Application of SNP (Single Nucleotide Polymorphism) site of IRS1 gene promoter region as porcine sexual maturity molecular genetic marker

Abstract

The invention discloses an application of an IRS1 gene promoter region SNP (Single Nucleotide Polymorphism) site as a porcine sexual maturity molecular genetic marker. According to the invention, an IRS1 gene promoter region is taken as a research object, and the relevance between the IRS1 gene promoter region and the sexual maturity of the sow is researched by adopting molecular and cell biological methods: g.128307611Cgt is found; a and g.128307308Cgt, and g.128307308C T is obviously related to group mature day age of Dupin black pigs; then different vectors are transfected, and different influences of different genotypes of the sites on the activity of the IRS1 gene promoter are studied. Furthermore, sow ovarian granular cells are used as experimental materials, experimental technologies such as transcriptome sequencing, a total iron colorimetric method and a malondialdehyde colorimetric method are adopted to research the influence of the IRS1 gene on the transcriptome level and ferroptosis of the sow ovarian granular cells, and the result shows that the IRS1 gene influences the signal paths that cell transcriptome differential genes are mainly enriched to iron ion homeostasis and the like; the ferroptosis of the cells is inhibited.

Description

Technical Field

[0001] The invention belongs to the technical field of cell engineering and gene engineering, and specifically relates to the application of a SNP site in a promoter region of an IRS1 gene as a molecular genetic marker for sexual maturity of pigs. Background Art

[0002] The first estrus and egg discharge of female mammals are signs that the animal body has reached sexual maturity and has reproductive capacity. The follicle is the basic structural and functional unit of the ovary. The single layer of flat granulosa cells in the follicle undergoes continuous proliferation and differentiation, and eventually the follicle matures and ruptures, and the follicular fluid and oocyte are discharged. However, only a very small number of follicles can develop to mature and ovulate. During the development process, the granulosa cells will initiate their own programmed death to regulate the follicle to atresia and degeneration. When the number of granulosa cells that undergo apoptosis in a follicle reaches 10%, it can be considered that the follicle enters the atresia state. Single nucleotide polymorphism SNP (single nucleotide polymorphism, SNP) refers to the DNA sequence polymorphism caused by mutations such as deletion, conversion, insertion, and transversion of a single nucleotide, and is a third-generation molecular genetic marker. This diallelic molecular marker has the advantages of rich sites, genetic stability, and convenient detection, so that SNP can provide more information in studying the genetic variation of organisms, and can be used to analyze more complex genetic problems. It is currently one of the most commonly used methods for evaluating the genetic polymorphism of biological populations.

[0003] The insulin receptor substrate protein family IRS is a class of phosphorylated proteins involved in insulin signal transduction. Phosphorylated IRS binds to the SH2 domain of other proteins and produces different functions according to the different protein structures where the domain is located. IRS1, as the most important representative of this protein family, is also an activator of the PI3K / AKT signaling pathway. miR-195 targets and binds to IRS1 to downregulate its expression level, inhibits PI3K / AKT signal transduction, and promotes vascular endothelial cell senescence, leading to atherosclerosis; overexpression of lncRNAPEG13 weakens the inhibitory effect of ox-LDL (lncRNAPEG13 inhibitor) on IRS1 and PI3K / AKT signal transduction, significantly improves HUVEC cell viability, promotes angiogenesis, and inhibits cell senescence, but knocking down IRS1 reverses this phenomenon. In studies on lung adenocarcinoma, IRS1 binds to FBXL16 to increase IGF1 / AKT signal transduction and promote the growth and migration of lung cancer cells. However, there is still no report on the association between the SNP site in the promoter region of the IRS1 gene and the sexual maturity of sows. Summary of the invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, one of the objectives of the present invention is to provide a SNP molecular marker associated with pig sexual maturity.

[0005] The second object of the present invention is to provide the application of the above-mentioned SNP molecular markers related to pig sexual maturity.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The SNP molecular markers associated with pig sexual maturity include at least one of the following SNP molecular markers:

[0008] (1) The SNP site corresponding to the C>A mutation at position g.128307611 on chromosome 15 of the porcine reference genome Sscrofa11.1 (i.e., -290 bp in the promoter region of the porcine insulin receptor substrate 1 (IRS1) gene);

[0009] (2) The SNP site corresponding to the C>T mutation at position g.128307308 on chromosome 15 of the pig reference genome Sscrofa11.1 (i.e., 13bp in the promoter region of the pig insulin receptor substrate 1 (IRS1) gene).

[0010] The application of the above-mentioned SNP molecular markers related to pig sexual maturity includes at least one of the following applications:

[0011] A. Application in assessing the age of first estrus in pigs;

[0012] B. Application in judging the onset of puberty in pigs;

[0013] C. Application in breeding high-yield pigs.

[0014] Furthermore, in the application A, the genotype of the g.128307611 locus is detected, and the age at first puberty of individuals with the genotype of CA is shorter than that of CC and AA individuals; and / or, the genotype of the g.128307308 locus is detected, and the age at first puberty of individuals with the genotype of CC is shorter than that of TT individuals.

[0015] Furthermore, in the application B, the genotype of the g.128307611 locus is detected, and the individual pigs with the genotype CA experience the onset of puberty faster than the CC and AA individuals; and / or, the genotype of the g.128307308 locus is detected, and the individual pigs with the genotype CC experience the onset of puberty faster than the TT individuals.

[0016] Furthermore, in the application C, the genotype of the g.128307611 locus is detected, and individuals with a genotype of CA are selected as breeding pigs; and / or, the genotype of the g.128307308 locus is detected, and individuals with a genotype of CC are selected as breeding pigs.

[0017] Furthermore, the pigs include any one of Duroc and its synthetic lines.

[0018] The above applications are for non-diagnostic purposes.

[0019] A primer for identifying the above-mentioned SNP molecular marker associated with pig sexual maturity, comprising:

[0020] F: 5′-ACGTCTCCGTAGCTCAAGTC-3′;

[0021] R: 5′-TCCCCCTGCCCAAGGATATT-3′.

