Primer probe, kit and detection method for simultaneously detecting 16 food-borne pathogenic bacteria

Abstract

The invention discloses a kit for simultaneously detecting 16 food-borne pathogenic bacteria. Each group of probes is designed based on bacterial classification, virulence gene specificity or serotype marks of the pathogenic bacteria; a group A probe vibrio detection group is used for detecting vibrio cholerae universal type, vibrio cholerae O1 serotype, vibrio cholerae O139 serotype and vibrio parahaemolyticus; the B group of probe invasive enterobacteriaceae pathogen group is used for detecting escherichia coli O157: H7, shigella, salmonella and yersinia small intestine; the C group probe escherichia coli pathotype detection group is used for detecting enterotoxigenic escherichia coli ETEC, enteroinvasive escherichia coli EIEC, enteroaggregative adherent escherichia coli EAEC and pathogenic escherichia coli EPEC; and the D group of probes are used for detecting campylobacter jejuni, campylobacter colons, listeria monocytogenes and enterohemorrhagic escherichia coli EHEC in the campylobacter and toxin type pathogen group.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a primer probe, a kit and a detection method for simultaneously detecting 16 foodborne pathogens. Background Art

[0002] Food safety is an important guarantee for public health and social development, and foodborne pathogens are one of the main threats to food safety. Foodborne pathogens not only cause serious foodborne diseases, but may also cause large-scale food contamination incidents, posing great harm to public health and economic development. Common foodborne pathogens include Escherichia coli (such as O157:H7, ETEC, EPEC, etc.), Salmonella, Shigella, Vibrio cholerae, Vibrio parahaemolyticus, Listeria monocytogenes, Yersinia intestinalis, Campylobacter jejuni, etc. These pathogens are widely distributed and diverse in type. Traditional detection methods are difficult to meet the needs of modern food safety testing in terms of sensitivity, specificity and detection efficiency.

[0003] At present, the conventional detection methods of foodborne pathogens mainly include microbial culture method, immunological detection method and molecular biological detection method: Microbial culture method is a traditional method for detecting pathogens, which determines the presence of target bacteria by isolating, culturing and identifying bacteria. However, this method usually takes a long time (48 hours or even longer), has high requirements for experimental environment and operation, and is difficult to achieve high-throughput detection, which is inefficient. Immunological detection methods (such as enzyme-linked immunosorbent assay, ELISA) are based on antigen-antibody reaction and are easy to operate, but their sensitivity and specificity are easily affected by the quality of antibodies, and it is difficult to detect multiple pathogens at the same time. Molecular biological detection methods (such as PCR technology) have been widely used in the field of foodborne pathogen detection due to their advantages of high sensitivity, strong specificity and short detection time. However, traditional PCR detection methods can usually only detect one or a small amount of target bacteria at a time, and cannot meet the needs of detecting multiple bacteria at the same time.

[0004] With the rapid development of molecular biology technology, multiplex fluorescence PCR technology has gradually become an important means for rapid detection of foodborne pathogens. Multiplex fluorescence PCR technology can simultaneously amplify and detect multiple target genes in a single reaction system by designing specific primers and probes. It has the following advantages: it can detect multiple target bacteria simultaneously in one reaction, greatly improving the detection efficiency; it avoids the generation of false positives and false negatives by designing specific primers and probes; it monitors the PCR amplification process in real time through fluorescent signals, and the detection time is usually completed within 1-2 hours; multiplex fluorescence PCR technology can be applied to the detection of food samples, environmental samples and clinical samples.

[0005] Although multiplex fluorescent PCR technology has made some progress in the field of foodborne pathogen detection, the existing technology still has the following problems: Single detection target: The current technology is mostly used to detect a single or a small number of foodborne pathogens, which cannot meet the needs of rapid screening of multiple pathogens in actual food safety work. Complex primer and probe design: The cross-interference problem of primers and probes in multiplex detection has not been completely solved, affecting the sensitivity and accuracy of detection. Lack of systematic solutions: In the existing technology, the promotion and application of detection methods often require multiple kits, making it difficult to form a unified multi-target rapid detection system. Summary of the invention

[0006] The present application provides a primer probe, a kit and a detection method for simultaneously detecting 16 foodborne pathogens, which is used to solve the technical problems that the existing technology cannot meet the needs of rapid screening of multiple pathogens in actual food safety work, and cross-interference affects the sensitivity and accuracy of detection.

[0007] In view of the above problems, the present application provides a primer probe, a kit and a detection method for simultaneously detecting 16 foodborne pathogens.

[0008] In the first aspect of the present application, a primer probe for simultaneously detecting 16 foodborne pathogens is provided, including: a group A Vibrio detection group: detecting Vibrio cholerae universal type, Vibrio cholerae O1 serotype, Vibrio cholerae O139 serotype, Vibrio parahaemolyticus; a. a specific PCR primer pair for detecting Vibrio cholerae and a probe sequence labeled with a FAM fluorescent dye is:

[0009] -Forward primer: SEQ ID NO: 1 GGACGACTCATGGGGACTTG

[0010] - Reverse primer: SEQ ID NO: 2 TGGATTTGGCATCTGCACCT

[0011] - Probe: SEQ ID NO: 3 GCTTATGTGTGGTATGCCAAT;

[0012] b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting Vibrio cholerae O1 serotype are:

[0013] - Forward primer: SEQ ID NO:4 TTGCTGAGTTTGCTGCCAGT

[0014] - Reverse primer: SEQ ID NO: 5 GAGGTGGAAAGGGAAAGTGG

[0015] - Probe: SEQ ID NO: 6 AGGTACATAACGATACAGTACTT;

[0016] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Vibrio cholerae O139 serotype are:

[0017] - Forward primer: SEQ ID NO: 7 TCCAGTGTGGTGCGTTACTG

[0018] - Reverse primer: SEQ ID NO: 8 TGGTCTAACAGGGAACCCGC

[0019] - Probe: SEQ ID NO: 9 GTACAAGTGAGCGTAGAGGA;

[0020] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Vibrio parahaemolyticus are:

[0021] -Forward primer: SEQ ID NO: 10 TAGCTACCGCTTTGCTGACC

[0022] - Reverse primer: SEQ ID NO: 11 GCTCAAGACCTGTGTCTGCT

[0023] - Probe: SEQ ID NO: 12 GGCTACTCTCTATCTGCAAT;

