SNP genetic markers associated with semen quality traits in pigs and application thereof

By identifying and constructing incompletely linked haplotype combinations in the ANXA5 gene promoter region, the problem of low heritability of boar semen quality traits was solved, enabling efficient boar semen quality screening and improving the economic benefits of pig farming.

CN119979726BActive Publication Date: 2025-11-25HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510378872.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-11-25
Estimated Expiration
2045-03-28

AI Technical Summary

Technical Problem

In existing technologies, the heritability of boar semen quality traits is low, conventional breeding methods are progressing slowly, and there is a lack of effective molecular marker-assisted selection methods.

Method used

Through population trait association analysis, three SNP sites located in the promoter region of the ANXA5 gene were identified. Specific primer pairs were designed for PCR amplification and sequencing to construct incompletely linked haplotype combinations and screen boars with high semen quality.

Benefits of technology

This method enables effective screening of boar semen quality traits, improves the economic benefits of pig farming, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979726B_ABST
    Figure CN119979726B_ABST
Patent Text Reader

Abstract

The application discloses a SNP genetic marker related to a pig semen quality trait and an application thereof, the SNP genetic marker is located in a promoter region of a pig ANXA5 gene, and a nucleotide sequence of the genetic marker is shown in Table SEQ ID NO.1; there are three SNP sites on the sequence respectively, and the three SNP sites are as follows: a base Y at 169bp of the sequence is C or T, a base M at 171bp is C or A, and a base K at 740bp is G or T.Through correlation analysis, the three SNP sites located in the promoter region of the ANXA5 gene are all related to boar sperm motility, and are in a linkage disequilibrium state, further haplotype analysis divides the three SNP sites into three haplotypes, and significant differences are found in the boar sperm motility trait after correlation analysis.The haplotypes can screen boars with high semen quality traits, and improve economic benefits of pig breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of porcine genetic marker screening and application technology, specifically to a SNP genetic marker associated with porcine semen quality traits and its application. Background Technology

[0002] In modern pig production, the widespread use of artificial insemination makes boar semen quality crucial, as it directly affects sow litter size and consequently, the economic benefits of pig farming. Boar semen quality includes semen volume, sperm density, sperm motility, and sperm abnormality rate. Heritability of boar semen quality traits is low, and conventional breeding methods have been slow to advance. However, the application of molecular marker-assisted breeding can largely solve this problem.

[0003] The AnnexinA5 (ANXA5) gene belongs to the AnnexinA family, which consists of structure-associated proteins that bind to phospholipids in a calcium-dependent manner. ANXA5 has been shown to be widely expressed in the reproductive systems of humans and rodents, including the testes (Li et al., 2011), epididymis (Guyonnet et al., 2011), sperm (Munuce et al., 2019), testicular interstitial cells, and Sertoli cells (Giambanco et al., 1991). The mutation rate in the ANXA5 promoter region is increased in patients with oligospermia in humans, with a higher prevalence of haplotype M2 (Lavorato et al., 2019). ANXA5 has also been shown to be significantly associated with sperm concentration, motility, and morphology in rabbits (Arruda-Alencar et al., 2012). Researchers identified porcine ANXA5 as a candidate gene influencing reproductive traits in Yorkshire boars through GWAS analysis. The above studies all indicate that the ANXA5 gene plays an important role in reproduction, especially in the quality traits of boar semen.

[0004] Currently, there are no reported molecular markers that have been identified regarding the impact of the ANXA5 gene on semen quality. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a SNP genetic marker associated with boar semen quality traits and its application. This invention identifies the correlation between SNP molecular markers and boar semen quality traits through population trait association analysis. The SNP molecular marker is located in the promoter region of the ANXA5 gene and has three SNP sites, verifying the polymorphism of the ANXA5 gene. This invention provides a new genetic marker, genotyping, and selection method for marker-assisted selection in pigs, laying the foundation for molecular improvement of semen quality.

[0006] To achieve the above objectives, the technical solution designed by the present invention is as follows:

[0007] This invention provides a SNP genetic marker associated with porcine semen quality traits. The SNP genetic marker is located in the promoter region of the porcine ANXA5 gene, and the nucleotide sequence of the genetic marker is shown in Table SEQ ID NO.1. The sequence contains three SNP sites, respectively...

[0008] In the above sequence, the base Y at position 169bp is C or T, the base M at position 171bp is C or A, and the base K at position 740bp is G or T.

