. (See above for steps).

[0082] S7: Prepare the mixture in a 0.2 ml PCR tube, mix gently, and then centrifuge briefly.

[0083] Table 4

[0084] Components Volume (μL) Mixed samples 45 Sequencing Adapter II (AM II) 5 G Rapid Ligation Buffer 14 H T4 Fast Ligase 7 Total volume 70

[0085] S8: PCR reaction system: 20℃, 15min; 21℃∞.

[0086] S9: Magnetic bead purification: Use 0.5× magnetic beads (35 μL) short fragment buffer (SFB) to wash and 15 μL elution buffer (EB) to elute.

[0087] a. Add the reaction system to 35 μL of magnetic beads A (1.5 mL centrifuge tube) and gently mix by flicking or pipetting; incubate at room temperature for 10 min.

[0088] b. Transfer the test tube to the magnetic rack and let it stand for 2 minutes; carefully discard the supernatant (be careful not to touch the magnetic beads).

[0089] c. Add 200 μL of Short Fragment Buffer (SFB) to the tube; after a while, carefully discard the supernatant (be careful not to touch the magnetic beads).

[0090] d. Repeat the steps (using short fragment buffer to wash twice to remove impurities).

[0091] e. Centrifuge briefly in a mini centrifuge and carefully discard any remaining liquid with a pipette; open the tube cap and air dry for 30 seconds (do not allow to dry out and crack).

[0092] f. Add 15 μL of elution buffer (EB) to elute and flick to mix; incubate at room temperature (preferably 34°C) for 5 min.

[0093] g. Place the tube back on the magnetic stand until the magnetic beads are attracted to one side of the magnetic stand or the mixed solution becomes clear; transfer 13 μL of the supernatant to a clean PCR tube.

[0094] S10: Take 1 μL barcoded DNA for Qubit fluorescence quantification, and the remaining 12 μL DNA library for on-machine experiment.

[0095] 4) Library construction and sequencing:

[0096] According to the instructions of the third-generation sequencing platform, the amplified products were labeled and connected in sequence to construct the sequencing library. Sequencing was performed on the third-generation sequencing platform.

[0097] Sequencing chip preparation and loading:

[0098] S1: Rotate 90° clockwise to the left to open the P hole.

[0099] S2: Adjust the P1000 to 200, and then slowly rotate to a larger range (approximately to 220-230) until the tip of the gun absorbs the yellow liquid.

[0100] S3: Prepare primer mixture: pipette 30 μL of flushing and fixing solution (FLT) into a tube of flushing buffer (FB) and mix well.

[0101] S4: Use P1000 to push 800 μL of the mixed primer mixture (Priming Mix) into the P hole at a constant speed and wait for 5 minutes.

[0102] S5: Prepare the loading mixture for the library: 75 μL in total.

[0103] Table 5

[0104] Components Volume (μL) Sequencing Buffer(SQB) / (SBII) 37.5 Loading Beads(LB) / (LBII) 25.5 DNA library 12 Total volume 75

[0105] S6: Flip the rubber cover upwards to open the S hole.

[0106] S7: Push 200 μL (P1000) of the mixed primer mixture into the P hole at a uniform speed. At this time, you should see a large droplet flowing upward from the S hole.

[0107] S8: Use P200 to drip 75 μL of the mixed sample solution of the library to be tested from the S hole, and control the dripping speed to ensure that the library fills the chip area.

[0108] S9: Close the S pore and P pore and prepare for sequencing.

[0109] S10: Place the chip into the third-generation sequencer and start sequencing.

[0110] Data Analysis:

[0111] The sequencing results were compared with the NCBI database using BLAST (Basic Local Alignment Search Tool), and the species with the highest similarity was the species to which the DNA belonged.

[0112] Example 3 Accuracy verification experiment of the kit designed by the present invention

[0113] 1. Reagents and samples: Sheep DNA (ZYAGEN); KeyPo SE Master mix (Vazyme);

[0114] Primer F is shown as SEQ ID No.1, and primer R is shown as SEQ ID No.2.

[0115] 2. Equipment and instruments: third-generation sequencer, PCR instrument

[0116] 3. Experimental steps:

[0117] 1) Extract genomic DNA from samples: Use magnetic bead method or column method to extract genomic DNA.

[0118] 2) Sample amplification: Prepare the amplification system as follows: 2xKeyPo SE Master 25μL, Primer F (10uM) 1.5μL, Primer R (10uM) 1.5μL, DNA 10-200ng, sterile double distilled water to 50μL. Amplify according to the following procedure: pre-denaturation at 94℃ for 2min, denaturation at 98℃ for 10sec, annealing at 60℃ for 30sec, extension at 68℃ for 480sec, and 35 cycles.