[0024] Group B Invasive Enterobacteriaceae Pathogens Group: Detection of Escherichia coli O157:H7, Shigella, Salmonella, and Yersinia enterica; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting Escherichia coli O157:H7 are:

[0025] -Forward primer: SEQ ID NO: 13 CGTGGATATGTCAGGGGCTC

[0026] - Reverse primer: SEQ ID NO: 14 ACCGCCAGCACCATTATCAA

[0027] - Probe: SEQ ID NO: 15 GGCGGTGGAGATATCCTCCT;

[0028] b. The sequences of the specific PCR primer pair and the probe labeled with VIC fluorescent dye for detecting Shigella are:

[0029] - Forward primer: SEQ ID NO: 16 TACCGACGAAAACGGCAAGA

[0030] - Reverse primer: SEQ ID NO: 17 CCACCTGCCAGTCAACAGAT

[0031] - Probe: SEQ ID NO: 18 CGCCGAATACCTGGGTGGAC;

[0032] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Salmonella are:

[0033] - Forward primer: SEQ ID NO: 19 GCGGATGCTTCGCGTTTTAT

[0034] - Reverse primer: SEQ ID NO: 20 GCTAACGGATTGCGAAGCTG

[0035] - Probe: SEQ ID NO: 21 GCTAACGGATTGCGAAGCTG;

[0036] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Yersinia intestinalis are:

[0037] - Forward primer: SEQ ID NO: 22 TAACCCGTAACAGCGACACC

[0038] - Reverse primer: SEQ ID NO: 23 CGTTTGGCGGAAAAGACCAA

[0039] - Probe: SEQ ID NO: 24 GATTGCTCCGTCATTATTGTGGCAAC;

[0040] Group C Escherichia coli pathotype detection group: detection of enterotoxigenic E. coli ETEC, enteroinvasive E. coli EIEC, enteroaggregative adherent E. coli EAEC, and pathogenic E. coli EPEC; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting enterotoxigenic E. coli ETEC are:

[0041] - Forward primer: SEQ ID NO: 25 ATGCGAATTCGTTCTTCCCT

[0042] - Reverse primer: SEQ ID NO: 26 CCATGTTTTTCCTGCTGAGCTT

[0043] - Probe: SEQ ID NO: 27 ACAAAACAATGAAAATAAAGATGAA;

[0044] b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting enteroinvasive E. coli EIEC are:

[0045] -Forward primer: SEQ ID NO: 28 GGTTTGATGGACATTTCAAGCTG

[0046] - Reverse primer: SEQ ID NO: 29 TGGAAGAAAGAAAAATAATGGAGCC

[0047] - Probe: SEQ ID NO: 30 CTCCTGAACGGCGTTTTTTTTAGATT;

[0048] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting agglomerated adherent E. coli EAEC are:

[0049] - Forward primer: SEQ ID NO: 31 CGGCTTATGAAGCAAAAATGCAG

[0050] - Reverse primer: SEQ ID NO: 32 TCTCGAGCATCAACATCAGGT

[0051] - Probe: SEQ ID NO: 33 TATTGAAATGCTTAGTGAGAGGAACA;

[0052] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting pathogenic Escherichia coli EPEC are:

[0053] - Forward primer: SEQ ID NO: 34 CCGTGACCTATTAATACGGGGG

[0054] - Reverse primer: SEQ ID NO: 35 CGCAAGCACCATTGCAGATT

[0055] - Probe: SEQ ID NO:36 CATGAATAAGAAATACGAAAAAGGTC;

[0056] Group D Campylobacter and toxin-forming pathogens group: detection of Campylobacter jejuni, Campylobacter coli, Listeria monocytogenes, and enterohemorrhagic Escherichia coli EHEC; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting enterohemorrhagic Escherichia coli are:

[0057] -Forward primer: SEQ ID NO: 37 ATCACTCGTTAGTGCCCGTG

[0058] - Reverse primer: SEQ ID NO:38 ACCAGAAGAAGCATCCACCG

[0059] - Probe: SEQ ID NO: 39 GAAGTTGAATTTTTTACAACGCTTACA;

[0060] b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting Campylobacter jejuni are:

[0061] - Forward primer: SEQ ID NO:40 ATCCGCACCAAGCAAGATGT

[0062] - Reverse primer: SEQ ID NO:41 CAGAGCAAAAGCTCCGCAAT

[0063] - Probe: SEQ ID NO:42 AAAGCAGCTAGTTTAATCTCTGAACT;

[0064] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Listeria monocytogenes are:

[0065] - Forward primer: SEQ ID NO: 43 TCGATTAACGGGAAGCTCGG

[0066] - Reverse primer: SEQ ID NO: 44 AACAGCTGAGCTATGTGCGA

[0067] - Probe: SEQ ID NO: 45 CCTATGTGTATGGTAAAGAAACTCCT;

[0068] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Campylobacter coli are:

[0069] - Forward primer: SEQ ID NO: 46 CGGAGCGACTCAGTCATCAA

[0070] - Reverse primer: SEQ ID NO: 47 TAGTCAAAGAAGCAATGCCAGA

[0071] - Probe: SEQ ID NO: 48 TTGGTGTAACAAGATTTGAAACAGGA.

[0072] 1. The second aspect of the present application provides a kit for simultaneously detecting 16 foodborne pathogens, wherein each set of probes is designed based on the genus classification, virulence gene specificity or serotype marker of the pathogen:

[0073] Group A probe Vibrio detection group: detection of Vibrio cholerae universal type, Vibrio cholerae serotype O1, Vibrio cholerae serotype O139, Vibrio parahaemolyticus;

[0074] Group B probe invasive Enterobacteriaceae pathogen panel: detection of Escherichia coli O157:H7, Shigella, Salmonella, and Yersinia enterica;

[0075] Group C probe Escherichia coli pathotype detection group: detect enterotoxigenic E. coli ETEC, enteroinvasive E. coli EIEC, enteroaggregative adherent E. coli EAEC, and pathogenic E. coli EPEC;

[0076] Group D probe Campylobacter and toxin-type pathogen group: detects Campylobacter jejuni, Campylobacter coli, Listeria monocytogenes, and enterohemorrhagic Escherichia coli EHEC.