[0022] Application of the IRS1 gene in regulating ferroptosis of pig ovarian granulosa cells, the application being any one or more of the following applications:

[0023] I. Application of overexpression of IRS1 gene to inhibit ferroptosis of ovarian granulosa cells in vitro;

[0024] II. Application of knocking down IRS1 gene to promote ferroptosis of ovarian granulosa cells in vitro.

[0025] Furthermore, the overexpression of IRS1 gene is achieved by the following method: connecting the nucleic acid molecule encoding the porcine IRS1 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing the IRS1 gene into sow ovarian granulosa cells cultured in vitro.

[0026] Furthermore, the knockdown of IRS1 gene is achieved by transfecting siRNA, and the siRNA sequence is as follows: IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′.

[0027] The promotion or inhibition of ferroptosis is determined by measuring the total iron and malondialdehyde (MDA) content and comparing the mRNA and protein expression levels of pathway marker genes.

[0028] The verification results of the present invention are as follows:

[0029] 1. Two SNP sites were discovered in the promoter region of the IRS1 gene.

[0030] 2. In the Douro black pig population, the CA genotype individuals at the g.128307611C>A locus reached sexual maturity at an age significantly earlier than that of the CC and AA genotype individuals; the CC genotype individuals at the g.128307308C>T locus reached sexual maturity at an age significantly earlier than that of the TT genotype individuals.

[0031] 3. No potential transcription factor binding site was predicted before the g.128307611C>A site mutation, but it may bind to transcription factors RAP1 and C / EBPalp after the mutation; g.128307308C>T site may bind to transcription factors AP-2α and SP1 before and after the mutation.

[0032] 4. Compared with the wild-type WT-7611 cells in the control group, there was no significant change in the IRS1 gene promoter activity in the mutant vector Mut-7611 group cells; the activity of the Mut-7308 group cells was significantly higher than that in the WT-7308 group.

[0033] 5. By transfecting 1000 ng / mL of the overexpression vector into sow ovarian granulosa cells, qRT-PCR was used to detect the expression of IRS1 and found that the transfection efficiency of pcDNA3.1-IRS1 was good and the difference was significant. In subsequent studies, 1000 ng / mL was selected as the transfection concentration of pcDNA3.1-IRS1.

[0034] 6. Synthesize IRS1 interference fragment / control (IRS1-siRNA / siRNA-NC), screen and detect its interference efficiency. As shown in the attached figure, the small fragment of gene interference was transfected into the ovarian granulosa cells of sows. By qRT-PCR, the IRS1-siRNA small fragment had a good interference effect and was used for subsequent experiments.

[0035] IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′;

[0036] 7. There were 331 genes significantly upregulated and 31 genes significantly downregulated in the pcDNA3.1-IRS1 group. The differentially expressed genes were mainly involved in signaling pathways such as iron ion homeostasis, cell proliferation, and programmed cell death.

[0037] 8. There were 240 genes significantly upregulated and 393 genes significantly downregulated in the siRNA-IRS1 group. The differentially expressed genes were mainly involved in biological processes such as cell migration, epithelial cell differentiation, inorganic cation transmembrane transport and regulation of GTPase activity.

[0038] 9. The total iron ion level of cells in the pcDNA3.1-IRS1 group decreased, while the total iron ion level of cells in the siRNA-IRS1 group increased, but the changes in both groups did not reach a statistically significant level.

[0039] 10. There was no significant difference in the MDA level of cells in the pcDNA3.1-IRS1 group compared with the control group, but the MDA level of cells in the siRNA-IRS1 group was significantly higher than that in the control group.

[0040] 11. Compared with the control group, overexpression of IRS1 can significantly increase the mRNA expression level and protein expression level of SLC7A11 gene, and significantly reduce the mRNA and protein expression level of P53 gene; while knocking down IRS1 can significantly reduce the mRNA and protein level of SLC7A11 gene, significantly increase the mRNA expression level of P53 gene, and the difference in protein expression level is not significant. In summary, IRS1 can inhibit cell ferroptosis.

[0041] Compared with the prior art, the present invention has the following advantages and effects:

[0042] 1. The present invention uses ear-like tissue of Duroc pig (Duroc pig × country black pig) as experimental material, adopts Sanger sequencing technology to discover SNP sites in the promoter region of IRS1 gene, and studies the relationship between SNP sites and the age of sexual maturity of Duroc pig population: Combining trait association analysis and population genetic structure analysis, it is found that the g.128307611C>A site and the g.128307308C>T site are significantly correlated with the age of sexual maturity of Duroc pig population.

[0043] 2. The present invention uses the above two SNP sites as research objects, and uses molecular and cell biology methods to study their application in sow ovarian granulosa cells: predict potential transcription factor binding sites through bioinformatics websites; by transfecting WT-7611, Mut-7611, WT-7308 and Mut-7308 vectors, it is found that there is no significant change in the IRS1 gene promoter activity of the Mut-7611 group cells; the cell activity of the Mut-7308 group is significantly higher than that of the WT-7308 group. It has a good application value for studying the effect of the IRS1 gene promoter SNP site on the sexual maturity of sows.

[0044] 3. The present invention uses sow ovarian granulosa cells as experimental materials, and adopts transcriptome sequencing, total iron colorimetry, malondialdehyde (MDA) colorimetry, qRT-PCR, Western Blot and other experimental techniques to study the effect of IRS1 gene on the transcription level and ferroptosis of sow ovarian granulosa cells. It is found that the differential genes of the cell transcriptome affected by IRS1 gene are mainly enriched in signal pathways such as iron ion homeostasis, thereby inhibiting cell ferroptosis.

[0045] 4. The technical solution of the present invention is well designed and the results are reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is the result of PCR amplification of the promoter region of IRS1 gene.

[0047] Figure 2 This is a diagram showing the effect of SNP sites on the promoter activity of the IRS1 gene.

[0048] Figure 3 This is a graph showing the efficiency of the overexpression vector pcDNA3.1-IRS1.

[0049] Figure 4 This is a graph showing the efficiency detection of the interference fragment IRS1-siRNA.

[0050] Figure 5 It is an analysis diagram of the effect of overexpression / interference of IRS1 gene on the transcription level of pig ovarian granulosa cells; among them, a and b are the effects of overexpression of IRS1 on the transcription level of sow ovarian granulosa cells; c and d are the effects of interfering with IRS1 on the transcription level of sow ovarian granulosa cells.