[0009] AGAAACTGACCCAAGGCAGAAGTTTTGAAATTTCCTAAGTAAGCTACCA

[0010] AAGAGCTATATATATTTAAGAGGCCATGTAGAAACCACTATTGACTTTTTT

[0011] TTAACTTAAAAATAAACTTAAGAAATGGCTCTCAAAGCTTCAAGCTTCCT

[0012] CTATACAAGGGTCAAAGAYGMGCTGTCCTTTACCTCAGTGACAGTCTCTT

[0013] AAAGACATCCATGCACCTCTAAGTGTGAGTACAAGGTGAGGCCCCGATC

[0014] CCCAGAGGTCACGGAGGGGAGTGAGGCCCCAAGCACCCGAAACCTAGA

[0015] GTCCTGATTAGCTCCCCCCGCTGCGCAAAGGCCAGGCGGTCACCCGGGA

[0016] CGGCGCGGAAGCGTGTCCCTACTGAGTTCCAAAGTGGCCACGACCCGG

[0017] CCCCACCCCAGCTGCCGGGACGCAGACTGGCCGCTCCCCACGCAGGGCG

[0018] CAGTGAGGCCACGGCCGGGCGGGGCAGGGCGGGGCCCGCCGGGACGGG

[0019] GCGGGGTCGGTGGTGTTTCCGTTGCTTGGAGCCGACAGAAAGTAGCTGC

[0020] TTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCCGCGCGCCGCCGCCC

[0021] CGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGGTGAGTGAGCGCT

[0022] CGCCTAGCCCGCAGAGGGGAGCGGGAACGCTGGGTTAGAGCGGATACT

[0023] CTGCTGAGAGCTCCTTCGGAGCTGCGGAGAGGGCGGGTCTGCAGCGGG

[0024] GCGCGGGGKCTCCGTGGGCCCTGCGGCAGGGAAGTCTGGCTAGCTGAA

[0025] CCAGCTGTCACTCTCTTCTCTTGCAGTCCTGCATCAGTCACCTTTTCCTG

[0026] ACCTGGGCAGTCGCTATGGCACAGGTAAGGCTGTGCGCCCTCGCGCAAC

[0027] GCTCGGATTTAGCAATTTTGTAAACTGCTCAGAGTTCTAGAGTTTGTTGG

[0028] AAAACCAGAAGAGTTTAGGAGTAAAACTCAGTCTGCCTTCCGAAAATCTT

[0029] TAATATTGTTTCCGCTTTGCATCCCCAACTCCTGTCCTTCTGCTTTCCGAGGAGTGT,

[0030] Furthermore, the genetic marker is incompletely linked (the first two SNPs are completely linked), and in the sequence, the dominant alleles at positions 169bp, 171bp, and 740bp are T, A, and T, respectively; the dominant genotypes are CT, CA, and GT, respectively.

[0031] The present invention also provides an application of the above-mentioned SNP genetic markers in marker-assisted selection of bovine semen quality traits.

[0032] This invention also provides a primer pair for amplifying the above-mentioned SNP genetic markers, wherein the primer pair is as follows:

[0033] Upstream primer: 5'-AGAAACTGACCCAAGGCAGAAGTT-3', as shown in SEQ ID NO.2;

[0034] Downstream primer: 5'-ACACTCCTCGGAAAGCAGAAGGAC-3', as shown in SEQ ID NO.3.

[0035] The present invention also provides a method for detecting SNPs associated with porcine semen quality traits, wherein the method uses the above-mentioned primer pairs for amplification and sequencing comparison to complete the detection.

[0036] This invention also provides a method for constructing haplotype combinations. The method uses the above-mentioned method to detect three SNP sites, and then constructs three haplotype combinations based on the feature of incomplete linkage, namely H1H1: TATTAT; H1H2: TATCCG; H2H2: CCGCCG. According to the association between haplotype combinations and boar semen quality traits, haplotype H1H2 has higher boar sperm motility.

[0037] The present invention also provides the application of the above-mentioned primer pair in identifying boars with high-quality semen.

[0038] The present invention also provides a kit for identifying boars with high-quality semen, the kit comprising the primer pairs described above.

[0039] Furthermore, the kit also includes a PCR mix.

[0040] This invention also provides a method for identifying boars with high-quality semen, comprising the following steps:

[0041] 1) Extract genomic DNA from the semen of the sample to be tested, for later use.

[0042] 2) Using the genomic DNA described above as a template, perform PCR amplification using the kit described in claim 6.