[0077] The third aspect of the present application provides a detection method for simultaneously detecting 16 foodborne pathogens, comprising: S1, extracting DNA of a sample to be tested, wherein the sample to be tested is a food sample, an environmental sample or a clinical sample;

[0078] S2, adding the DNA template into the primer-probe combination tubes of group AD respectively for multiplex fluorescence PCR amplification;

[0079] S3, analyzing the amplification curve through a multi-channel fluorescence signal acquisition system;

[0080] S4. Determine the presence of target pathogens based on the Ct value. When the Ct value is ≤35, it is considered positive. The detection linear range is not less than 10^1-10^6 CFU / mL. The PCR reaction procedure is: 97℃ pre-denaturation for 1min; 97℃ denaturation for 5s, 58℃ annealing / extension for 30s, for a total of 40 cycles. The amplification efficiency is not less than 90%, R 2 Value ≥ 0.99.

[0081] One or more technical solutions provided in this application have at least the following technical effects or advantages:

[0082] The embodiment of the present application can simultaneously detect the above four common diarrhea bacteria through primer probes, kits and detection methods for simultaneously detecting 16 foodborne pathogens, and uses four different fluorescent markers, FAM, VIC, ROX and CY5, to achieve rapid, sensitive and accurate detection of target pathogens in samples through a fully automatic real-time fluorescent PCR detection system. The present invention not only improves the multiplicity of detection, but also enhances the specificity and sensitivity of detection through optimized primer and probe design, meets the clinical demand for rapid detection of diarrhea pathogens, and is expected to reduce detection costs and increase the popularity of detection technology.

[0083] The present invention provides an innovative detection scheme based on multiplex fluorescence PCR technology, which can simultaneously detect 16 major foodborne pathogens, including Escherichia coli (O157:H7, ETEC, EIEC, EAEC, EPEC), Shigella, Vibrio cholerae (O1 serotype and O139 serotype), Vibrio parahaemolyticus, Salmonella, Listeria monocytogenes, Yersinia intestinalis, Campylobacter jejuni, enterohemorrhagic Escherichia coli and Campylobacter coli.

[0084] The present invention designs a set of efficient primer-probe combinations and develops a kit and a detection method, which can quickly detect 16 pathogens simultaneously through a multi-channel real-time fluorescence PCR detection system. The technical features of the invention include:

[0085] (1) Efficient primer and probe design: By optimizing primer and probe sequences, the cross-interference problem in multiplex fluorescence PCR is significantly reduced, and the sensitivity and specificity of detection are improved.

[0086] (2) Comprehensive testing content: It covers 16 major foodborne pathogens and can meet the needs of rapid screening of multiple target bacteria in food safety testing.

[0087] (3) Easy operation: The kit already contains the main components required for PCR amplification (primer probe combination, buffer, dNTPs, Taq DNA polymerase, etc.), and only a small amount of sample is required to complete the detection.

[0088] (4) Strong applicability: The present invention is applicable to the detection of various types of samples such as food samples, environmental samples and clinical samples, and can be widely used in food safety supervision, hospital diagnosis and environmental hygiene monitoring.

[0089] The above description is only an overview of the technical solution of the present application. In order to more clearly understand the technical means of the present application, it can be implemented in accordance with the contents of the specification. In order to make the above and other purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0091] Figure 1 A group sensitivity graph provided for this application;

[0092] Figure 2 Group B sensitivity graph provided for this application;

[0093] Figure 3 Group C sensitivity graph provided for this application;

[0094] Figure 4 This is the sensitivity diagram of Group D provided for this application. DETAILED DESCRIPTION

[0095] The present application provides a primer probe, a kit and a detection method for simultaneously detecting 16 foodborne pathogens, aiming to solve the technical problems that the existing technology cannot meet the demand for rapid screening of multiple pathogens in actual food safety work and cross-interference affects the sensitivity and accuracy of detection.

[0096] After introducing the basic principles of the present application, the technical solutions in the present application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all of the embodiments of the present application. It should be understood that the present application is not limited to the example embodiments described here. Based on the embodiments of the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application. It should also be noted that, for the convenience of description, only the parts related to the present application are shown in the accompanying drawings, rather than all of them.

[0097] Example 1: Primer probe design and specificity verification

[0098] 1.1 Materials and Instruments

[0099] Pathogen standard strains: 16 target bacteria including Vibrio cholerae O1 (ATCC 39315), Escherichia coli O157:H7 (ATCC 43895), Listeria monocytogenes (ATCC 19115); non-target control bacteria: 20 common intestinal commensal bacteria including Escherichia coli K12 (ATCC 47076), Lactobacillus casei ATCC 334.

[0100] Instrument: ABI QuantStudio 5 real-time fluorescence PCR instrument;

[0101] 1.2 Primer and probe synthesis

[0102] Primer probes (Shenggong Biosynthesis) were synthesized according to the sequences shown in the sequence table (SEQ ID NO: 1-48), the 5' end of the probe was labeled with FAM / VIC / ROX / CY5, and the 3' end was labeled with a BHQ1 quenching group.

[0103] 1.3 Primer probe design and synthesis:

[0104] Based on the target gene sequence in the NCBI database, the primer probe was designed using Primer Premier 6.0 software to meet the following conditions: Tm value: 58±2℃ (within-group difference ≤2℃); GC content: 40%-60%; the 5' end of the probe was labeled with a fluorescent group (FAM / VIC / ROX / CY5), and the 3' end was labeled with a BHQ1 quenching group. Synthesis: Synthesized by Sangon Biotech (Shanghai) Co., Ltd., HPLC purification (purity ≥98%).

[0105] 1.4 Experimental procedures

[0106] 1.4.1 DNA extraction: DNA of 16 target bacteria and 20 non-target bacteria (such as Escherichia coli K12 and Lactobacillus casei) was extracted; 1 mL of bacterial solution (concentration 10 8 CFU / mL), extract DNA according to the FastDNA Spin Kit instructions, and determine the concentration and purity by NanoDrop (A260 / A280=1.8-2.0)

[0107] 1.4.2 Specificity test

[0108] Reaction system (25 μL): 2×Probe Master Mix: 12.5 μL; Primer pair (0.1 μM): 1 μL each; Probe (0.05 μM): 0.5 μL; DNA template (10 CFU / mL): 2 μL; Sterile water: make up to 25 μL.

[0109] PCR program: 97°C pre-denaturation for 1 min; 97°C denaturation for 5 s → 58°C annealing / extension for 30 s, for a total of 40 cycles.