[0051] Figure 6 This is a graph showing the total iron ion level in pig ovarian granulosa cells detected by total iron colorimetric method after overexpression / interference of IRS1 gene.

[0052] Figure 7 This is a graph showing the malondialdehyde (MDA) level in pig ovarian granulosa cells detected by the malondialdehyde (MDA) colorimetric assay after overexpression / interference of the IRS1 gene.

[0053] Figure 8 It is a diagram to detect the effects of overexpression / interference of IRS1 gene on the levels of key genes in the ferroptosis signaling pathway of pig ovarian granulosa cells; wherein, a is the effect of overexpression / interference of IRS1 on the transcription level of key genes in the ferroptosis signaling pathway of sow ovarian granulosa cells; b is the effect of overexpression / interference of IRS1 on the protein expression level of key genes in the ferroptosis signaling pathway of sow ovarian granulosa cells. DETAILED DESCRIPTION

[0054] The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0055] The present invention applies statistical methods to analyze the results of three independent experiments in each embodiment, calculate the "mean ± standard deviation", and use one-way analysis of variance to perform significant difference analysis (in the figure, "*" indicates P < 0.05, and "**" indicates P < 0.01).

[0056] The test samples collected in the following embodiments are ear samples of a binary hybrid pig of Duroc and country black pig (abbreviated as Duroc black pig). The sampling site is located at the Niujiaowan R&D Farm of Guangdong No. 1 Food Co., Ltd., and all pigs are fed and managed using unified standards.

[0057] The present invention uses R language (v4.03) and general linear model (GLM) to analyze the genetic association between SNP and puberty. The model is as follows:

[0058] Yij=L+Gj

[0059] Where Yij is the observed pubertal age of the ith animal, L is the mean pubertal age, and Gj represents the genotype effect. For different genotypes, they are coded as dummy variables through categorical variable coding. Statistics are expressed as "mean ± standard deviation".

[0060] Example 1: DNA extraction

[0061] The present invention adopts the traditional chloroform method to extract DNA from the sow genome, and the specific method steps are as follows:

[0062] (1) Tissue sample processing: Take approximately 0.2 g of pig ear tissue sample and place it in a labeled 2 ml centrifuge tube. Use sterile ophthalmic surgical scissors to cut the ear sample thoroughly and evenly in the centrifuge tube.

[0063] (2) Tissue lysis and digestion: Add 1 ml of tissue lysis buffer to the centrifuge tube in step (1). Then, add 40 mL of 20 mg / ml proteinase K, immediately cover the centrifuge tube, and gently invert it several times to ensure that the proteinase K and tissue lysis buffer are fully mixed. Place the centrifuge tube in a preheated 56°C water bath overnight for digestion until the ear sample tissue is completely dissolved.

[0064] (3) After the sample is completely digested, centrifuge it at 12,000 rpm for 10 min at 4°C.

[0065] (4) Take 950 μL of the supernatant, add an equal volume of Tris-saturated phenol, shake well for 10 min, and centrifuge at 12,000 rpm for 10 min in a low-temperature centrifuge at 4°C.

[0066] (5) Take 900 μL of the supernatant and place it in a new 2 ml centrifuge tube. Add 900 μL of an equal volume of phenolform mixture, shake well for 10 min, and centrifuge at 12,000 rpm in a low-temperature centrifuge at 4°C for 10 min.

[0067] (6) Take 850 μL of the supernatant and place it in a new 2 ml centrifuge tube. Add 850 μL of an equal volume of phenolform mixture, shake well for 10 min, and centrifuge at 12,000 rpm in a low-temperature centrifuge at 4°C for 10 min.

[0068] (7) Take 800 μL of the supernatant and place it in a new 2 ml centrifuge tube. Add 800 μL of an equal volume of phenolform mixture, shake well for 10 min, and centrifuge at 12,000 rpm in a low-temperature centrifuge at 4°C for 10 min.

[0069] (8) Take 750 μL of the supernatant and quickly add 800 μL of pre-cooled anhydrous ethanol. Gently invert the tube to mix until a white precipitate is formed.

[0070] (9) Gently pick out the precipitated DNA with a pipette tip and transfer it to a 1.5 ml centrifuge tube. Add 800 μL of 75% alcohol for rinsing and centrifuge at 12,000 rpm in a 4°C low-temperature centrifuge for 10 min.

[0071] (10) Remove excess alcohol, place in a clean bench fume hood, open the centrifuge tube lid for ventilation for a while. Add 200 μL Elution Buffer preheated to 37°C, pipette thoroughly to dissolve. Store in a -20°C refrigerator.

[0072] Experimental Example 2: RNA Extraction

[0073] The specific operation process of extracting RNA using Trizol as lysis buffer is as follows:

[0074] (1) Treat adherent cells: Taking a 6-well plate as an example, add 500 μL Trizol to each well, place the cell culture plate on ice for 10 to 15 min, then use a pipette to blow down the cells in the same treatment group and collect them together, place them in a low-temperature centrifuge at 4°C and centrifuge at 12,000 rpm for 5 min, and carefully transfer the supernatant to a new 1.5 mL RNase-free tube. Do not absorb impurities;

[0075] (2) Mix chloroform and Trizol in a ratio of 1:5, add 1 mL of the mixed chloroform to the supernatant, shake and mix, then let stand on ice for 5 min, centrifuge at 12000 rpm at 4°C for 5 min, and carefully transfer the upper aqueous phase to a new 1.5 mL RNase-free tube;

[0076] (3) Add 1 mL of a mixture of isopropanol and Trizol (isopropanol:Trizol=1:2), gently invert and mix, let stand on ice for 10 min, centrifuge at 12000 rpm for 10 min at 4°C, and discard the supernatant;

[0077] (4) Add 1 mL of 75% ethanol-DEPC (75% ethanol:DEPC = 1:1) precooled to 4°C, gently blow the RNA precipitate to wash the RNA, then centrifuge at 12,000 rpm for 15 min at 4°C, and discard the supernatant;

[0078] (5) Open the lid of the centrifuge tube and allow the RNA to dry at room temperature for 5 to 10 minutes to evaporate the ethanol as much as possible, but also prevent the RNA precipitate from over-drying;

[0079] (6) Add 30 μL of DEPC water precooled to 4°C to dissolve the RNA precipitate and store in a -80°C refrigerator.

