Identification and application of molecular markers related to porcine semen quality

Abstract

The present invention provides a molecular marker identification method related to pig semen quality and its application, relating to the field of biotechnology. This application involves applying a substance for detecting the SNP molecular marker rs3471304372 to the preparation of a product for predicting pig semen quality. The SNP molecular marker rs3471304372 is associated with pig sperm motility and sperm density, with the TT genotype being the dominant genotype. Breeding pigs with the TT genotype can effectively improve pig sperm motility and sperm density. Using this genetic marker to assess Large White pig semen quality and select boars is of great significance for pig genetic breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to molecular marker identification related to pig semen quality and application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Boar fertility is crucial to the pig industry. Boar semen quality is closely linked to conception rate and litter size in sows, and therefore plays a crucial role in pig genetic improvement. Compared to traditional breeding methods, molecular marker-assisted selection (MAM) has become an effective way to improve boar fertility due to its high efficiency and accuracy.

[0004] Marker-assisted selection (MAS) improves breeding efficiency by indirectly selecting for target traits through the detection of molecular markers that are tightly linked to the target trait. The core of this technology lies in leveraging the linkage relationship between molecular markers and the target trait gene. By selecting markers tightly linked to the target trait, individuals carrying superior alleles can be quickly identified at an early stage, without having to wait for the trait to manifest phenotype. Therefore, by screening for molecular markers tightly linked to boar semen quality traits, MAS allows for more precise selection of boars carrying markers for superior semen traits, thereby improving semen quality at the genetic level. This is crucial for increasing reproductive efficiency and accelerating the genetic improvement process.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of the present invention is to overcome the defects of the prior art and provide a SNP molecular marker related to pig semen quality and its application.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] In a first aspect, the invention provides the use of a substance for detecting the SNP molecular marker rs3471304372 in the preparation of a product for predicting pig semen quality, wherein the semen quality includes sperm motility and sperm density.

[0009] In a second aspect, a kit for predicting pig semen quality is provided, the kit comprising a substance for detecting the SNP molecular marker rs3471304372.

[0010] In a third aspect, provided is the use of the substance for detecting the SNP molecular marker rs3471304372 described in the first aspect, or the kit described in the second aspect in breeding pig screening or pig breeding.

[0011] In a fourth aspect, a method for predicting pig semen quality is provided, comprising predicting a sample whose genotype of the SNP molecular marker rs3471304372 is TT as having high sperm motility and high sperm density.

[0012] In a fifth aspect, a method for screening boars is provided, the screening method comprising obtaining the genotype of the SNP molecular marker rs3471304372, and screening boars with a genotype of TT. Boars with a genotype of TT of the SNP molecular marker rs3471304372 have high sperm motility and high sperm density.

[0013] In a sixth aspect, a pig breeding method is provided, comprising making the genotype of the SNP molecular marker rs3471304372 of the boar TT.

[0014] In a seventh aspect, provided is the use of a substance for gene editing the SNP molecular marker rs3471304372 in the preparation of a product for improving pig semen quality, wherein the semen quality includes sperm motility and sperm density.

[0015] In an eighth aspect, a kit for improving boar semen quality, including sperm motility and sperm density, is provided. The kit includes a reagent for gene editing the SNP molecular marker rs3471304372, wherein the gene editing reagent causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention discloses a method for identifying or assisting in the identification of boar semen quality traits. By detecting the genotype of the rs3471304372T>C site in the porcine CD163 gene, the present invention finds that the genotype of the site is CC, TT, or CT, and that the site is significantly associated with porcine sperm motility and sperm density. The TT genotype is the dominant genotype, and sperm motility and sperm density with the TT genotype are higher than those with the CT or CC genotypes. The SNP molecular marker rs3471304372 can assist in the identification of porcine semen quality traits. Based on this genetic marker, the semen quality of Large White pigs and the selection of boars are evaluated, which has important reference significance for pig genetic breeding. DETAILED DESCRIPTION

[0018] The technical solutions of the present invention will be described clearly and completely below in conjunction with the embodiments. Obviously, the embodiments described are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention. Unless otherwise specified, the professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any method or material similar or equivalent to the described contents may also be applied to the present invention.