[0110] Detection settings: Target bacteria group: 16 target bacteria DNAs (10 CFU / mL) were added respectively; Non-target bacteria group: 20 symbiotic bacteria DNAs (106 CFU / mL) were added; Negative control: Sterile water was used instead of template.

[0111] Judgment criteria: Ct value ≤ 35 is positive, > 40 is negative, and 35 < Ct ≤ 40 requires retesting.

[0112] 1.5 Specificity verification results:

[0113]

[0114]

[0115] 1.6 Conclusion:

[0116] Target bacteria detection: At a concentration of 10 CFU / mL, the Ct values of all 16 pathogenic bacteria were ≤ 35 (range 27.9 - 31.4), and the test results were positive, indicating that the specificity met the design requirements;

[0117] Non-target bacteria detection: 20 common intestinal symbiotic bacteria (such as Escherichia coli K12, Lactobacillus) showed no amplification signal (Ct value > 40) at a high concentration of 106 CFU / mL, and the specificity was 100%;

[0118] Cross-interference: There was no cross-amplification of primers and probes within and between groups, and the fluorescence signal channels (FAM / VIC / ROX / CY5) were clearly separated (attached Figure 1-4 ).

[0119] Example 2: Optimization of PCR buffer and verification of amplification efficiency

[0120] 2.1 Buffer formulation screening design

[0121] Four groups of buffer formulations were set to compare the effects of different component concentrations on the amplification efficiency:

[0122] Group 1: 10 mM Tris-HCl (pH 8.3) + 0.5% PEG 20000 + 0.1 M betaine + 1 mM MgCl2;

[0123] Group 2 (preferred): 25 mM Tris-HCl (pH 8.8) + 1% PEG 20000 + 0.3 M betaine + 2 mM MgCl2;

[0124] Group 3: 50 mM Tris-HCl (pH 9.0) + 2% PEG 20000 + 0.5 M betaine + 3 mM MgCl2;

[0125] Group 4: 50 mM Tris-HCl (pH 9.0) + 1.5 mM MgCl2;

[0126] 2.2 Amplification efficiency test

[0127] Reaction system (25 μL): 2×Probe Master Mix (including optimized buffer): 12.5 μL; Primer pair (0.1 μM) and probe (0.05 μM): designed according to the AD group in claim 1; DNA template (10 1 -10 6 CFU / mL gradient dilution): 2 μL; Sterile water: make up to 25 μL.

[0128] PCR program: 97°C pre-denaturation for 1 min→40 cycles (97°C for 5 s, 58°C for 30 s).

[0129] All experiments were repeated 3 times, with 3 parallel samples in each group, and the data are expressed as mean ± standard deviation

[0130] 2.3 Amplification efficiency and interference suppression verification

[0131] Data processing: Amplification efficiency (E): calculated by the formula E=10^(-1 / slope)-1; Amplification efficiency difference: standard deviation (SD) of amplification efficiency of 16 pathogens; Primer dimer inhibition rate: analyzed by melting curve (95℃15s→60℃1min→95℃15s).

[0132] 2.4 Experimental results:

[0133]

[0134]

[0135] Conclusion: Group 2 (25mM Tris-HCl+1% PEG 20000+0.3M betaine+2mM MgCl2) has the highest amplification efficiency (98%) and the smallest efficiency difference (≤10%), and is the optimal formula.

[0136] Example 3: Instructions for use of the kit and detection method

[0137] 3.1 Materials and Kit Composition

[0138] 3.1.1 Kit components:

[0139] The kit comprises: a PCR buffer, dNTPs, Taq DNA polymerase, MgCl2, wherein the buffer comprises the following components: a) 10-50 mM Tris-HCl (pH 8.3-9.0), more preferably 25 mM Tris-HCl (pH 8.3-9.0); b) 0.5-2% w / v) polyethylene glycol 20000 (PEG 20000), more preferably 1% w / v polyethylene glycol 20000 (PEG 20000); c) 0.1-0.5 M betaine, more preferably 0.3 M betaine; d) 1-3 mM MgCl2, more preferably 1-3 mM MgCl2; wherein the PEG20000 is used to inhibit the formation of primer dimers, betaine is used to improve the amplification efficiency of GC-rich templates, and the buffer can make the amplification efficiency difference of 16 pathogens ≤15%; the PCR amplification system contains the following optimized components: a) 0.05-0.2μM primer pair, more preferably 0.1μM primer pair; b) 0.02-0.1μM probe, more preferably 0.05μM probe; c) 0.5-1U / μL hot start Taq DNA polymerase, more preferably 0.5-1U / μL hot start Taq DNA polymerase; d) 0.5-1.5mM dNTPs, more preferably 0.5-1.5mM dNTPs; wherein the concentration ratio of primers to probes is controlled at 1:0.4-1:0.6 to balance the amplification efficiency and fluorescence signal interference

[0140] Preferably, the primer probe tubes of group AD are in the form of lyophilized powder, each tube containing 0.1 μM primer pair and 0.05 μM probe (SEQ ID NO: 1-48 in the sequence list);

[0141] 5× PCR buffer: 25 mM Tris-HCl (pH 8.8), 1% PEG 20000, 0.3 M betaine, 2 mM MgCl2;

[0142] Hot start Taq enzyme premix (containing dNTPs): 0.5U / μL (Takara Premix Taq TM );

[0143] Control: Positive control (mixture of 16 pathogenic bacteria recombinant plasmids, 10 3 CFU / mL); negative control (sterile water containing 1% BSA); standard curve plasmid (10 1 -10 6 CFU / mL).

[0144] 3.1.2 Sample Type:

[0145] Food samples: fresh pork (containing 5% pig blood), salted shrimp (salinity 6%), yogurt (pH 4.8);

[0146] Clinical samples: stool samples from patients with diarrhea (with ethical approval);

[0147] Environmental sample: effluent from sewage treatment plant.

[0148] 3.2 Detection steps

[0149] 3.2.1 Sample preparation: Extract DNA from the samples to be tested (such as environmental samples, food samples or clinical samples) to ensure that the quality and purity of the extracted DNA are suitable for PCR amplification.

[0150] 3.2.2 Preparation of reaction system (25 μL / reaction): 5× PCR buffer: 5 μL; Hot start Taq enzyme premix: 5 μL; AD group primer probe tube: 1 μL each (after reconstitution); DNA template: 2 μL; Sterile water: make up to 25 μL.

