Primer capable of simultaneously identifying five maple species and application

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses a primer capable of identifying five acer species at the same time and application of the primer, the primer comprises AcerTS-F: CGGAACTAGTCGGATGGAGT; the invention relates to a method for preparing an Ac < S-R >: GAAGCAGTTCGAGACAACCG; respectively extracting total DNA (deoxyribonucleic acid) of acer palmatum, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum plants; carrying out PCR (Polymerase Chain Reaction) amplification on the total DNA (Deoxyribose Nucleic Acid) of each species by using the AcerTS-F and the AcerTS-R; after PCR products are sequenced, sequence comparison is carried out, five acer species including acer northeast, acer mono, acer ginnala, acer tegmentosum and acer mogmentosum can be identified at the same time, and precious genetic resources are provided for genetic diversity, phylogenetic evolution and taxonomy research of the acer species.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, in particular to a primer capable of simultaneously identifying five species of Acer genus and its application. Background Art

[0002] The genus Acer (Acer L.) has about 200 species and dominates the forests of the Northern Hemisphere. Acer species are foundation species for many terrestrial ecosystems in northern China, have high economic value, and are one of the most important timber species. Flavonoids, tannins, terpenes, sterols, alkaloids, diarylheptanes, diarylheptanes, etc. have been isolated from Acer plants, which have high biological activity and pharmacological effects. It is an important autumn foliage tree species in Northeast China and can be used as a street tree or landscaping. Despite its importance, the phylogenetic relationships of this genus are still unclear. Five species of Acer (Acer sutchuenensis, Acer sutchuenensis, Acer sutchuenensis, Acer sutchuenensis, Acer sutchuenensis, Acer sutchuenensis) play an important role in different forest types.

[0003] In recent years, many molecular identification methods have been developed, and commonly used DNA barcodes, such as ITS and trnK genes, have been used for species identification and phylogenetic analysis of Acer. However, due to unclear species boundaries and low resolution, the performance of these markers at the species level and subspecific level is not satisfactory. Therefore, how to provide a simple and efficient molecular marker that can distinguish Acer species is an urgent problem to be solved in this field. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a primer and application capable of simultaneously identifying five species of Acer genus.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0006] One of the objects of the present invention is to provide a primer that can simultaneously identify five species of Acer genus, the primer comprising:

[0007] AcerTS-F: CGGAACTAGTCGGATGGAGT;

[0008] AcerTS-R:GAAGCAGTTCGAGACAACCG;

[0009] The five species of Acer are Acer sutchuenensis, Acer chromaticum, Acer striata, Acer chinensis and Acer scutellaria.

[0010] The second object of the present invention is to provide a method for simultaneously identifying five species of Acer using the above primers, comprising the following steps:

[0011] S1. Extract the total DNA of Acer truncatum, Acer chromaticum, Acer striata, Acer chinensis and Acer truncatum respectively;

[0012] S2, PCR amplification of total DNA of each species using AcerTS-F and AcerTS-R respectively;

[0013] S3. After sequencing the PCR products, sequence comparison was performed. Taking the amplified sequence of Acer truncatum as a reference, deletions occurred at 146bp-171bp in Acer truncatum, Acer chromaticum, Acer striata, and Acer chinensis. Compared with the other four species, the base at position 127 of Acer truncatum changed from T to C; compared with the other four species, the base at position 120 of Acer striata changed from A to C; compared with the other four species, the base at position 167 of Acer chromaticum changed from G to A.

[0014] Furthermore, the PCR amplification reaction system includes: 12.5 μl TaqPCR MasterMix (2×), 1 μl AcerTS-F with a concentration of 10 μM, 1 μl AcerTS-R with a concentration of 10 μM, 2 μl DNA, and 8.5 μl ddH2O; the PCR amplification reaction conditions are: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 68°C for 1 minute, for a total of 35 cycles; and finally extension at 68°C for 7 minutes.

[0015] Compared with the prior art, the designed primers of the present invention can simultaneously identify five species of Acer, namely, Acer truncatum, Acer chromaticum, Acer striata, Acer truncatum and Acer truncatum, providing valuable genetic resources for the genetic diversity, systematic evolution and taxonomic research of Acer species. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the chloroplast genome characteristics of the Acer truncatum plant.

[0017] Figure 2 The figure shows the length and number of repeated sequences in the chloroplast genome of five Acer species.