[0019] Cluster of differentiation 163 (CD163) is a type I membrane protein primarily expressed in monocytes and macrophages and belongs to the B-type member of the cysteine-rich scavenger receptor superfamily. The porcine CD163 gene is located on chromosome 5. The genome comprises 17 exons and 16 introns, with a coding region of 3,333 base pairs (bp) encoding a total of 1,110 amino acids. The CD163 gene plays a crucial role in inflammatory responses, immune regulation, and the development and progression of diseases. Testicular macrophages (tMΦ) possess immunosuppressive functions, protecting spermatogenesis from autoimmune attack. Studies have shown that CD163-positive M2 macrophages are significantly negatively correlated with spermatogenesis, potentially affecting semen quality and suggesting that CD163 may be a key factor influencing male reproductive performance. The present study discovered that the SNP site rs3471304372 in the CD163 gene is associated with sperm motility and sperm density. The SNP molecular marker rs3471304372 is located at position 63326545 on chromosome 5 of the genome sequence information version number Sscrofa11.1 (accession number NM_213976.1). There is a T>C mutation. The site is position 41 of SEQ ID NO.6. The base Y of the site is C or T, and the genotype of the site is CC, TT or CT.

[0020] SEQ ID NO.6:

[0021] AATATATTTTAATAAGCTCTACCAAGTCATCCAGAAGCTA Y TAAAGAATTACTGGTCACTGACATAGTGTACCTGTTTTCA.

[0022] Experiments have shown that the genotype of the rs3471304372T>C locus in the porcine genome is associated with sperm motility and sperm density. Testing for the genotype of the rs3471304372T>C locus in the porcine genome can assist in identifying semen quality traits: Pigs with the TT genotype have higher sperm motility and sperm density than those with the CT or CC genotypes. In this article, high sperm motility refers to sperm motility that is higher than the average for the breed, and high sperm density refers to sperm density that is higher than the average for the breed.

[0023] Based on the above findings, the following technical solutions are provided.

[0024] In a first aspect, a method is provided for using a substance for detecting the SNP molecular marker rs3471304372 in preparing a product for predicting pig semen quality, wherein the semen quality includes sperm motility and sperm density.

[0025] In an optional embodiment, the substance for detecting SNP molecular markers includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for mass spectrometry detection, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substance for detecting SNP sites includes, but is not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent labels, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned substance for detecting SNP molecular markers based on general and more specific methods described in textbooks, references, process manuals, product descriptions, and standard documents, and the present invention is not limited thereto.

[0026] In an optional embodiment, the reagent for nucleic acid amplification includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2.

[0027] SEQ ID NO.1: AGCTCTACCAAGTCATCCAG;

[0028] SEQ ID NO. 2: GGCCTTGAAAACAGGTACAC.

[0029] In an optional embodiment, the forward primer and the reverse primer further independently contain one or more of a universal primer sequence, a tag sequence, a restriction site sequence and a protection base for sequencing.

[0030] In an optional embodiment, the substance for detecting SNP molecular markers includes a MassARRAY detection reagent, which is a nucleic acid mass spectrometry analysis method based on matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology. MassARRAY detection first obtains an amplification product containing a SNP site by nucleic acid amplification, and then performs a single base extension reaction using a single base extension primer designed next to the SNP site. The extension primer terminates after extending one base at the SNP site, so that the allele extension product of each SNP has only a difference in the terminal base. Mass spectrometry is then performed to obtain a spectrum, and a peak diagram is generated at the corresponding respective molecular weight positions according to the difference in the molecular weight of the extension product. The MassARRAY detection reagent includes a forward primer, a reverse primer, and an extension primer.