[0151] 3.2.2 Amplification procedure: pre-denaturation at 97°C for 1 min; 40 cycles (97°C for 5 s → 58°C for 30 s); fluorescence signal acquisition: read FAM / VIC / ROX / CY5 channel signals at 58°C.

[0152] 3.2.3 Result interpretation:

[0153] Positive judgment: Ct value ≤ 35 and the amplification curve shows a typical S-shape;

[0154] Negative determination: Ct value>40 or no amplification curve;

[0155] Quantitative analysis: Calculate the pathogen concentration based on the Ct value of the standard curve plasmid.

[0156] 3.3 Experimental Results

[0157]

[0158] Conclusion: The test results of all sample types showed that the concentration of plasmids of all 16 pathogens was within 10 2 At the CFU / mL concentration, the Ct values ​​were all ≤35, indicating that the design requirements were met.

[0159] Example 4: Sensitivity and specificity testing

[0160] 4.1 Strains and samples:

[0161] Target bacteria: 16 standard strains of foodborne pathogens (such as Vibrio cholerae O1 ATCC 39315, Escherichia coli O157:H7ATCC 43895, etc.);

[0162] Non-target bacteria: 20 intestinal commensal bacteria (such as Escherichia coli K12 ATCC 47076, Lactobacillus casei ATCC 334, etc.);

[0163] 4.2 Sensitivity test

[0164] Preparation of bacterial solution: dilute 16 target bacteria to 10 0 -108CFU / mL gradient concentration;

[0165] DNA extraction: Take 1 mL of bacterial solution of each concentration and extract DNA according to the instructions of FastDNA Spin Kit;

[0166] PCR amplification: amplification according to the steps of claim 2 (the reaction system contains the optimized buffer of claim 3);

[0167] Detection limit determination: The lowest concentration that can repeatedly detect positive results (Ct value ≤ 35) is the detection limit.

[0168] 4.3 Specificity test

[0169] High concentration of non-target bacteria interference: 20 symbiotic bacteria were diluted to 106 CFU / mL, and DNA was extracted and added to the PCR reaction system;

[0170] Cross-reaction detection: Amplify according to the steps of claim 2 to determine whether non-specific signals appear (Ct value ≤ 35)

[0171] 4.4 Experimental Results

[0172] 4.4.1 Sensitivity

[0173]

[0174]

[0175]

[0176] Conclusion: The laboratory sensitivity of all 16 target bacteria was 10 CFU / mL. The Ct values ​​of all 16 pathogens at a concentration of 10 CFU / mL were ≤35 (range 27.9-31.4), indicating that the sensitivity met the design requirements; (Appendix Figure 1-4 )

[0177] 4.4.2 Specificity test (20 non-target intestinal commensal bacteria)

[0178]

[0179]

[0180] Conclusion: There was no cross-reaction with 20 commensal bacteria and the specificity was 100%.

[0181] Example 5: Performance comparison with prior art

[0182] 5.1 Comparison object: the present invention and the purchased kit for detecting 12 pathogens (not covering Vibrio cholerae O139, Campylobacter coli, etc.)

[0183] 5.2 Experimental procedures

[0184] Same sample processing: extract DNA according to the steps of claim 2, and use the present invention and the comparative technology for detection respectively;

[0185] Sensitivity comparison: Test 10 1 -10 3 LOD of CFU / mL spiked samples;

[0186] Cross-interference rate analysis: DNA of 20 symbiotic bacteria (10 6 CFU / mL), and the false positive rate was calculated;

[0187] Cost accounting: Compare reagent consumption and equipment usage costs.

[0188] The experiment was repeated three times, with three parallel samples each time. The data were expressed as mean ± standard deviation, and the t test was performed using SPSS 26.0 (p < 0.01).

[0189] 5.3 Experimental Results

[0190] 5.3.1 Comparison of core performance indicators

[0191] index The present invention Comparison Kits Detection of pathogenic bacteria 16 types 12 types Sensitivity of blood samples <![CDATA[10 2 CFU / mL]]> <![CDATA[10 3 CFU / mL]]> Cross-interference rate <0.1％ 8.5％ Detection time 2 hours 3 hours Cost per test 40 Yuan 68 yuan

[0192] 5.3.2 Cross-interference comparison

[0193] Non-target bacteria The present invention (false positive rate) Comparison kit (false positive rate) Escherichia coli K12 0％ 5.2％ Lactobacilli 0％ 7.8％ Bifidobacterium 0％ 6.3％

[0194] 5.4 Conclusion

[0195] Improved detection throughput: The present invention covers 33% more pathogenic bacteria than the comparative kit (16 vs 12 species);

[0196] Sensitivity advantage: Sensitivity is increased by 10 times in blood samples (10 2 vs 10 3 CFU / mL);

[0197] Anti-interference ability: the cross-interference rate is reduced from 8.5% to <0.1%;

[0198] Cost-effectiveness: The cost of a single test is reduced by 41% (40 vs 68 yuan).

[0199] Through these specific embodiments, it can be clearly seen that the quadruple fluorescent PCR detection of the present invention, a primer probe, a kit and a detection method for simultaneously detecting 16 foodborne pathogens not only simplifies the detection process of multiple pathogens, but also performs well in sensitivity and specificity, and is suitable for rapid diagnosis needs in clinical and public health.

[0200] The probe probe sets and sequences mentioned in this application are as follows:

[0201] Group A Vibrio detection group: detection of Vibrio cholerae universal type, Vibrio cholerae serotype O1, Vibrio cholerae serotype O139, Vibrio parahaemolyticus; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting Vibrio cholerae are:

[0202] -Forward primer: SEQ ID NO: 1 GGACGACTCATGGGGACTTG

[0203] - Reverse primer: SEQ ID NO: 2 TGGATTTGGCATCTGCACCT

[0204] - Probe: SEQ ID NO: 3 GCTTATGTGTGGTATGCCAAT;

[0205] b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting Vibrio cholerae O1 serotype are:

[0206] - Forward primer: SEQ ID NO:4 TTGCTGAGTTTGCTGCCAGT

[0207] - Reverse primer: SEQ ID NO: 5 GAGGTGGAAAGGGAAAGTGG

[0208] - Probe: SEQ ID NO: 6 AGGTACATAACGATACAGTACTT;