[0119] 3) Agarose gel electrophoresis detection: Take 5 μL of the amplified product from the previous step for agarose gel electrophoresis detection to detect the quality of the amplified product. The amplified band size is required to be about 16 kb. During the electrophoresis detection, a single specific band should be present, without non-specific amplified bands, such as Figure 3 As shown in the electrophoresis detection diagram.

[0120] 4) Purification of amplified products: Purify the PCR amplified products using the magnetic bead method or other purification methods with equivalent effects.

[0121] 5) Library construction and sequencing: According to the instructions of the third-generation sequencing platform, the amplified products were labeled and connected in sequence to construct a sequencing library. Sequencing was performed on the third-generation sequencing platform. The sequencing result is shown in SEQ ID No. 3.

[0122] 6) Data analysis: The DNA sequencing results were compared with the NCBI database using BLAST, and the species with the highest similarity was the species to which the DNA belonged.

[0123] The comparison results are as follows:

[0124] Query: dna Query ID: lcl|Query_1675869Length: 16491

[0125] >Capra hircus isolate V07-146 mitochondrion, complete genome SequenceID: NC_005044.2Length: 16643

[0126] >Capra hircus isolate V07-146 mitochondrion, complete genome SequenceID: GU295658.1Length: 16643

[0127] Range 1: 480 to 16643

[0128] Score: 29850bits(16164), Expect: 0.0,

[0129] Identities: 16164 / 16164 (100%), Gaps: 0 / 16164 (0%), Strand: Plus / Plus

[0130] By comparison, the sample DNA and Capra hircus, i.e., the mitochondrial genome of sheep, are 100% consistent, indicating that the sample species is sheep. The experimental results show that the primer set of the present invention has high resolution, high accuracy and strong specificity.

[0131] Example 4: Test for the adaptability of the primer set and kit samples designed by the present invention

[0132] 1. Reagents and samples:

[0133] Sample 1: duck blood; Sample 2: original cut mutton; Sample 3: beef jerky; Sample 4: pork jerky (purchased from the market); KeyPoSE Master mix (Vazyme Company);

[0134] Primer F is shown as SEQ ID No.1, and primer R is shown as SEQ ID No.2.

[0135] 2. Equipment and instruments: third-generation sequencer, PCR instrument

[0136] 3. Experimental steps:

[0137] 1) Extract genomic DNA from samples: Use magnetic bead method or column method to extract genomic DNA.

[0138] 2) Sample amplification: Prepare the amplification system as follows: 2xKeyPo SE Master 25μL, Primer F (10uM) 1.5μL, Primer R (10uM) 1.5μL, DNA 10-200ng, sterile double distilled water to 50μL. Amplify according to the following procedure: pre-denaturation at 94℃ for 2min, denaturation at 98℃ for 10sec, annealing at 60℃ for 30sec, extension at 68℃ for 480sec, and 35 cycles.

[0139] 3) Agarose gel electrophoresis detection: Take 5 μL of the amplified product from the previous step for agarose gel electrophoresis detection to detect the quality of the amplified product. The amplified band size is required to be about 16 kb. During the electrophoresis detection, a single specific band should be present, without non-specific amplified bands, such as Figure 4 As shown in the electrophoresis detection diagram;

[0140] 4) Purification of amplified products: Purify the PCR amplified products using magnetic beads or other purification methods with equivalent effects.

[0141] 5) Library construction and sequencing: According to the instructions of the third-generation sequencing platform, the amplified products are labeled and connected in sequence to construct a sequencing library. Sequencing is performed on the third-generation sequencing platform.

[0142] The sequencing result of sample 1 is shown as SEQ ID No.4.

[0143] The sequencing result of sample 2 is shown as SEQ ID No.5.

[0144] The sequencing result of sample 3 is shown as SEQ ID No.6.

[0145] The sequencing result of sample 4 is shown as SEQ ID No.7.