[0031] In an optional embodiment, the nucleotide sequence of the forward primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 1 and is at least 30 bp in length; the nucleotide sequence of the reverse primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 2 and is at least 30 bp in length. The length of the forward and reverse primers being at least 30 bp facilitates the distinction between the primers and the target product during mass spectrometry analysis, preventing interference with the detection results due to incomplete primer digestion.

[0032] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection includes the tag sequence and the sequence shown in SEQ ID NO.1 from the 5' end to the 3' end; the nucleotide sequence of the reverse primer includes the tag sequence and the sequence shown in SEQ ID NO.2 from the 5' end to the 3' end.

[0033] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0034] In an optional embodiment, the nucleotide sequence of the extension primer for MassARRAY detection is shown as SEQ ID NO.5.

[0035] In a second aspect, a kit for predicting pig semen quality is provided, the kit comprising a substance for detecting the SNP molecular marker rs3471304372 of the first aspect. The semen quality comprises sperm motility and sperm density.

[0036] In an optional embodiment, the kit includes one or more of reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for mass spectrometry detection, reagents for constructing a sequencing library, and reagents for sequencing. More specifically, the kit includes, but is not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent labels, buffers, dNTPs, salts, and the like. Depending on the specific detection method, those skilled in the art can select the reagent composition of the kit based on general and more specific methods described in textbooks, reference literature, process manuals, product specifications, and standard documents, and the present invention is not limited thereto.

[0037] In an optional embodiment, the kit includes a reagent for nucleic acid amplification, the reagent for nucleic acid amplification includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2.

[0038] In an optional embodiment, the forward primer and the reverse primer further independently contain one or more of a universal primer sequence, a tag sequence, a restriction site sequence and a protection base for sequencing.

[0039] In an optional embodiment, the kit includes a MassARRAY detection reagent. The MassARRAY detection reagent includes a forward primer, a reverse primer, and an extension primer.

[0040] In an optional embodiment, the nucleotide sequence of the forward primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 1 and is at least 30 bp in length; the nucleotide sequence of the reverse primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 2 and is at least 30 bp in length. The length of the forward and reverse primers being at least 30 bp facilitates the distinction between the primers and the target product during mass spectrometry analysis, preventing interference with the detection results due to incomplete primer digestion.

[0041] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection includes the tag sequence and the sequence shown in SEQ ID NO.1 from the 5' end to the 3' end; the nucleotide sequence of the reverse primer includes the tag sequence and the sequence shown in SEQ ID NO.2 from the 5' end to the 3' end.

[0042] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0043] In an optional embodiment, the nucleotide sequence of the extension primer for MassARRAY detection is shown as SEQ ID NO.5.

[0044] In a third aspect, provided is the use of the substance for detecting the SNP molecular marker rs3471304372 described in the first aspect, or the kit described in the second aspect in breeding pig screening or pig breeding.

[0045] In a fourth aspect, a method for predicting pig semen quality is provided, comprising predicting a sample having a genotype of TT of the SNP molecular marker rs3471304372 as a boar with high sperm motility and high sperm density.

[0046] In an optional embodiment, the prediction method can also be combined with other targets, such as other polymorphic molecular markers (such as SSR molecular markers, STR molecular markers or InDel molecular markers), or other prediction methods known in the art to assist in predicting pig sperm motility.

[0047] In a fifth aspect, a method for screening boars is provided, the screening method comprising obtaining the genotype of the SNP molecular marker rs3471304372, and screening boars with a genotype of TT. Boars with a genotype of TT of the SNP molecular marker rs3471304372 have high sperm motility and high sperm density.

[0048] In a sixth aspect, a pig breeding method is provided, comprising: providing a boar with a genotype of the SNP molecular marker rs3471304372 of TT. The specific means for obtaining a specific genotype in the boar can be achieved by conventional methods known in the art by those skilled in the art, and the present invention is not limited thereto.

[0049] In an alternative embodiment, offspring with a target genotype are obtained by obtaining parents with known genotypes.

[0050] In an optional embodiment, offspring with a target genotype are obtained by gene editing methods.