[0209] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Vibrio cholerae O139 serotype are:

[0210] - Forward primer: SEQ ID NO: 7 TCCAGTGTGGTGCGTTACTG

[0211] - Reverse primer: SEQ ID NO: 8 TGGTCTAACAGGGAACCCGC

[0212] - Probe: SEQ ID NO: 9 GTACAAGTGAGCGTAGAGGA;

[0213] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Vibrio parahaemolyticus are:

[0214] -Forward primer: SEQ ID NO: 10 TAGCTACCGCTTTGCTGACC

[0215] - Reverse primer: SEQ ID NO: 11 GCTCAAGACCTGTGTCTGCT

[0216] - Probe: SEQ ID NO: 12 GGCTACTCTCTATCTGCAAT;

[0217] Group B Invasive Enterobacteriaceae Pathogens Group: Detection of Escherichia coli O157:H7, Shigella, Salmonella, and Yersinia enterica; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting Escherichia coli O157:H7 are:

[0218] -Forward primer: SEQ ID NO: 13 CGTGGATATGTCAGGGGCTC

[0219] - Reverse primer: SEQ ID NO: 14 ACCGCCAGCACCATTATCAA

[0220] - Probe: SEQ ID NO: 15GGCGGTGGAGATATCCTCCT;

[0221] b. The sequences of the specific PCR primer pair and the probe labeled with VIC fluorescent dye for detecting Shigella are:

[0222] - Forward primer: SEQ ID NO: 16 TACCGACGAAAACGGCAAGA

[0223] - Reverse primer: SEQ ID NO: 17 CCACCTGCCAGTCAACAGAT

[0224] - Probe: SEQ ID NO: 18 CGCCGAATACCTGGGTGGAC;

[0225] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Salmonella are:

[0226] - Forward primer: SEQ ID NO: 19 GCGGATGCTTCGCGTTTTAT

[0227] - Reverse primer: SEQ ID NO: 20 GCTAACGGATTGCGAAGCTG

[0228] - Probe: SEQ ID NO: 21 GCTAACGGATTGCGAAGCTG;

[0229] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Yersinia intestinalis are:

[0230] - Forward primer: SEQ ID NO: 22 TAACCCGTAACAGCGACACC

[0231] - Reverse primer: SEQ ID NO: 23 CGTTTGGCGGAAAAGACCAA

[0232] - Probe: SEQ ID NO: 24 GATTGCTCCGTCATTATTGTGGCAAC;

[0233] Group C Escherichia coli pathotype detection group: detection of enterotoxigenic E. coli ETEC, enteroinvasive E. coli EIEC, enteroaggregative adherent E. coli EAEC, and pathogenic E. coli EPEC; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting enterotoxigenic E. coli ETEC are:

[0234] - Forward primer: SEQ ID NO: 25ATGCGAATTCGTTCTTCCCT

[0235] - Reverse primer: SEQ ID NO: 26CCATGTTTTTCCTGCTGAGCTT

[0236] - Probe: SEQ ID NO: 27ACAAAACAATGAAAATAAAGATGAA;

[0237] b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting enteroinvasive E. coli EIEC are:

[0238] -Forward primer: SEQ ID NO: 28GGTTTGATGGACATTTCAAGCTG

[0239] - Reverse primer: SEQ ID NO: 29TGGAAGAAAGAAAAATAATGGAGCC

[0240] - Probe: SEQ ID NO: 30CTCCTGAACGGCGTTTTTTTTAGATT;

[0241] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting agglomerated adherent E. coli EAEC are:

[0242] - Forward primer: SEQ ID NO: 31 CGGCTTATGAAGCAAAAATGCAG

[0243] - Reverse primer: SEQ ID NO: 32TCTCGAGCATCAACATCAGGT

[0244] - Probe: SEQ ID NO: 33TATTGAAATGCTTAGTGAGAGGAACA;

[0245] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting pathogenic Escherichia coli EPEC are:

[0246] -Forward primer: SEQ ID NO: 34CCGTGACCTATTAATACGGGGG

[0247] - Reverse primer: SEQ ID NO: 35CGCAAGCACCATTGCAGATT

[0248] - Probe: SEQ ID NO: 36CATGAATAAGAAATACGAAAAAGGTC;

[0249] Group D Campylobacter and toxin-forming pathogens group: detection of Campylobacter jejuni, Campylobacter coli, Listeria monocytogenes, and enterohemorrhagic Escherichia coli EHEC; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting enterohemorrhagic Escherichia coli are:

[0250] -Forward primer: SEQ ID NO: 37ATCACTCGTTAGTGCCCGTG

[0251] - Reverse primer: SEQ ID NO: 38ACCAGAAGAAGCATCCACCG

[0252] - Probe: SEQ ID NO: 39GAAGTTGAATTTTTTACAACGCTTACA;

[0253] b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting Campylobacter jejuni are:

[0254] -Forward primer: SEQ ID NO: 40ATCCGCACCAAGCAAGATGT

[0255] - Reverse primer: SEQ ID NO: 41CAGAGCAAAAGCTCCGCAAT

[0256] - Probe: SEQ ID NO: 42AAAGCAGCTAGTTTAATCTCTGAACT;

[0257] c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Listeria monocytogenes are:

[0258] -Forward primer: SEQ ID NO: 43TCGATTAACGGGAAGCTCGG

[0259] - Reverse primer: SEQ ID NO: 44AACAGCTGAGCTATGTGCGA

[0260] - Probe: SEQ ID NO: 45CCTATGTGTATGGTAAAGAAACTCCT;

[0261] d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Campylobacter coli are:

[0262] - Forward primer: SEQ ID NO: 46CGGAGCGACTCAGTCATCAA

[0263] - Reverse primer: SEQ ID NO: 47TAGTCAAAGAAGCAATGCCAGA

[0264] - Probe: SEQ ID NO: 48TTGGTGTAACAAGATTTGAAACAGGA.