[0080] Example 3: Genomic DNA and RNA quality detection and concentration determination

[0081] (1) Agarose gel electrophoresis to detect RNA and DNA integrity

[0082] Preparation of 1% agarose gel: Add 1×TAE buffer and agarose powder in a conical flask in proportion, heat in a microwave oven for 3 to 5 minutes to completely dissolve it, take it out and cool it for a while, add 1 to 3 μL EB stain, shake it gently, pour it into the plate and insert the comb, and place it at room temperature for 30 minutes before use. Take 5 μL of the DNA or RNA solution to be tested, add 1 μL 6×LoadingBuffer and mix well, put the 1% agarose gel into the electrophoresis tank for spotting, and run the electrophoresis instrument at 150V / cm for 25 minutes. After the electrophoresis is completed, put the gel into the UV analyzer for observation and take a photo for preservation. The DNA sample should have only one band, and the RNA sample should have three small molecule RNA bands of 28S, 18S and 5S, with no obvious signs of degradation before and after.

[0083] (2) Detection of genomic DNA concentration and purity

[0084] NanoDrop 2000 UV spectrophotometer (Thermo): Turn on the instrument and select the double-stranded nucleic acid (DNA) or single-stranded nucleic acid (RNA) type. Pipette 1 μL Elution Buffer to clean the detection base and click the Blank button for calibration. Gently wipe the base with qualitative filter paper and add 1 μL of the DNA or RNA sample to be tested. Click the Measure button to measure.

[0085] After the measurement, wash the detection base with Elution Buffer and turn off the instrument. Qualified DNA / RNA sample standards: A260 / A230 ratio between 1.8 and 2.2, A260 / A280 ratio between 1.7 and 2.1.

[0086] Example 4: Cloning of the porcine IRS1 gene promoter sequence

[0087] The promoter sequence of the porcine IRS1 gene (Gene ID: 100512686) was searched in the NCBI database, and specific primers for cloning the promoter sequence of the IRS1 gene were designed. The primer sequences are as follows:

[0088] F: 5′-ACGTCTCCGTAGCTCAAGTC-3′;

[0089] R: 5′-TCCCCCTGCCCAAGGATATT-3′.

[0090] The promoter region of IRS1 gene was amplified using the extracted DNA from pig ears as template.

[0091] Example 5: Cultivation of sow ovarian granulosa cells

[0092] (1) Ovaries of healthy commercial sows were collected at Kongwangji Slaughterhouse in Huangpu District, Guangzhou. Ovaries with ruddy and shiny surface, healthy, normal development, and moderate size were selected, placed in PBS containing 1% double antibody, and placed with ice packs around to keep the temperature low. They were quickly brought back to the cell room for subsequent experiments;

[0093] (2) Wash the sow ovaries 2 to 3 times with PBS containing 1% double antibody, then soak them in 75% alcohol for 30 seconds, and finally wash the ovaries with PBS containing 1% double antibody until the solution is clear and transparent. After sealing, quickly transfer them to the clean bench in the cell room for operation;

[0094] (3) Add 4 mL of DMEM medium to a 15 mL centrifuge tube, use forceps to pick up the ovary, use a disposable 1 mL sterile syringe to draw 1.5 mL of follicular fluid, inject it into the 15 mL centrifuge tube prepared with medium, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0095] (4) Add 3 mL of PBS containing 2% double antibody to resuspend and wash the cells, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0096] (5) Repeat the above steps once;

[0097] (6) Add 1 mL of complete culture medium and gently pipette to resuspend the cells. Inoculate the cells in a 75 cm 2 The cell culture flask was placed in a 37°C, 5% CO2 cell culture incubator for culture;

[0098] (7) After 48 h of culture, observe the cell adhesion using an inverted microscope and change the medium or plate the cells according to their growth conditions.

[0099] Example 6: Inoculation and transfection of recombinant plasmids

[0100] 1. Inoculation and transfection of mutation site recombinant plasmid

[0101] (1) When the cell confluence reaches 70-80%, discard the old culture medium and wash the adherent cells 1-2 times with PBS containing 2% double antibody;

[0102] (2) Steps ② to ⑥ of the same subculture process;

[0103] (3) Gently pipette an appropriate amount of complete medium to resuspend the cells, inoculate an appropriate amount of the cell suspension in a cell culture plate, shake gently to evenly distribute the cells, place in a 37°C, 5% CO2 incubator, observe after 24 hours, and conduct subsequent experiments depending on their growth conditions;

[0104] (4) Transfection can be performed only when the cell confluence reaches 70-80%;

[0105] (5) Press Prepare transfection reagent according to the 3000 kit instructions, prepare solution A: Opti-MEM and Lipofectamine TM 3000; prepare solution B: Opti-MEM, recombinant plasmid, pGL-TK plasmid and P3000, gently mix, add solution A to solution B, gently blow and mix, incubate at room temperature in the dark for 15 minutes, add to cell culture plate, transfect (each treatment group needs at least 3 replicates), after transfection, culture in a 37°C, 5% CO2 incubator;

[0106] Among them, pRL-TK plasmid is a commercially available plasmid obtained from the Key Laboratory of Agricultural Animal Genomics and Molecular Breeding of Guangdong Province; the recombinant plasmids include wild-type and mutant vectors of g.128307611C>A site, named WT-7611 and Mut-7611; and wild-type and mutant vectors of g.128307308C>T site, named WT-7308 and Mut-7308; all were commissioned to Wuhan Jinkairui Bioengineering Co., Ltd. for synthesis, the basic plasmid used was pGL3-basic, the cloning sites were KpnI and XhoI, and the target sequences were as follows:

[0107] WT-7611 target sequence: GTGCAACGTTGGGACTTGGCAGCTCGCCTCCCCCTGCCCAAGGATATTTAATTTGCCTCGGGAATCGCTACTTCCAGAGGGGAACTCAGGAGGGAAGGCGCGCGTGCCTGGAGGGGCAACGCGGGGACCCCCGGCCGCCGCCGC CTGCGCGCCGGACTCCAGCCCTGGCGGCGAGCGATGCATCTTCTCCTTCCCAGCCGCGGCGGCTGAGAAGAGATTTGGCTCCCCGAGGATCCCGGGCTGCACTCACGCCGGACGCGCTGCCTCCCCCCAGGGCATGAAACGCCAGTAAACTCCGG