[0051] In a seventh aspect, provided is the use of a substance for gene editing the SNP molecular marker rs3471304372 in the preparation of a product for improving pig semen quality, wherein the semen quality includes sperm motility and sperm density.

[0052] In an optional embodiment, the substances used for gene editing of the SNP molecular marker rs3471304372 include but are not limited to reagents for the CRISPR-Cas gene editing system, specifically including but not limited to guide RNA or polynucleotides encoding guide RNA; donor DNA or polynucleotides encoding donor DNA; Cas enzymes or polynucleotides editing Cas nucleases, the Cas nucleases including but not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or proteins, polypeptides or complexes obtained by mutation of the above-mentioned Cas nucleases and / or fusion with other functional domains.

[0053] In an eighth aspect, a kit for improving boar semen quality, including sperm motility and sperm density, is provided. The kit includes a reagent for gene editing the SNP molecular marker rs3471304372, wherein the gene editing reagent causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

[0054] In an optional embodiment, the kit for improving boar sperm motility includes reagents for the CRISPR-Cas gene editing system, and the reagents for the CRISPR-Cas gene editing system include but are not limited to guide RNA or a polynucleotide encoding the guide RNA; donor DNA or a polynucleotide encoding the donor DNA; Cas enzyme or a polynucleotide that edits the Cas nuclease.

[0055] In an optional embodiment, the pig described in any of the above aspects includes a Large White pig.

[0056] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0057] Example: Discovery of SNP sites associated with pig semen quality and development of primers and methods for genotyping

[0058] 1. Screening of SNP sites of porcine CD163 gene

[0059] 1. Extraction of Genomic DNA from Sperm

[0060] Genomic DNA was extracted from semen of 253 Large White pigs using the following method:

[0061] (1) Preparation of sperm extract: Measure 0.5 mL Tris-HCl (1 M, pH = 8), 1 mL EDTA-Na (0.5 M, pH = 8), 1 mL NaCl (5 M), 2 mL SDS (10%), 400 μL DTT (1 M) and 5.5 mL ddH2O, mix well, sterilize under high pressure and store at room temperature.

[0062] (2) Take the semen out of the -20℃ refrigerator and let it stand to liquefy. After thorough mixing, take 1 mL of semen and place it in a centrifuge tube. Centrifuge at 12000 rpm for 2 min. Take 100 μL of the sample and precipitate it in a 1.5 mL centrifuge tube.

[0063] (3) Add 400 μL ddH2O, 100 μL sperm extract and 30 μL proteinase K and mix thoroughly.

[0064] (4) Digest in a constant temperature water bath at 60°C for 12 h until the sample becomes transparent.

[0065] (5) Add the same volume of Tris-saturated phenol, slowly invert to mix, centrifuge at 4°C, 10,000 rpm for 7 min, aspirate the supernatant (about 400 μL) into a new centrifuge tube, and repeat the process.

[0066] (6) Tris-saturated phenol, chloroform, and isoamyl alcohol were prepared in a ratio of 25:24:1 to form equal volumes and added to the reaction mixture, and the above extraction steps were repeated.

[0067] (7) Prepare equal volumes of chloroform and isoamyl alcohol at a ratio of 24:1 and add them to the reaction. Repeat the above extraction steps and transfer the supernatant (about 150 μL) to a 2 mL centrifuge tube.

[0068] (8) Add 1 / 10 volume of sodium acetate solution (3 M) and 2 volumes of anhydrous ethanol (pre-cooled at -20°C) to the supernatant. Slowly invert the centrifuge tube to precipitate white clumps of DNA. Gently shake to mix and aggregate the DNA. Centrifuge at 4°C, 10,000 rpm for 2 min and discard the supernatant.

[0069] (9) Prepare 75% ethanol (pre-cooled to -20°C) and add it to the DNA precipitate for 10 min. Centrifuge at 4°C, 10,000 rpm for 2 min, discard the supernatant, repeat the wash twice, and briefly centrifuge again to remove the remaining liquid.