[0265] Each set of probes is designed based on the genus classification, virulence gene specificity or serotype markers of pathogens:

[0266] Group A probe Vibrio detection group: detection of Vibrio cholerae universal type, Vibrio cholerae serotype O1, Vibrio cholerae serotype O139, Vibrio parahaemolyticus;

[0267] Group B probe invasive Enterobacteriaceae pathogen panel: detection of Escherichia coli O157:H7, Shigella, Salmonella, and Yersinia enterica;

[0268] Group C probe Escherichia coli pathotype detection group: detect enterotoxigenic E. coli ETEC, enteroinvasive E. coli EIEC, enteroaggregative adherent E. coli EAEC, and pathogenic E. coli EPEC;

[0269] Group D probe Campylobacter and toxin-type pathogen group: detects Campylobacter jejuni, Campylobacter coli, Listeria monocytogenes, and enterohemorrhagic Escherichia coli EHEC.

[0270] The probes were labeled with FAM, VIC, ROX, and CY5 fluorescent groups, and were compatible with the multi-channel fully automatic real-time fluorescence PCR detection system. There was no cross-interference in the fluorescence signals between the groups. The detection sensitivity of the probe was 10 CFU / mL, and there was no cross-reaction with 20 common intestinal commensal bacteria.

[0271] The detection methods are summarized as follows:

[0272] S1. Extracting DNA from a sample to be tested, wherein the sample to be tested is a food sample, an environmental sample or a clinical sample;

[0273] S2. Add the DNA template to the primer-probe combination tubes of group AD for multiplex fluorescence PCR amplification. Each reaction system contains 0.05-0.2 μM primer pair, 0.02-0.1 μM probe, 0.5-1 U / μL hot start Taq DNA polymerase, and 0.5-1.5 mM dNTPs.

[0274] S3. Analyze the amplification curve using a multi-channel fluorescence signal acquisition system. The amplification program is as follows: pre-denaturation at 97°C for 1 min; denaturation at 97°C for 5 s, annealing / extension at 58°C for 30 s, for a total of 40 cycles;

[0275] S4. Determine the presence of the target pathogen based on the Ct value, and calculate the initial concentration of the pathogen using the standard curve plasmid. When the Ct value is ≤35, it is considered positive. The detection linear range is not less than 10^1-10^6 CFU / mL; the amplification efficiency is not less than 90%, R 2 Value ≥ 0.99.

[0276] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A primer probe for simultaneously detecting 16 foodborne pathogens, characterized in that: Included AD group probes: Group A Vibrio detection group: detection of Vibrio cholerae universal type, Vibrio cholerae serotype O1, Vibrio cholerae serotype O139, Vibrio parahaemolyticus; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting Vibrio cholerae are: -Forward primer: SEQ ID NO: 1GGACGACTCATGGGGACTTG - Reverse primer: SEQ ID NO: 2TGGATTTGGCATCTGCACCT - Probe: SEQ ID NO: 3GCTTATGTGTGGTATGCCAAT; b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting Vibrio cholerae O1 serotype are: -Forward primer: SEQ ID NO: 4TTGCTGAGTTTGCTGCCAGT - Reverse primer: SEQ ID NO: 5GAGGTGGAAAGGGAAAGTGG - Probe: SEQ ID NO: 6AGGTACATAACGATACAGTACTT; c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Vibrio cholerae O139 serotype are: - Forward primer: SEQ ID NO: 7TCCAGTGTGGTGCGTTACTG - Reverse primer: SEQ ID NO: 8TGGTCTAACAGGGAACCCGC - Probe: SEQ ID NO: 9GTACAAGTGAGCGTAGAGGA; d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Vibrio parahaemolyticus are: -Forward primer: SEQ ID NO: 10TAGCTACCGCTTTGCTGACC - Reverse primer: SEQ ID NO: 11GCTCAAGACCTGTGTCTGCT - Probe: SEQ ID NO: 12GGCTACTCTCTATCTGCAAT; Group B Invasive Enterobacteriaceae Pathogen Panel: detection of Escherichia coli O157:H7, Shigella, Salmonella, and Yersinia enterica; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting E. coli O157:H7 are: -Forward primer: SEQ ID NO: 13CGTGGATATGTCAGGGGCTC - Reverse primer: SEQ ID NO: 14ACCGCCAGCACCATTATCAA - Probe: SEQ ID NO: 15GGCGGTGGAGATATCCTCCT; b. The sequences of the specific PCR primer pair and the probe labeled with VIC fluorescent dye for detecting Shigella are: -Forward primer: SEQ ID NO: 16TACCGACGAAAACGGCAAGA - Reverse primer: SEQ ID NO: 17CCACCTGCCAGTCAACAGAT - Probe: SEQ ID NO: 18CGCCGAATACCTGGGTGGAC; c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Salmonella are: -Forward primer: SEQ ID NO: 19GCGGATGCTTCGCGTTTTAT - Reverse primer: SEQ ID NO: 20GCTAACGGATTGCGAAGCTG - Probe: SEQ ID NO: 21 GCTAACGGATTGCGAAGCTG; d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Yersinia intestinalis are: -Forward primer: SEQ ID NO: 22TAACCCGTAACAGCGACACC - Reverse primer: SEQ ID NO: 23CGTTTGGCGGAAAAGACCAA - Probe: SEQ ID NO: 24GATTGCTCCGTCATTATTGTGGCAAC; Group C Escherichia coli pathotype detection group: detection of enterotoxigenic E. coli ETEC, enteroinvasive E. coli EIEC, enteroaggregative adherent E. coli EAEC, and pathogenic E. coli EPEC; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting enterotoxigenic E. coli ETEC are: - Forward primer: SEQ ID NO: 25ATGCGAATTCGTTCTTCCCT - Reverse primer: SEQ ID NO: 26CCATGTTTTTCCTGCTGAGCTT - Probe: SEQ ID NO: 27ACAAAACAATGAAAATAAAGATGAA; b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting enteroinvasive E. coli EIEC are: -Forward primer: SEQ ID NO: 28GGTTTGATGGACATTTCAAGCTG - Reverse primer: SEQ ID NO: 29TGGAAGAAAGAAAAATAATGGAGCC - Probe: SEQ ID NO: 30CTCCTGAACGGCGTTTTTTTTAGATT; c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting agglomerated adherent E. coli EAEC are: - Forward primer: SEQ ID NO: 31 CGGCTTATGAAGCAAAAATGCAG - Reverse primer: SEQ ID NO: 32TCTCGAGCATCAACATCAGGT - Probe: SEQ ID NO: 33TATTGAAATGCTTAGTGAGAGGAACA; d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting pathogenic Escherichia coli EPEC are: -Forward primer: SEQ ID NO: 34CCGTGACCTATTAATACGGGGG - Reverse primer: SEQ ID NO: 35CGCAAGCACCATTGCAGATT - Probe: SEQ ID NO: 36CATGAATAAGAAATACGAAAAAGGTC; Group D Campylobacter and toxin-forming pathogens group: detection of Campylobacter jejuni, Campylobacter coli, Listeria monocytogenes, and enterohemorrhagic Escherichia coli EHEC; a. The specific PCR primer pair and probe sequence labeled with FAM fluorescent dye for detecting enterohemorrhagic Escherichia coli are: -Forward primer: SEQ ID NO: 37ATCACTCGTTAGTGCCCGTG - Reverse primer: SEQ ID NO: 38ACCAGAAGAAGCATCCACCG - Probe: SEQ ID NO: 39GAAGTTGAATTTTTTACAACGCTTACA; b. The specific PCR primer pair and probe sequence labeled with VIC fluorescent dye for detecting Campylobacter jejuni are: -Forward primer: SEQ ID NO: 40ATCCGCACCAAGCAAGATGT - Reverse primer: SEQ ID NO: 41CAGAGCAAAAGCTCCGCAAT - Probe: SEQ ID NO: 42AAAGCAGCTAGTTTAATCTCTGAACT; c. The specific PCR primer pair and probe sequence labeled with ROX fluorescent dye for detecting Listeria monocytogenes are: -Forward primer: SEQ ID NO: 43TCGATTAACGGGAAGCTCGG - Reverse primer: SEQ ID NO: 44AACAGCTGAGCTATGTGCGA - Probe: SEQ ID NO: 45CCTATGTGTATGGTAAAGAAACTCCT; d. The specific PCR primer pair and the probe sequence labeled with CY5 fluorescent dye for detecting Campylobacter coli are: - Forward primer: SEQ ID NO: 46CGGAGCGACTCAGTCATCAA - Reverse primer: SEQ ID NO: 47TAGTCAAAGAAGCAATGCCAGA - Probe: SEQ ID NO: 48TTGGTGTAACAAGATTTGAAACAGGA.