[0018] Figure 3 Nucleotide variations in the chloroplast genomes of five Acer species.

[0019] Figure 4 Schematic diagram of the comparative chloroplast genome structure of five maple species.

[0020] Figure 5 To use mVISTA to visually compare the chloroplast genomes of five Acer species.

[0021] Figure 6 The results of sequencing Acer TS primers for Acer sutchuenensis, Acer monochromatum, Acer striata, Acer chinensis, and Acer scutellaria. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0023] This example exemplifies a method for simultaneously identifying five species of Acer genus, and the specific process is as follows:

[0024] 1) Extracting total DNA from Acer truncatum, Acer serrata, Acer serrata, Acer serrata and Acer serrata plants respectively; then sequencing the extracted total DNA from Acer truncatum, Acer serrata, Acer serrata, Acer serrata and Acer serrata plants respectively, obtaining chloroplast genome sequences from the total DNA sequencing results, and performing differential analysis on the data; the data differential analysis method specifically includes:

[0025] Using mVISTA software and the ShuffleLAGAN model, the chloroplast genomes of five Acer species were aligned, annotated, and visualized.

[0026] The sizes and junction sites of LSC / IRb / SSC / IRa regions of 55 Acer species were compared using the IRscope online program. In the analysis of genome structural rearrangement, the cp genomes of the five species were aligned using the MAUVE program. Codon usage, synonymous codon usage, and RSCU were determined using CodonWv1.4.2. Nucleotide differentiation of Acer species was calculated based on nucleotide diversity values ​​using the DnaSP v6 software. The reverse, forward, complement, and palindromic repeat sequences of the chloroplast genomes of the five species were identified using the REPuter program, and the parameters were set as follows: 1) the minimum repeat sequence length was 20 bp, 2) the maximum calculated repeat length was 50 bp, 3) the consistency was not less than 90%, and 4) the Hamming distance was 3. The SSR loci of the chloroplast genomes of the five Acer species were mapped using the MISA (v2.1) software. The minimum number was: 8 repeats for the mononucleotide type; 4 repeats for the dinucleotide type; 4 repeats for the trinucleotide type; and 3 repeats for the tetranucleotide type, pentanucleotide type, and hexanucleotide type. The minimum length between two SSR sites was greater than 100 bp.

[0027] The results are as follows:

[0028] The present invention analyzed the SSRs results and showed that there were 4 types of SSRs (Table 1 and Figure 2). A. tataricum had a total of 96 SSRs, A. mandshuricum 109 SSRs, A. pictum 106 SSRs, A. tegmentosum 110 SSRs, and A. ukurunduense 107 SSRs. The types and contents of the motifs varied between species. Mononucleotides accounted for the largest proportion (58.33% to 64.22%) in the five species, followed by dinucleotides (27.52% to 34.38%), tetranucleotides (5.21% to 7.55%), and trinucleotides (1.89% to 3.74%). Mononucleotides accounted for 86.44% to 93.84%. Most SSRs in all species were A / T mononucleotides. In the chloroplast genome, the LSC region had the most SSRs, ranging from 57 to 71 in the five species analyzed here. However, the number of SSRs in the IR region was the least, ranging from 22 to 24, the number in the SSC region was 13 to 19, and the number in the LSC region was 57 to 71. The number of SSRs in the intergenic region was the highest, and the number of SSRs in the intron region was the lowest.

[0029] Table 1 Repeat sequence information of chloroplast genomes of five Acer species

[0030]

[0031] The Pi values ​​of the five Acer species range from 0 to 0.029 ( Figure 3 ). The results showed that rapid nucleotide substitutions can occur in Acer plants. The nucleotide variability in the IR region was not obvious compared with the SSC and LSC regions. There were four variable regions (trnK-UUU / rps16, ndhF / rpl32, rpl32 / trnL-UAG, and ycf1) with Pi values ​​exceeding 0.02, and all variable regions showed high nucleotide diversity, which was observed in the intergenic regions.

[0032] The chloroplast genome sequences of five Acer species were compared using the MAUVE program ( Figure 4 The results showed that the chloroplast genome structures of the five Acer species were very similar and had good colinearity. The mVISTA program was used to analyze ( Figure 5 ), and found hypervariable regions including mark / rps16, trnQ-UUG / rps16, trnQ-UUG / psbI, trnS-GCU / atpA, atpH / atpI, psbZ / trnG-GCC, ycf3 / trnS-GGA, trnT-UGU / trnL-UAA, trnF-GAA / ndhJ, petA / psbJ, ndhF / trnL-UAG, and ycf1.