[0070] (10) Open the lid and let it dry naturally. When the white precipitate becomes transparent, add 50 μL ddH2O to dissolve it.

[0071] (11) DNA concentration and quality were determined using a micro-spectrophotometer and agarose gel electrophoresis.

[0072] 2. Design and Synthesis of Detection Primers

[0073] Detection primers were designed based on the pig genome sequence information version number Sscrofa11.1, and primer sets were designed for the 63326545bp site (rs3471304372), 63303274bp site (rs690846722), 63322944bp site (rs3473446970), 63323697bp site (rs1112082621), 63305780bp site (rs3476466349), and 63314277bp site (rs3473298743) of the Large White pig CD163 gene on chromosome 5. The nucleotide sequences of the PCR amplification primers are shown in Table 1 (F represents the forward primer, R represents the reverse primer, and U represents the extension primer).

[0074] Table 1 Primer sequences

[0075]

[0076] The above primers were synthesized by Beijing Compson Biotechnology Co., Ltd.

[0077] 3. Genotyping using Sequenom MassARRAY SNP technology

[0078] (1) The genomic DNA of semen from 253 Large White pigs to be tested was used as a template, and the forward primers and reverse primers corresponding to each of the above-mentioned sites were used to amplify the target fragments to obtain PCR amplification products. The PCR amplification system is shown in Table 2, and the amplification program is shown in Table 3.

[0079] Table 2 PCR amplification system

[0080] Components Volume (μL) Enzyme-free water 1.75 10×PCR Buffer 0.625 MgCl (25 mM) 0.325 dNTP Mix (25mM) 0.1 Forward primer (0.5 μM) 0.5 Reverse primer (0.5 μM) 0.5 HotStar Taq (5U / μL) 0.2 DNA template (10 ng / μL) 1 Total volume 5

[0081] Table 3 PCR amplification program

[0082]

[0083]

[0084] (2) The PCR products in the above (1) were treated and digested with alkaline phosphatase (SAP enzyme) (see Table 4 for the digestion system and Table 5 for the digestion reaction procedure) to obtain digestion products.

[0085] Table 4 Digestion system

[0086] Components Volume (μL) Enzyme-free water 1.53 10×SAP Buffer 0.17 SAP Enzyme (1.7U / μL) 0.3 PCR amplification products 5 Total volume 7

[0087] Table 5 Digestion reaction procedure

[0088] Temperature (℃) Time (m) Number of cycles 37 40 1 85 5 1

[0089] (3) Using the digestion product in (2) above as a template, single-base extension reactions were performed using the extension primers at each site (see Table 6 for the extension reaction system and Table 7 for the extension reaction procedure) to obtain extension products.

[0090] Table 6 Extension reaction system

[0091] Components Volume (μL) Enzyme-free water 0.619 10X iPLEX Buffer plus 0.2 iPLEX terminator 0.2 iPLEX enzyme 0.041 Extend primer Mix 0.94 digestion products 7 Total volume 9

[0092] Table 7 Extension reaction program

[0093]

[0094] (4) The extension product in the above (3) was diluted 3 times with enzyme-free water, and 6 mg of resin was added for desalting treatment. The sample was rotated on a rotary mixer for 15 minutes and centrifuged at 2000 rpm for 5 minutes. The desalted sample was spotted on the sample target using a mass spectrometer. After waiting for natural crystallization, it was placed on a mass spectrometer for matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) reaction. The mass spectrum peak was detected using Typer 4.0 software, and the genotype of the target site of each sample was determined based on the mass spectrum peak diagram.

[0095] The genotyping results of target loci at different individuals in 253 Large White pigs are shown in Tables 8 to 13. The results show that rs690846722 and rs3473446970 had no polymorphism in the 253 Large White pigs (only one genotype was detected) and could not be used for subsequent analysis and were therefore excluded. The genotyping results of rs3471304372, rs1112082621, rs3476466349 and rs3473298743 were good, with genotype detection rates >90%. Some samples were not successfully genotyped and are indicated by " / ".