2. A kit for simultaneously detecting 16 foodborne pathogens, characterized in that: Each group of probes is designed based on the genus classification, virulence gene specificity or serotype marker of the pathogen: Group A probe Vibrio detection group: detection of Vibrio cholerae universal type, Vibrio cholerae serotype O1, Vibrio cholerae serotype O139, Vibrio parahaemolyticus; Group B probe invasive Enterobacteriaceae pathogen panel: detection of Escherichia coli O157:H7, Shigella, Salmonella, and Yersinia enterica; Group C probe Escherichia coli pathotype detection group: detect enterotoxigenic E. coli ETEC, enteroinvasive E. coli EIEC, enteroaggregative adherent E. coli EAEC, and pathogenic E. coli EPEC; Group D probe Campylobacter and toxin-type pathogen group: detects Campylobacter jejuni, Campylobacter coli, Listeria monocytogenes, and enterohemorrhagic Escherichia coli EHEC.

3. The kit for simultaneously detecting 16 foodborne pathogens according to claim 1, characterized in that: Each group of probes is labeled with FAM, VIC, ROX, and CY5 fluorescent groups, respectively, and is compatible with a multi-channel fully automatic real-time fluorescent PCR detection system, and there is no cross-interference of fluorescent signals between groups.

4. The kit for simultaneously detecting 16 foodborne pathogens according to claim 1, characterized in that: The detection sensitivity of the probe is 10 CFU / mL, and there is no cross-reaction with 20 common intestinal commensal bacteria.

5. A method for simultaneously detecting 16 foodborne pathogens according to claim 1: S1, extracting the DNA of the sample to be tested, wherein: The sample to be tested is a food sample, an environmental sample or a clinical sample; S2, adding DNA templates to primer-probe combination tubes of group AD respectively for multiplex fluorescence PCR amplification; S3, analyzing the amplification curve through a multi-channel fluorescence signal acquisition system; S4. Determine the presence of target pathogens based on the Ct value. When the Ct value is ≤35, it is considered positive. The detection linear range is not less than 10^1-10^6 CFU / mL. The PCR reaction procedure is: 97℃ pre-denaturation for 1min; 97℃ denaturation for 5s, 58℃ annealing / extension for 30s, for a total of 40 cycles. The amplification efficiency is not less than 90%, R 2 Value ≥ 0.

99.

6. A kit for simultaneously detecting 16 foodborne pathogens according to claim 1, characterized in that Contains: PCR buffer, dNTPs, Taq DNA polymerase, MgCl2, the buffer contains the following components: a) 10-50 mM Tris-HCl (pH 8.3-9.0), more preferably 25 mM Tris-HCl (pH 8.3-9.0); b) 0.5-2% w / v) polyethylene glycol 20000 (PEG 20000), more preferably 1% w / v polyethylene glycol 20000 (PEG 20000); c) 0.1-0.5 M betaine, more preferably 0.3 M betaine; d) 1-3 mM MgCl2, more preferably 1-3 mM MgCl2; The PEG 20000 is used to inhibit the formation of primer dimers, betaine is used to improve the amplification efficiency of GC-rich templates, and the buffer can make the difference in amplification efficiency of 16 pathogens ≤15%.

7. A kit for simultaneously detecting 16 foodborne pathogens according to claim 1, characterized in that: The PCR amplification system contains the following optimized components: a) 0.05-0.2 μM primer pair, more preferably 0.1 μM primer pair; b) 0.02-0.1 μM probe, more preferably 0.05 μM probe; c) 0.5-1 U / μL hot start Taq DNA polymerase, more preferably 0.5-1 U / μL hot start Taq DNA polymerase; d) 0.5-1.5 mM dNTPs, more preferably 0.5-1.5 mM dNTPs; wherein the concentration ratio of primer to probe is controlled at 1:0.4-1:0.6 to balance amplification efficiency and fluorescence signal interference; 8. A kit for simultaneously detecting 16 foodborne pathogens according to claim 1, characterized in that: It also includes: a positive control, a negative control, and a standard curve plasmid. The positive control is a recombinant plasmid mixture containing 16 pathogen-specific target genes; the negative control is sterile deionized water added with 1% bovine serum albumin (BSA) to eliminate sample matrix interference; the standard curve plasmid range is 10^1-10^6 CFU / mL.

Images