[0043] 3) Using single nucleotide polymorphism detection, the genotypes of the 169th, 171st, and 740th bases in the promoter region of the ANXA5 gene in an individual are identified and haplotypes are formed. Correlation analysis is performed with semen quality traits. When the individual haplotype is H1H2 (TATCCG), the sample is considered to have good sperm motility; or, when the individual haplotype is H1H1 or H2H2, the sample is considered to have low sperm motility.

[0044] The beneficial effects of this invention are:

[0045] In this invention, three SNP sites located in the promoter region of the ANXA5 gene were identified through association analysis. All three SNP sites were found to be associated with boar sperm motility and were in linkage disequilibrium. Further haplotype analysis classified them into three haplotypes, and association analysis revealed significant differences in boar sperm motility traits. These haplotypes can be used to screen boars with higher semen quality traits, thereby improving the economic benefits of pig farming. Attached Figure Description

[0046] Figure 1 This is the agarose gel electrophoresis pattern of the PCR products in Example 1.

[0047] Figure labeling: Agarose gel concentration is 1.2%; lane M is DNA Marker DL2000; lanes 1-8 are amplified fragments of the primers shown in SEQ ID NO:2 and SEQ ID NO:3 in different individuals of Duroc pigs, with a fragment size of 1034bp.

[0048] Figure 2 The sequencing maps, from top to bottom, are the sequencing map of the g.102387770T>C site in Example 1, the sequencing map of the g.102387772A>C site in Example 1 of this invention, and the sequencing map of the g.102388341T>G site in Example 1 of this invention.

[0049] Figure 3 This is a schematic diagram of the chain imbalance analysis in Example 3.

[0050] Among them, the g.102387770T>C(rs343104241) site and the g.102387772A>C(rs328765480) site are completely linked. Detailed Implementation

[0051] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0052] Example 1: Obtaining the porcine ANXA5 gene fragment and establishing a method for polymorphism detection.

[0053] 1. Extraction of porcine genomic DNA

[0054] The experimental pig breed used in this embodiment was Duroc pigs. Semen quality traits for each pig included semen volume, semen density, sperm motility, and sperm abnormality rate. Pig genomic DNA was extracted using an animal tissue genomic DNA extraction kit from Beijing Qingke Biotechnology Co., Ltd., and the concentration and purity of the extracted DNA were determined.

[0055] 2. Obtaining the SNP genetic marker fragment of the porcine ANXA5 gene

[0056] A pair of primers was designed based on the SNP genetic marker detection sequence (as shown in SEQ ID NO:1) in the promoter region of the porcine ANXA5 gene (accession number ENSSSCG00000009097) to amplify fragments at polymorphic sites. The primers are as follows:

[0057] Upstream primer: 5'-AGAAACTGACCCAAGGCAGAAGTT-3'

[0058] Downstream primer: 5'-ACACTCCTCGGAAAGCAGAAGGAC-3'

[0059] The target fragment, 1034 bp in length, was obtained by PCR amplification. The PCR reaction system was as follows: the total volume was 25 μl, including 1 μl template DNA, 0.5 μl each of forward and reverse primers, 12.5 μl PCR Mix, and finally 10.5 μl deionized water to a total volume of 25 μl. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; then 95℃ denaturation for 30 s, 63℃ annealing for 30 s, and 72℃ extension for 1 min, for a total of 35 cycles, with a final extension at 72℃ for 5 min. The PCR product was stored at 4℃. The PCR product was detected by 1.2% agarose gel electrophoresis, and the results are shown in the attached figure. Figure 1 As shown.

[0060] 3. Detection of molecular markers in amplified fragments using direct sequencing

[0061] The amplified PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for DNA sequencing. The sequencing results were compared and analyzed using the Benchling website to obtain the ANXA5 genotyping data of the above samples. Figure 2 ).

[0062] Example 2: Association analysis of porcine semen quality traits using genetic markers screened in this invention.

[0063] To determine whether the polymorphism in the promoter region of the porcine ANXA5 gene is associated with porcine semen quality, a one-marker ANOVA was performed using the GLM program in SAS statistical software (SAS Institute Inc, Version 9.4). Simultaneously, the REG program was used to calculate the additive and dominant effects of the gene, and significance tests were performed. The model used was as follows:

[0064] Y ij =μ+G i +F j +e ij

[0065] Y ij Here, μ represents the phenotypic value, and G represents the mean value. i Genotypic effects (including additive and dominant effects); F j For the comprehensive effect of pig farms; e ij This is due to the residual effect.

[0066] Association analysis between different genotypes and semen quality traits was conducted in Duroc pigs. The statistical analysis results are shown in Table 1.