[0146] 6) Data analysis: Perform BLAST sequence comparison on the DNA sequencing results in the NCBI database, and the species with the highest similarity is the species to which the DNA belongs. The comparison results are shown below:

[0147] Sample 1 DNA comparison results:

[0148] Query: sample Query ID: lcl|Query_928503Length: 16436

[0149] >Anas poecilorhyncha mitochondrion, complete genome Sequence ID: NC_022418.1Length: 16608

[0150] >Anas poecilorhyncha mitochondrion, complete genome Sequence ID: KF156760.1Length: 16608

[0151] Range 1: 517 to 16608

[0152] Score: 29717bits(16092), Expect: 0.0,

[0153] Identities: 16092 / 16092 (100%), Gaps: 0 / 16092 (0%), Strand: Plus / Plus

[0154] DNA alignment results of sample 2:

[0155] Query: dna Query ID: lcl|Query_1675869 Length: 16491

[0156] >Capra hircus isolate V07-146 mitochondrion, complete genome Sequence ID: NC_005044.2 Length: 16643

[0157] >Capra hircus isolate V07-146 mitochondrion, complete genome Sequence ID: GU295658.1 Length: 16643

[0158] Range 1: 480 to 16643

[0159] Score: 29850 bits (16164), Expect: 0.0,

[0160] Identities: 16164 / 16164 (100%), Gaps: 0 / 16164 (0%), Strand: Plus / Plus

[0161] DNA alignment results of sample 3:

[0162] Query: sample Query ID: lcl|Query_417931 Length: 16185

[0163] >Bos taurus mitochondrion, complete genome Sequence ID: MF925711.1 Length: 16340

[0164] Range 1: 479 to 16340

[0165] Score: 29226 bits (15826), Expect: 0.0,

[0166] Identities: 15850 / 15862 (99%), Gaps: 0 / 15862 (0%), Strand:

[0167] Plus / Plus

[0168] Sample 4 DNA comparison results:

[0169] Query: sample Query ID: lcl|Query_939985Length: 16459

[0170] >Sus scrofa isolate DM1122 mitochondrion, complete genome Sequence ID: MT483613.1Length: 16620

[0171] Range 1: 486 to 16620

[0172] Score: 29523 bits (15987), Expect: 0.0,

[0173] Identities: 16090 / 16138 (99%), Gaps: 13 / 16138 (0%), Strand: Plus / Plus

[0174] By comparison, the DNA of sample 1 is 100% consistent with Anas poecilorhyncha, indicating that the sample contains duck-derived ingredients; the DNA of sample 2 is 100% consistent with Capra hircus, indicating that the sample contains sheep-derived ingredients; the DNA of sample 3 is 99% consistent with Bos taurus, indicating that the sample contains cattle-derived ingredients; the DNA of sample 4 is 99% consistent with Sus scrofa, indicating that the sample contains pig-derived ingredients. The test results of the above samples are consistent with the labels, and there is no adulteration.

[0175] The above experimental results indicate that the primers designed in the present invention can achieve full-length mitochondrial amplification in different animal-derived DNAs, and accurate identification of animal-derived ingredients can be achieved with only one pair of primers, thereby improving the detection efficiency of identification of fake animal-derived ingredients in the public security food, drug and environmental protection fields.

Claims

1. A primer for identifying animal-derived ingredients based on third-generation sequencing technology, characterized in that: The primers are primer F shown in SEQ ID No.1: GTATGACCGCGGTGGCTGGCAC, and primer R shown in SEQ ID No.2: CCAAACTGGGATTAGATACCC.

2. A kit for identifying animal-derived ingredients based on third-generation sequencing technology, characterized in that Comprising the primer of claim 1.

3. A method for identifying animal-derived ingredients based on third-generation sequencing technology, characterized in that The steps include: 1) Extraction of sample genomic DNA: Extraction of genomic DNA using magnetic bead method or column method; 2) Sample amplification: Prepare the amplification system as follows: 2xKeyPo SE Master 25 μL, primer F10uM 1.5 μL shown in SEQ ID No.1, primer R10uM 1.5 μL shown in SEQ ID No.2, DNA 10-200 ng, and sterile double distilled water to make up to 50 μL; 3) Agarose gel electrophoresis detection: The amplified product of step 2) is subjected to agarose gel electrophoresis detection to detect the quality of the amplified product. The amplified band size is required to be about 16 kb. During the electrophoresis detection, a single specific band should be present without non-specific amplified bands. 4) Purification of amplified products: Purify the PCR amplified products using magnetic beads or other purification methods with equivalent effects; 5) Library construction and sequencing: label and add adapters to the amplified products in sequence, construct a sequencing library, and perform sequencing on a third-generation sequencing platform; 6) Data analysis: The DNA sequencing results were compared with the NCBI database using BLAST, and the species with the highest similarity was the species to which the DNA belonged.

4. The method for identifying animal-derived ingredients according to claim 3, wherein: In the step 2), amplification was performed according to the following conditions: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, and 35 cycles.

5. Use of the primers according to claim 1 in preparing an animal-derived ingredient identification product.

6. Use of the kit according to claim 2 in the preparation of an animal-derived ingredient identification product.

Images