Molecular marker for identifying content of strawberry flavor substance gamma-decalactone and application of molecular marker
By detecting specific single nucleotide polymorphic sites in the strawberry genome, the problem of identifying the content of strawberry γ-delactone is solved, and the efficiency of strawberry breeding and the aroma quality of fruits is improved.
Patent Information
- Application Number
- CN202510274926.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-05-13
Smart Images
Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] The invention belongs to the field of gene biotechnology, and particularly relates to a molecular marker for identifying the content of gamma-decanolide, a strawberry flavor substance, and an application thereof. Background Art
[0002] Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome. It is the smallest variation unit and is a variation form formed by a single nucleotide substitution, transversion, insertion or deletion.
[0003] Cultivated strawberry (Fragaria × ananassa, 2n=8x=56) is an octoploid perennial herb. Due to its short growth cycle, wide adaptability and high economic benefits, my country's strawberry industry has developed rapidly in recent years and plays an important role in the development of modern urban agriculture. With the development of the industry, consumers' demand for high-quality strawberry fruits is growing. For a long time, the breeding goal of increasing yield and suitable production has caused the decline and loss of the content of fruit flavor substances, which can no longer meet the market demand for variety diversification and hinder the further improvement and development of the industry.
[0004] Aroma is one of the important quality traits of strawberries. It plays an important role in improving the attractiveness and competitiveness of strawberry fruits and is one of the essential characteristics of high-quality strawberries in the current market. Since aroma traits are composed of a variety of volatile substances, the formation and regulation mechanisms are complex, and the mining of related genes is far from enough, it is still difficult to achieve the regulation of aroma traits, and there is a lack of strawberry varieties with strong aroma. Therefore, molecular breeding and genetics, as a powerful way of forward gene mining, can reveal the genetic laws of key substances in strawberry aroma by using specific hybrid populations, and explore related molecular markers and genes, which greatly promotes the research on the regulation of strawberry aroma formation. Summary of the invention
[0005] The technical problem to be solved by the present invention is how to quickly and accurately identify the content of γ-decanolide, a strawberry aroma substance, by using molecular markers.
[0006] In order to solve the above problems, the present invention first provides an application of a substance for detecting a single nucleotide polymorphism in a strawberry genome, wherein the single nucleotide polymorphism may be Marker959933, Marker960055 and Marker960072; Marker959933 is a single nucleotide polymorphism in the strawberry genome, which is the 29084958th nucleotide of the Fvb3-2 chromosome, which is C or G; Marker960055 is a single nucleotide polymorphism in the strawberry genome, which is the 29107970th nucleotide of the Fvb3-2 chromosome, which is C or G; Marker960072 is a single nucleotide polymorphism in the strawberry genome, which is the 29109249th nucleotide of the Fvb3-2 chromosome, which is A or T; the application may be an application for identifying or assisting in identifying the content of γ-decalactone in strawberries and / or strawberry breeding.
[0007] The Marker959933 corresponds to the nucleotide 29084958 of the strawberry reference genome (Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1, Date performed: 2019-02-28) Fvb3-2 chromosome; the Marker960055 corresponds to the nucleotide 29107970 of the strawberry reference genome (Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1, Date performed: 2019-02-28) Fvb3-2 chromosome; the Marker960072 corresponds to the strawberry reference genome (Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1, Date performed: performed: 2019-02-28) nucleotide 29109249 of chromosome Fvb3-2 (https: / / www.rosaceae.org / species / fragaria_x_ananassa / genome_v1.0.a1).
[0008] In the above application, the substance can be a primer composition for amplifying a strawberry genomic DNA fragment including the single nucleotide polymorphism site, a PCR reagent containing the primer composition, and / or a kit containing the primer composition or the PCR reagent.
[0009] The present invention also provides a method for identifying or assisting in identifying the content of γ-decalactone in strawberries, the method comprising detecting the genotype of the single nucleotide polymorphism in the genome of the strawberry to be tested, and identifying or assisting in identifying the content of γ-decalactone in strawberries according to the genotype.
[0010] In the above method, the strawberry may be a hybrid offspring or a strawberry variety.
[0011] The strawberry may be a hybrid offspring of strawberry A and strawberry B. Both strawberry A and strawberry B may be strawberry varieties carrying the SNP. The strawberry A may be specifically a Monterey strawberry, and the strawberry B may be specifically a Jingtaoxiang strawberry. The hybrid offspring is the F1 generation.
[0012] In the above method, according to the genotype identification or auxiliary identification of the γ-decalactone content of the strawberry, the γ-decalactone content of the strawberry to be tested whose genotype is heterozygous can be lower than that of the strawberry to be tested whose genotype is homozygous.
[0013] The invention also provides application of the method in strawberry breeding.
[0014] The present invention also provides a strawberry breeding method, which comprises detecting the genotypes of Marker959933, Marker960055 and Marker960072 in the strawberry genome, and selecting strawberries whose genotype of Marker959933 is CC, whose genotype of Marker960055 is GG and whose genotype of Marker960072 is TT as parents for breeding.