[0067] Table 1. Statistical analysis of three SNPs in the promoter region of the porcine ANXA5 gene and semen quality traits in Duroc pigs.

[0068]

[0069] Note: The above values ​​are the least squares mean standard errors; lowercase letters indicate significant differences; μ: mean; SE: standard error.

[0070] As shown in Table 1, in Duroc pigs, the sperm motility of the CT genotype in g.102387770T>C was significantly higher than that of the TT genotype (P<0.05); the sperm motility of the CA genotype in g.102387772A>C was significantly higher than that of the AA genotype (P<0.05); and the sperm motility of the GT genotype in g.102388341T>G was significantly higher than that of the TT genotype (P<0.05).

[0071] Example 3: Linkage disequilibrium analysis and haplotype analysis of porcine semen quality traits using screened SNP genetic markers.

[0072] To determine the associations among three SNPs in the promoter region of the porcine ANXA5 gene, linkage disequilibrium analysis was performed using Haploview software. The results are attached. Figure 3As shown, g.102387770T>C (rs343104241) and g.102387772A>C (rs328765480) are completely linked. Two haplotypes were constructed using Haploview software: H1 (TAT), H2 (CCG), H3 (CCT), and H4 (TAG). Haplotypes H3 and H4 have frequencies below 1% and were therefore not considered. Combining haplotypes H1 and H2 yielded three haplotype combinations. Association analysis was performed between these three haplotype combinations and boar semen quality traits; the statistical results are shown in Table 2.

[0073] Table 2. Statistical analysis of haplotype combinations of the porcine ANXA5 gene promoter region and semen quality traits in Duroc pigs.

[0074]

[0075] Note: The above values ​​are the least squares mean standard errors; lowercase letters indicate significant differences; μ: mean; SE: standard error.

[0076] As shown in Table 2, the H1H2 (TATCCG) haplotype combination was significantly higher than the H2H2 (CCGCCG) haplotype combination in terms of sperm motility.

[0077] This invention identified SNP polymorphisms in the promoter region of the ANXA5 gene in Duroc pigs and analyzed their correlation with semen volume, sperm density, sperm motility, and sperm abnormality rate. In Duroc pigs, the g.102387770T>C, g.102387772A>C, and g.102388341T>G sites were significantly correlated with sperm motility. Among these, the CT genotype in g.102387770T>C, the CA genotype in g.102387772A>C, and the GT genotype in g.102388341T>G may be beneficial genotypes for improving sperm motility. Further haplotype analysis revealed that the H1H2 (TATCCG) haplotype exhibited higher boar sperm motility. Therefore, in practical boar breeding, boars with better semen quality traits can be obtained by screening for the H1H2 (TATCCG) haplotype in the ANXA5 promoter region. Thus, this invention can be used as an auxiliary selection tool to guide early boar screening, thereby reducing production costs and increasing economic benefits in pig farming.

[0078] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP genetic marker genotypes in Duroc pig sperm motility-assisted selection, characterized in that: The SNP genetic marker is located in the promoter region of the porcine ANXA5 gene, and the nucleotide sequence of the genetic marker is shown in SEQ ID NO.

1. The sequence has three SNP sites: the base Y at 169 bp is C or T, the base M at 171 bp is C or A, and the base K at 740 bp is G or T.

2. A method for identifying boars with high-quality semen, characterized in that: Includes the following steps: 1) Extract genomic DNA from the semen of the sample to be tested, for later use; 2) Using the above-mentioned genomic DNA as a template, PCR amplification was performed using a kit, which included primer pairs, and the primer pairs were as follows: Upstream primer: 5'-AGAAACTGACCCAAGGCAGAAGTT-3', Downstream primer: 5'-ACACTCCTCGGAAAGCAGAAGGAC-3'; 3) Using single nucleotide polymorphism detection, the genotypes of the 169th, 171st and 740th bases of the SNP genetic markers of individuals were identified and haplotype combinations were formed. Correlation analysis was performed with semen quality traits. The nucleotide sequence of the SNP genetic markers is shown in SEQ ID NO.

1. When the individual haplotype is H1H2, and the haplotype H1H2 is TATCCG, the sample to be tested is considered to have high-quality sperm motility.

Citation Information

Patent Citations

  • COL1A1 gene polymorphism as genetic marker of Duroc boar semen quality traits and application of COL1A1 gene polymorphism as genetic marker of Duroc boar semen quality traits

    CN118028482A

  • Methods for Improving Fertility and Selectivity For Desired Offspring Sex in Artificial Insemination

    US20110076667A1