[0108] Mut-7611 target sequence: GTGCAACGTTGGGACTTGGCAGCTCGCCTCCCCCTGCCCAAGGATATTTAATTTGCCTCGGGAATCGCTACTTCCAGAGGGGAACTCAGGAGGGAAGGCGCGCGTGCCTGGAGGGGCAACGCGGGGACCCCCGGCCGCCGCCGCCTGCGCGCCGGACTCCAGCCCTGGCGGCGAGAGATGCATCTTCTCTCCTTCCCAGCCGCGGCGGCTGAGAAGAGATTTGGCTCCCCGAGGATCCGGGCTGCACTCACGCCGGACGCGCTGCCTCCCCCCAGGGCATGAAACGCCAGTAAACTCCGG

[0109] WT-7308 target sequence: CAGCTGCTGCGTCCTCCCTCGGCTGCCCCTCCCCGGCGCGGAGGGCGGCGTGGATTTCGGAGTCGGGGTTTCTGCCGCCTCCAGCCCTGTTTGCATGTGCGGGGCCGCGGCGAGGAGCCTCCGCCCCCCACCCGGTTGTTTTTCGGCGCCTCCCTCTCCTCGGCGGCGGTGGCGGCGGCAGCATGGCGAGCCCTCCCGAGACGGATGGCTTCTCGGACGTGCGCAAGGTGGGCTACCTGCGCAAACCCAAGAGCATGCACAAGCGCTTTTTCG

[0110] Mut-7308 target sequence: CAGCTGCTGCGTCCTCCCTCGGCTGCCCCTCCCCGGCGCGGAGGGCGGCGTGGATTTCGGAGTCGGGGTTTCTGCCGCCTCCAGCCCTGTTTGCATGTGCGGGGCCGCGGCGAGGAGCCTCCGCCCCCCACCCGGTTGTTTTTCGGCGCCTCCCTCTCTTCGGCGGCGGTGGCGGCGGCAGCATGGCGAGCCCTCCCGAGACGGATGGCTTCTCGGACGTGCGCAAGGTGGGCTACCTGCGCAAACCCAAGAGCATGCACAAGCGCTTTTTCG。

[0111] (6) Conduct subsequent experiments according to the expected experimental plan.

[0112] 2. Inoculation and transfection of pcDNA3.1-IRS1 or IRS1-siRNA

[0113] When the fusion degree of porcine GCs reaches about 80%, discard the culture medium in the bottle, wash twice with PBS containing 1% penicillin-streptomycin, and discard PBS. Add 3mL of trypsin to the bottle, put it in the cell culture incubator for digestion for 5 minutes, and observe the cell adhesion under a microscope. When most of the cells are round and float with the liquid, it means that the digestion is complete. Add 4mL of complete culture medium to terminate the digestion. After blowing the wall of the culture bottle with a pipette tip, transfer the mixed solution in the bottle to a 15mL centrifuge tube and centrifuge at 1000rpm for 5 minutes at room temperature. Discard the supernatant, wash twice with PBS containing 1% penicillin-streptomycin, and discard the supernatant. Add 3mL of complete culture medium to resuspend the cells and inoculate them in the cell culture plate. After gently shaking the "cross" to mix, place it in a 37℃, 5% CO2 incubator for static culture. Observe the cell adhesion and growth status after 24 hours. When the fusion degree of GCs reaches 70-80%, discard the complete culture medium, wash twice with PBS, and add incomplete culture medium.

[0114] Prepare solution A: Opti-MEM and Lipofectamine TM 3000 and mix well. Prepare solution B: Opti-MEM, overexpression plasmid and P3000, or Opti-MEM and small RNA fragments, and mix gently. Add solution A to solution B, pipette and mix gently, and incubate at room temperature in the dark for 15 minutes. The overexpression plasmid is constructed as follows:

[0115] Basic plasmid: pcDNA3.1 plasmid

[0116] Insertion sites: BstEII and NotI

[0117]

[0118] The sequence of the small RNA fragment siRNA is as follows: 5′-GCCUAUGCCAGCAUCAGUUTT-3′.

[0119] Add the AB solution mixture to the cell culture plate, shake it gently in a "cross" pattern to mix the mixture with the culture medium thoroughly, and then place the culture plate in a constant temperature 5% CO2 cell culture incubator for culture and transfection for 24 hours. Perform subsequent experiments according to the experimental design.

[0120] Example 7: Dual fluorescence activity detection of recombinant plasmid in the promoter region of IRS1 gene

[0121] Refer to the instructions of the dual luciferase detection kit to detect the dual fluorescence activity of the recombinant plasmid in the promoter region of the IRS1 gene. The steps are as follows:

[0122] (1) 24 hours after transfection, discard the culture medium, wash the cells twice with PBS containing 1% double antibody, add 100 μL of cell lysis buffer to each well, gently shake the cell culture plate to allow the cell lysis buffer to completely cover the cells, and incubate the cell culture plate on ice for 5 minutes;

[0123] (2) Pipette 50 μL of cell lysate and add it to the dual fluorescence detection plate. Add 75 μL of Luciferase Assay Reagent to each well and mix gently with a pipette. Incubate at room temperature for 15 min and then detect the luminescence value.

[0124] (3) Add 75 μL of Stop& Reagent, mix gently with a pipette, incubate at room temperature for 15 min, and then detect the luminescence value.

[0125] (4) Calculation: Relative activity of firefly luciferase = luminescence value of firefly luciferase / luminescence value of Renilla luciferase.

[0126] Experimental Example 8: Strand-specific transcriptome sequencing

[0127] (1) Take a certain amount of total RNA sample and use oligodT to obtain mRNA from the total RNA;

[0128] (2) mRNA disruption;

[0129] (3) Random primers are added to the fragmented mRNA to synthesize one strand of cDNA;

[0130] (4) cDNA second-strand synthesis, using dUTP instead of dTTP;

[0131] (5) End repair, A addition, and adapter ligation of double-stranded cDNA;

[0132] (6) PCR and PCR product recovery;

[0133] (7) Library quality testing;

[0134] (8) Circularization of library products;

[0135] (9) Circular DNA molecules replicate through rolling circles to form DNA nanoballs (DNBs) 10. Sequencing on the DNBSEQ platform.