[0096] Table 8 Statistical raw data of different genotypes at rs3471304372 site of CD163 gene in Large White pig

[0097]

[0098]

[0099] Table 9 Statistical raw data of different genotypes of the rs690846722 locus of the CD163 gene in Large White pigs

[0100]

[0101]

[0102]

[0103] Table 10 Statistical raw data of different genotypes of CD163 gene rs3473446970 locus in Large White pig

[0104]

[0105]

[0106] Table 11 Statistical raw data of different genotypes of the rs1112082621 locus of the CD163 gene in Large White pigs

[0107]

[0108]

[0109]

[0110] Table 12 Statistical raw data of different genotypes at rs3476466349 site of CD163 gene in Large White pig

[0111]

[0112]

[0113] Table 13 Statistical raw data of different genotypes of CD163 gene rs3473298743 locus in Large White pig

[0114]

[0115]

[0116]

[0117] 2. Detection of pig sperm motility and sperm density

[0118] Computer-assisted sperm analysis was used to detect sperm motility and sperm density, as follows: after the semen was taken out, it was placed in a constant temperature water bath at 37°C for liquefaction. After the semen was completely liquefied, it was thoroughly mixed. An appropriate amount of semen was taken and placed on a sperm quality detection counting plate preheated at 37°C. After keeping warm for 2 minutes, the sperm motility and sperm density were tested.

[0119] The results of sperm motility test of 253 Large White pigs are shown in Table 14, and the results of sperm density test are shown in Table 15.

[0120] Table 14 Large White Pig Sperm Motility Test Results

[0121]

[0122]

[0123]

[0124] Table 15 Detection results of sperm density in Large White pigs

[0125]

[0126]

[0127] III. Correlation analysis between SNP loci of porcine CD163 gene and porcine semen traits

[0128] Using Excel software, the distribution of genotypes of the above loci in the Large White pig population was statistically analyzed to calculate the genotype frequencies, allele frequencies, polymorphism information content (PIC), heterozygosity (HE), effective number of alleles at each locus, and the chi-square test was used to detect whether the locus was in Hardy-Weinberg equilibrium; HaploView software was used to detect the minor allele frequency (MAF) of each locus, and the results are shown in Tables 16-19.

[0129] The CT genotype had the largest proportion at the rs3471304372 locus in the Large White pig population, the CC genotype had the largest proportion at the rs1112082621 locus, the TT genotype had the largest proportion at the rs3476466349 locus, and the CT genotype had the largest proportion at the rs3473298743 locus. All 4 loci were moderately polymorphic (0.25 < PIC < 0.5) in the Large White pig population; the chi-square test showed that all 4 loci were in Hardy-Weinberg equilibrium (P > 0.05) in the Large White pig population.

[0130] Table 16 Population genetics results of the rs3471304372 locus of the CD163 gene in the Large White pig population

[0131]

[0132]

[0133] Table 17 Population genetics results of the rs1112082621 locus of the CD163 gene in the Large White pig population

[0134]

[0135] Table 18 Population genetics results of the rs3476466349 locus of the CD163 gene in the Large White pig population

[0136]

[0137] Table 19 Population genetic results of rs3473298743 site of CD163 gene in Large White pig population

[0138]

[0139] Note: In Tables 16 to 19, PIC is the polymorphism information content, HE is the heterozygosity, NE is the effective number of alleles, MAF is the minimum allele frequency, P value is the chi-square value, and the numbers in brackets are the number of samples corresponding to the genotype.

[0140] Using JMP Pro 18 software, we analyzed the associations between the genotypes at these four loci and sperm motility and sperm density. The results, shown in Table 20, indicate that the rs3471304372 locus is significantly associated with sperm motility and sperm density in Large White boars. The TT genotype is the dominant genotype, with higher sperm motility and sperm density than the CT genotype and significantly higher than the CC genotype. In practical breeding, selecting pigs with the TT genotype for breeding results in better semen quality.