[0033] Then, select the differential regions and design the detection primers as follows:

[0034] AcerTS-F: CGGAACTAGTCGGATGGAGT;

[0035] AcerTS-R:GAAGCAGTTCGAGACAACCG.

[0036] 2) AcerTS-F and AcerTS-R were used to perform PCR amplification on the total DNA of each species; specifically, three plant individuals were collected for each species, and total DNA was extracted. The total DNA extracted from each plant species was amplified by the detection primers, and the PCR amplification experiment was performed. The PCR amplification reaction system was: 12.5μl Taq PCR MasterMix (2×), 1μl AcerTS-F with a concentration of 10μM, 1μl AcerTS-R with a concentration of 10μM, 2μl DNA, 8.5μl ddH2O; the PCR amplification reaction conditions were: 94℃ pre-denaturation for 2 minutes; 94℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 68℃ extension for 1 minute, a total of 35 cycles; and finally 68℃ extension for 7 minutes.

[0037] A specific molecular marker was established based on the hypervariable regions of the chloroplast genomes of five Acer species in Northeast China. The PCR products were electrophoresed by 1% agarose gel. The products recovered after gel excision were sequenced by Sanger sequencing. 15 total DNA samples were amplified by the primer set, and each sample was repeated 3 times. The corresponding PCR products were sequenced by double-end sequencing. The sequencing results were compared and found that AcerTS-F / R can produce stable target bands and can well distinguish Northeast Acer (Acer mandshuricum), Acer pictum, Acer tataricum, Acer tegmentosum, and Acer ukurunduense. Agarose gel electrophoresis showed that the size of the amplified fragment was the same as the target fragment. Sequencing of PCR products revealed three SNP sites and one insertion-deletion mutation site (Indel) in the amplified sequence, which accurately identified five species (A. mandshuricum, A. tataricum, A. pictum, A. tegmentosum and A. ukurunduense) ( Figure 5 ). Using the amplified sequence of Acer truncatum as a reference, Acer truncatum, Acer truncatum, Acer truncatum, and Acer truncatum had deletions at 146bp-171bp; the base at position 127 of Acer truncatum changed from T to C compared with the other four species; the base at position 120 of Acer truncatum changed from A to C compared with the other four species; the base at position 167 of Acer truncatum changed from G to A compared with the other four species ( Figure 6 ).

[0038] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A primer capable of simultaneously identifying five species of Acer genus, characterized in that: The primers include: AcerTS-F: CGGAACTAGTCGGATGGAGT; AcerTS-R:GAAGCAGTTCGAGACAACCG; The five species of Acer are Acer sutchuenensis, Acer chromaticum, Acer striata, Acer chinensis and Acer scutellaria.

2. A method for simultaneously identifying five species of Acer using the primers as claimed in claim 1, characterized in that: The following steps are involved: S1. Extract the total DNA of Acer truncatum, Acer chromaticum, Acer striata, Acer chinensis and Acer truncatum respectively; S2, PCR amplification of total DNA of each species using AcerTS-F and AcerTS-R respectively; S3. After sequencing the PCR products, sequence comparison was performed. Taking the amplified sequence of Acer truncatum as a reference, deletions occurred at 146bp-171bp in Acer truncatum, Acer chromaticum, Acer striata, and Acer chinensis. Compared with the other four species, the base at position 127 of Acer truncatum changed from T to C; compared with the other four species, the base at position 120 of Acer striata changed from A to C; compared with the other four species, the base at position 167 of Acer chromaticum changed from G to A.

3. The method for simultaneously identifying five species of Acer genus according to claim 2, characterized in that: The PCR amplification reaction system includes: 12.5 μl TaqPCR MasterMix (2×), 1 μl AcerTS-F with a concentration of 10 μM, 1 μl AcerTS-R with a concentration of 10 μM, 2 μl DNA, and 8.5 μl ddH2O; the PCR amplification reaction conditions are: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 68°C for 1 minute, for a total of 35 cycles; and finally extension at 68°C for 7 minutes.

Images