[0136] Experimental Example 9: Detection of total cellular iron ion levels

[0137] (1) Reagent preparation

[0138] ①Before testing, remove the reagent and allow it to return to room temperature.

[0139] ② Prepare 100μmol / L iron standard: Take 20μL of reagent 3 and mix with 1980μL of ddH2O. Prepare as needed and use immediately.

[0140] ③ Dilution of standards of different concentrations:

[0141] Table 1 Standard dilution system

[0142]

[0143] (2) Sample processing

[0144] Cell sample: Collect about 1×10 6 For each cell, add 200 μL of reagent 1, mix thoroughly, place on ice for 10 min, centrifuge at 15,000 × g at 4°C for 10 min, and take the supernatant.

[0145] (3) Operation steps

[0146] ① Standard wells: Take 80μL of standard products of different concentrations and add them to the corresponding wells of the ELISA plate. Determination wells: Take 80μL of the sample to be tested and add them to the corresponding wells of the ELISA plate.

[0147] ② Add 80 μL of reagent 2 to each well.

[0148] ③ Shake gently to mix, and incubate in a 37℃ constant temperature incubator for 40 min.

[0149] ④ Use an ELISA reader to measure the OD value of each well at 593 nm.

[0150] (4) Calculate the total iron ion content in cells (nmol / 10 6 ):

[0151]

[0152] Note: Standard fitting curve: y = ax + b

[0153] y: Standard OD value - blank OD value (OD value when the standard concentration is 0)

[0154] x: concentration of the standard

[0155] a: slope of the curve

[0156] b: intercept of the curve

[0157] ΔA: Absolute OD value of the sample - OD value of the test well + OD value of the blank well

[0158] N: Number of cell samples used for lysis (calculated by cell number) / 10 6

[0159] V: Amount of reagent added when processing cell samples (mL)

[0160] f: dilution factor of the sample before adding it to the detection system

[0161] Experimental Example 10: Malondialdehyde (MDA) Level Detection

[0162] (1) Reagent preparation:

[0163] ①Before testing, remove the reagent and allow it to return to room temperature.

[0164] ② Reagent 1 may solidify when stored in a 4℃ refrigerator. It can be heated in a 37℃ constant temperature water bath and can be used only when the liquid melts to a transparent state.

[0165] ③ If reagent 3 precipitates, it needs to be heated and dissolved in a constant temperature water bath at 80℃ and used after cooling.

[0166] ④Prepare reagent 2 application solution:

[0167] Reagent 2: double distilled water = 1.2:34, stored at 4°C for 3 months.

[0168] ⑤ Prepare the working solution: Prepare it in the ratio of reagent 1: reagent 2 application solution: reagent 3 = 0.2:3:1, and use it immediately after preparation.

[0169] (2) Sample preparation

[0170] Take at least 3×10 6 cells, discard the cell culture medium, digest the cells with trypsin, transfer the cells of the same treatment group to a 1.5mL sterile centrifuge tube, add 500μL of reagent V extraction solution, mix upside down for 2min, and use an ultrasonic disruptor or a glass homogenizer to manually homogenize the cells to make a suspension for testing.

[0171] Note: Ultrasonic crushing: The parameters of the ultrasonic crusher can be selected as 90W, 4s / time, interval 2s, and total time 10min.

[0172] (3) Operation steps

[0173] ① Add 100 μL of anhydrous ethanol (blank tube), 100 μL of 10 nmol / mL standard (standard tube), and 100 μL of the sample to be tested (sample tube) into the corresponding 1.5 mL EP tubes.

[0174] ② Add 1 mL of working solution to each tube in ①.

[0175] ③Wrap the EP tube mouth with aluminum foil, turn it upside down to mix well, and place it in a 100℃ water bath for 40 minutes.

[0176] ④ Cool to room temperature and centrifuge at 1078×g for 10 min.

[0177] ⑤ Take 250 μL of supernatant and transfer it to a 96-well plate. (Do not add the precipitate to the ELISA plate).

[0178] ⑥ Use an enzyme-labeled instrument to measure the OD value of the test solution at 532nm.

[0179] (4) Calculate the malondialdehyde content in cells (nmol / mgprot):

[0180]

[0181] ΔA1: OD value of the measuring tube - OD value of the blank tube

[0182] ΔA2: OD value of standard tube - OD value of blank tube

[0183] C: Standard concentration (10nmol / mL)

[0184] f: dilution factor of the sample before adding it to the detection system

[0185] Cpr: protein concentration of the sample to be tested (mgprot / mL)

[0186] Experimental Example 11: qRT-PCR detection of gene expression

[0187] According to the sequence information of the CDS region of the target gene provided by the NCBI database, the primer-blast function in the NCBI website was used to design the quantitative primers of the target gene, GAPDH was used as the internal reference, and the length of the qRT-PCR product generally did not exceed 300 bp.

[0188] Table 2 qRT-PCR primer list

[0189]

[0190] Note: All the above primers belong to pig species.

[0191] The qRT-PCR process refers to the instructions of Maxima SYBR Green qPCR Master Mix reagent. The qRT-PCR reaction system is shown in Appendix 3. The Ct values ​​of the reference gene and the target gene are obtained by qRT-PCR, and the relative expression of the target gene is calculated using the 2-△△Ct method:

[0192] Relative expression level = 2 -[(实验组目的基因Ct值-实验组内参Ct值)-(对照组目的基因Ct值-对照组内参Ct值)]

[0193] Table 3 qRT-PCR reaction system

[0194]

[0195]

[0196] Note: The reaction program is 95℃15min; 95℃5s, 60℃1min, 40 cycles.

[0197] Experimental Example 12: Western Blot

[0198] (1) Total protein extraction (taking 6-well plate as an example):

[0199] ① Pour away the culture medium and add appropriate amount of PBS to each well and wash 2 to 3 times.