[0141] Table 20 Association analysis between different genotypes of CD163 gene SNP sites and sperm motility and sperm density in Large White pigs

[0142]

[0143] Note: Different letters in the upper right corner of the same column indicate significant differences (P<0.05)

[0144] The SNP site at position 63326545 on chromosome 5 (accession number NM_213976.1) of the pig genome sequence information version number Sscrofa11.1 was named rs3471304372T>C. The site is position 41 of SEQ ID NO.6. The base Y at the site is C or T, and the genotype of the site is CC, TT or CT.

[0145] In summary, the genotype of the rs3471304372T>C site in the pig genome is related to pig sperm motility and sperm density. By detecting the genotype of the rs3471304372T>C site in the pig genome, it can assist in identifying pig semen quality traits: the semen quality of pigs with TT genotype is higher than that of pigs with CT or CC genotype.

[0146] Unless otherwise specified, the materials and reagents used in the above examples can be obtained from commercial sources.

[0147] The main reagents used in the above examples are as follows:

[0148] PCR Enzyme (Roche, 05066506001);

[0149] PCR Accessory Set (Sequenom, 11327);

[0150] SpectroCHIP Resin Kit (Sequenom, 10117-2);

[0151] IPLEX Gold Reagent Kit (Sequenom, 10136);

[0152] enzyme-free water (Tiangen, RT121-02);

[0153] The main instruments used in the above examples are as follows:

[0154] 384-well PCR machine (Applied Biosystems / BIO-GENER, Veriti384 / RePURE-A);

[0155] Vortex mixer (Qilin Bell, QL-901);

[0156] Centrifuge (eppendorf, 5810R);

[0157] Massarray mass spectrometer (Agena, 260000);

[0158] Massarray mass spectrometer (Agena, RS1000);

[0159] Rotary mixer (Jiangsu Haimen Qilin Bell Instrument Manufacturing Co., Ltd., WA-986);

[0160] All reagents and instruments were purchased from Beijing Compass Biotechnology Co., Ltd.

[0161] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance for detecting the SNP molecular marker rs3471304372 in the preparation of a product for predicting pig semen quality, wherein the semen quality includes sperm motility and sperm density; The substance for detecting SNP molecular markers includes a forward primer and a reverse primer for nucleic acid amplification.

2. The use according to claim 1, characterized in that The nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The substances for detecting SNP molecular markers include forward primers, reverse primers and extension primers for MassARRAY detection.

4. The use according to claim 3, characterized in that The nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the length of the forward primer is at least 30 bp; the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2, and the length of the reverse primer is at least 30 bp.

5. The use according to claim 4, characterized in that The nucleotide sequence of the forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

6. The use according to claim 3, characterized in that The nucleotide sequence of the extension primer is shown in SEQ ID NO.

5.

7. Use of the substance for detecting the SNP molecular marker rs3471304372 according to any one of claims 1 to 6 in sow screening or pig breeding, wherein the substance for detecting the SNP molecular marker comprises a forward primer and a reverse primer for nucleic acid amplification.

8. The use according to claim 7, characterized in that The pigs include Large White pigs.

9. A method for predicting pig semen quality, characterized in that: This includes predicting samples with the genotype TT of the SNP molecular marker rs3471304372 as boars with high sperm motility and high sperm density.

10. A method for screening boars, characterized in that: The method includes obtaining the genotype of the SNP molecular marker rs3471304372 and screening boars with a genotype of TT. Boars with a genotype of TT of the SNP molecular marker rs3471304372 have high sperm motility and high sperm density.

11. A pig breeding method, characterized in that: This includes making the genotype of the boar's SNP molecular marker rs3471304372 TT.

12. Use of a substance for gene editing the SNP molecular marker rs3471304372 in the preparation of a product for improving pig semen quality, wherein the semen quality includes sperm motility and sperm density, and the substance for gene editing the SNP molecular marker rs3471304372 causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

13. A kit for improving the quality of boar semen, characterized in that: The invention comprises a reagent for performing gene editing on the SNP molecular marker rs3471304372, wherein the gene editing reagent causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

Images