[0200] ② Add 100 μL of protein lysis buffer (protease inhibitor: RIPA = 1:100) to each well, and place the cell culture plate on a shaker at 4°C and shake gently for 15 to 20 minutes.

[0201] ③ Use a pipette to repeatedly blow the cells in the well to ensure that the protein is fully lysed. Collect the cells in the same treatment group into the same 1.5mL centrifuge tube, centrifuge at 4°C and 12000rpm for 10min, and take the supernatant for subsequent experiments.

[0202] (2) Protein quantification:

[0203] ①Prepare working solution: According to the BCA protein concentration assay kit, mix reagent A and reagent B in a volume ratio of 50:1 to prepare BCA working solution.

[0204] ② Prepare a 96-well plate, add 0, 1, 2, 4, 8, 12, 16, and 20 μL of 0.5 mg / mL protein standard into the corresponding wells, and fill each well to 20 μL with PBS solution.

[0205] ③ Take 2 μL of the protein sample to be tested and add it to the corresponding wells, and fill each well to 20 μL with PBS solution.

[0206] ④ Add 200 μL of BCA working solution to each sample well and standard well.

[0207] ⑤ Place the 96-well plate in a 37°C constant temperature incubator and incubate for 30 minutes to allow the BCA working solution to react with the protein.

[0208] ⑥ Use an ELISA reader to measure the absorbance (A562) of each well at a wavelength of 570 nm. Draw a standard curve based on the different concentrations of protein standards and their corresponding A562 values ​​to calculate the original concentration of the protein sample.

[0209] (3) Protein denaturation: Calculate the volume of ddH2O and 5×SDS loading buffer required for 20 μg of protein sample based on the protein concentration obtained in the protein quantification test, and boil the mixture in 95-100°C boiling water for 5-10 min.

[0210] (4) SDS-PAGE electrophoresis: Add the treated protein sample to the precast protein gel and run the electrophoresis at 140V for 45min. After the electrophoresis is completed, cut the gel band containing the target protein according to the position indicated by the protein marker.

[0211] (5) Transfer: In eBlot TM The membrane was transferred on L1 fast wet transfer instrument, and the transfer program used the instrument's default settings.

[0212] (6) Blocking: Prepare 5% skim milk powder in advance. After transfer, wash the membrane once with 1× TBST and soak the membrane in milk powder for blocking at room temperature for 1 to 2 h.

[0213] (7) Primary antibody incubation: Prepare the primary antibody with 1× TBST according to the ratio in the instruction manual. After blocking, wash with 1× TBST for 8 min, repeat 3 times, and incubate at 4°C overnight (12-16 h).

[0214] (8) Secondary antibody incubation: Prepare the secondary antibody with 1×TBST according to the ratio in the instruction manual. After the primary antibody incubation, wash with 1×TBST for 8 min, repeat 3 times; then soak the membrane in the secondary antibody and incubate at room temperature for 1 to 2 h.

[0215] (9) Exposure and result analysis: Prepare the luminescent solution according to the instructions of the BCL color development kit. After the secondary antibody incubation is completed, wash with 1×TBST for 8 minutes, repeat 3 times; use a chemiluminescence instrument to expose the protein sample, use ImageJ software to process the exposed image, and analyze the gray value of the target protein.

[0216] Result analysis:

[0217] 1. Using the pig ear sample DNA as a template, primers were designed for PCR amplification with reference to the porcine IRS1 promoter sequence published on NCBI. The band positions were observed by agarose gel electrophoresis. The porcine IRS1 gene promoter region sequence of 867 bp (-406 / +461) Figure 1 ).

[0218] 2. According to Table 4, at the g.128307611C>A site, C mutated to A, and three genotypes were found, CC, CA and AA, with two alleles, of which the mutant base A was the minor allele; at the g.128307308C>T site, C mutated to T, and two genotypes were found, CC and TT, with two alleles, of which the mutant base T was the minor allele.

[0219] 3. The analysis criteria of population genetic structure index are: polymorphism information content PIC>0.25, indicating that the site is moderately polymorphic, polymorphism information content PIC<0.25, indicating that the site is lowly polymorphic. P>0.05 indicates that the population genetic variation of the site is in Hardy-Weinberg equilibrium (Table 5).

[0220] 4. This statistical analysis was based on the genotype statistical results of the Douro Black pig population (142 pigs) with records of sexual maturity, and the sexual maturity age of each individual was associated with the genotype using the one-way analysis of variance method (Table 6). In the Douro Black pig population, the CA genotype individuals with g.128307611C>A locus had a significantly earlier sexual maturity age than the CC and AA genotype individuals; the TT genotype individuals with g.128307308C>T locus had a significantly earlier sexual maturity age than the CC genotype individuals.

[0221] 5. To explore the effect of the mutation site on the promoter activity of the IRS1 gene, the pGL3-basic vector containing the wild-type sequence and mutant sequence of the site was constructed by Jinkairui Bioengineering Co., Ltd. The wild-type and mutant vectors of the g.128307611C>A site were named WT-7611 and Mut-7611, respectively; the wild-type and mutant vectors of the g.128307308C>T site were named WT-7308 and Mut-7308, respectively.

[0222] The above recombinant plasmids were transfected into sow ovarian granulosa cells, Mut-7611 was used as a control with WT-7611, and Mut-7308 was used as a control with WT-7308. The IRS1 gene promoter activity was detected by dual fluorescence reporter enzyme assay. The results showed that there was no significant change in the IRS1 gene promoter activity in the Mut-7611 group; the IRS1 gene promoter activity in the Mut-7308 group was significantly higher than that in the WT-7308 group ( Figure 2 ).

[0223] The ovarian granulosa cells are derived from healthy commercial sows from Kongwangji Slaughterhouse in Huangpu District, Guangzhou (the same below).

[0224] 6. By transfecting 1000ng / mL of the overexpression vector into sow ovarian granulosa cells, qRT-PCR was used to detect the expression of IRS1. It was found that the transfection efficiency of pcDNA3.1-IRS1 was good and the difference was significant. In subsequent studies, 1000ng / mL was selected as the transfection concentration of pcDNA3.1-IRS1 ( Figure 3 ).

[0225] The above-mentioned overexpression vector was synthesized by Guangzhou Dongze Biotechnology Co., Ltd.

[0226] 7. Synthesize IRS1 interference fragment / control (IRS1-siRNA / siRNA-NC), screen and detect its interference efficiency. As shown in the attached figure, the small fragment of gene interference was transfected into the ovarian granulosa cells of sows. By qRT-PCR, the IRS1-siRNA small fragment had a good interference effect and was used for subsequent experiments ( Figure 4 ).

[0227] IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′;

[0228] The above-mentioned small interfering RNA fragments were synthesized by Guangzhou Dongze Biotechnology Co., Ltd.

[0229] 8. The above-mentioned pcDNA3.1-IRS1 or IRS1-siRNA was transfected into sow ovarian granulosa cells, respectively, and pcDNA3.1 or siRNA-NC was used as the control. The effects of IRS1 on the transcription level and ferroptosis of sow ovarian granulosa cells were detected by chain-specific transcriptome sequencing, total iron colorimetry, malondialdehyde (MDA) colorimetry, qRT-PCR, Western Blot and other experimental methods.

[0230] 9. There were 331 genes significantly up-regulated and 31 genes significantly down-regulated in the pcDNA3.1-IRS1 group. The differentially expressed genes were mainly involved in signaling pathways such as iron homeostasis, cell proliferation, and programmed cell death ( Figure 5 a, b).

[0231] 10. There were 240 genes significantly upregulated and 393 genes significantly downregulated in the IRS1-siRNA group. The differentially expressed genes were mainly involved in biological processes such as cell migration, epithelial cell differentiation, inorganic cation transmembrane transport and regulation of GTPase activity ( Figure 5 (c, d).

[0232] 11. The total iron level of cells in the pcDNA3.1-IRS1 group decreased, while the total iron level of cells in the IRS1-siRNA group increased. The changes in both groups did not reach a statistically significant level ( Figure 6 ).

[0233] 12. There was no significant difference in the MDA level between the pcDNA3.1-IRS1 group and the control group, but the MDA level in the IRS1-siRNA group was significantly higher than that in the control group ( Figure 7 ).

[0234] 13. Compared with the control group, overexpression of IRS1 can significantly increase the mRNA and protein expression levels of SLC7A11 gene, and significantly reduce the mRNA and protein expression levels of P53; while knocking down IRS1 can significantly reduce the mRNA and protein levels of SLC7A11 gene, significantly increase the mRNA expression level of P53, and the difference in protein expression level is not significant. In summary, IRS1 can inhibit cell ferroptosis ( Figure 8 ).

[0235] In summary, the g.128307308C>T mutation of IRS1 may change its binding with transcription factors, resulting in changes in promoter activity, affecting the transcription and translation of target genes, and then regulating the conduction of granulosa cell ferroptosis signaling pathway, affecting the sexual maturity of sows.

[0236] Table 4 Statistical results of SNP site typing in the promoter region of IRS1 gene

[0237]

[0238] Table 5 Analysis of population genetic structure indicators

[0239]

[0240] Table 6 Effects of IRS1 gene polymorphisms on the age of sexual maturity in Dorado Black pigs

[0241]

[0242] Note: The values ​​in the above table are expressed as arithmetic mean ± standard deviation. a and b in the table represent the intra-group differences.

[0243] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with sexual maturity in pigs, characterized by: Includes at least one of the following SNP molecular markers: (1) The SNP site corresponding to the C>A mutation at position g.128307611 on chromosome 15 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the C>T mutation at position g.128307308 on chromosome 15 of the pig reference genome Sscrofa11.

1.

2. The use of the SNP molecular marker associated with pig sexual maturity as described in claim 1, characterized in that: Include at least one of the following applications: A. Application in assessing the age of first estrus in pigs; B. Application in judging the onset of puberty in pigs; C. Application in breeding high-yield pigs.

3. The use of the SNP molecular marker associated with pig sexual maturity according to claim 2, characterized in that: In the application A, the genotype of the g.128307611 locus is detected, and the age of first puberty of individuals with genotype CA is shorter than that of CC and AA individuals; and / or, the genotype of the g.128307308 locus is detected, and the age of first puberty of individuals with genotype CC is shorter than that of TT individuals.

4. The use of the SNP molecular marker associated with pig sexual maturity according to claim 2, characterized in that: In the application B, the genotype of the g.128307611 locus is detected, and the individual pigs with the genotype CA experience the onset of puberty faster than the CC and AA individuals; and / or, the genotype of the g.128307308 locus is detected, and the individual pigs with the genotype CC experience the onset of puberty faster than the TT individuals.

5. The use of the SNP molecular marker associated with pig sexual maturity according to claim 2, characterized in that: In the application C, the genotype of the g.128307611 locus is detected, and individuals with a genotype of CA are selected as breeding pigs; and / or, the genotype of the g.128307308 locus is detected, and individuals with a genotype of CC are selected as breeding pigs.

6. The use of the SNP molecular marker associated with pig sexual maturity according to any one of claims 2 to 5, characterized in that: The pigs include any one of Duroc and its synthetic lines.

7. A primer for identifying SNP molecular markers associated with sexual maturity in pigs, characterized in that: include: F: 5′-ACGTCTCCGTAGCTCAAGTC-3′; R: 5′-TCCCCCTGCCCAAGGATATT-3′.

8. Application of IRS1 gene in regulating ferroptosis of pig ovarian granulosa cells, characterized in that: The application is any one or more of the following applications: I. Application of overexpression of IRS1 gene to inhibit ferroptosis of ovarian granulosa cells in vitro; II. Application of knocking down IRS1 gene to promote ferroptosis of ovarian granulosa cells in vitro.

9. The use of the IRS1 gene in regulating ferroptosis of porcine ovarian granulosa cells according to claim 8, characterized in that: The overexpression of IRS1 gene is achieved by the following method: connecting the nucleic acid molecule encoding pig IRS1 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing the IRS1 gene into sow ovarian granulosa cells cultured in vitro.

10. The use of the IRS1 gene in regulating ferroptosis of porcine ovarian granulosa cells according to claim 8, characterized in that: The knockdown of IRS1 gene is achieved by transfecting siRNA, and the siRNA sequence is as follows: IRS1-siRNA: 5′-GCCUAUGCCAGCAUCAGUUTT-3′.

Images