[0015] The present invention also provides a primer composition for detecting the polymorphism or genotype of a single nucleotide polymorphism site in a strawberry genome, wherein the primer composition consists of a Marker959933 primer pair, a Marker960055 primer pair and / or a Marker960072 primer pair; the Marker959933 primer pair consists of a single-stranded DNA of a sequence 1 in a sequence list and a sequence 2 in the sequence list, the Marker960055 primer pair consists of a single-stranded DNA of a sequence 3 in a sequence list and a sequence 4 in the sequence list, and the Marker960072 primer pair consists of a single-stranded DNA of a sequence 5 in a sequence list and a sequence 6 in the sequence list.
[0016] In the above, the sequence 1 can be specifically 5'-CGATTTTTCTTTTTCCTCTTTTCTT-3', the sequence 2 can be specifically 5'-GTCAGGTATGGTTTCTCGCTCACAC-3', the sequence 3 can be specifically 5'-TCTCAAAGCAAATAATACTGAAGCA-3', the sequence 4 can be specifically 5'-CTTCTTCACTCCTCTTCATCCTCAT-3', the sequence 5 can be specifically 5'-GTTGAAGGGTGACACAGAACCAGAC-3', and the sequence 6 can be specifically 5'-AAATTATCGATGCTCGTTTATTGCA-3'.
[0017] The PCR product of the Marker959933 primer pair is sequence 7 (SEQ ID NO: 7, 358 bp) in the sequence list. Marker 959933 is located at the 29084958th base position of the cultivated strawberry Fvb3-2 chromosome, corresponding to the 185th nucleotide of sequence 7, which is C or G (indicated by "S"), and its polymorphism is CC / CG.
[0018] The PCR product of the Marker960055 primer pair is sequence 8 (SEQ ID NO: 8, 366 bp) in the sequence list. Marker 960055 is located at the 29107970th base position of the cultivated strawberry Fvb3-2 chromosome, corresponding to the 206th nucleotide of sequence 8, which is C or G (indicated by "S"), and its polymorphism is GG / CG.
[0019] The PCR product of the Marker960072 primer pair is sequence 9 in the sequence list (SEQ ID NO: 9, 290 bp). Marker Marker960072 is located at base position 29109249 of the chromosome of cultivated strawberry Fvb3-2, corresponding to the 149th nucleotide of sequence 9, which is T or A (indicated by "W"), and its polymorphism is TT / AT.
[0020] The present invention also provides a PCR reagent containing the primer combination.
[0021] The present invention also provides a kit containing the PCR reagent.
[0022] The present invention also provides a nucleic acid molecule, the nucleotide sequence of which may be sequence 7, sequence 8 and / or sequence 9 in the sequence listing.
[0023] In the present application, the breeding index includes the γ-decanolide content.
[0024] In the present application, the purpose of the breeding includes cultivating strawberry plants with high γ-decalactone (the γ-decalactone trait is higher than that of the parent).
[0025] This study aims to reveal the genetic laws of strawberry peach aroma traits and to explore molecular markers closely linked to the key substance γ-decalactone. The F1 hybrid population of 'Monterey' × 'Jingtaoxiang' was used as the test material, and SNP markers were developed by progeny resequencing, a high-density genetic linkage map was constructed, and QTL positioning was carried out in combination with phenotypic GC-MS measurement results, and molecular markers related to strawberry γ-decalactone were screened, laying a foundation for strawberry aroma breeding and the study of aroma regulation mechanisms. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 It is a highly significant QTL site for the γ-decanolide content in LGFvb3-2. DETAILED DESCRIPTION
[0027] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0028] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0029] The following implementation cases were analyzed and processed using EXCEL for phenotypic data, and the results were expressed as mean ± standard deviation. QTL positioning was performed using MapQTL 6.0 software, and the QTL significance was determined by the PT test of the software. Significant QTL means P < 0.05, and extremely significant QTL means P < 0.01.
[0030] Example 1: Population phenotype identification 1. Construction of hybrid population Through the detection of volatile substances, it was found that the content of γ-decanolide in 'Jingtaoxiang' (Wang Guixia et al., 2018) was significantly higher than that in other varieties. It is a key substance for peach aroma and is mainly accumulated during the fruit ripening period. In order to maximize the separation of traits in the hybrid offspring population, the target selected parents were tested for the content of γ-decanolide in the fruit ripening period. It was found that the mature fruit of the variety 'Monterey' (a product of Beijing Larsen Canyon Company) almost did not produce this substance and was stable, making it a suitable variety. Based on the above results, the hybrid combination of 'Monterey'×'Jingtaoxiang' was configured. After sowing and breeding, a total of 170 F1 offspring lines were obtained.
[0031] 2. Determination of γ-decanolide content and genetic analysis of hybrid populations The volatile substances in the mature fruits of the parents and F1 hybrid offspring in two consecutive production seasons of 2020-2021 and 2021-2022 were detected by GC-MS, and the characteristic substance γ-decanolide was quantitatively analyzed. According to the actual sampling results, the γ-decanolide content of 170 F1 offspring of the parents in the 2020-2021 production season varied in the population from 0.000 to 103.500 μg / kg, with an average of 16.891 μg / kg and a standard deviation of 22.596 μg / kg. In the 2021-2022 production season, the γ-decanolide content of 134 F1 offspring of the parents varied in the population from 0.000 to 210.226 μg / kg, with an average of 27.079 μg / kg and a standard deviation of 41.714 μg / kg (Table 1).
[0032] Table 1 γ-Decalactone test results of parents and F1 offspring
[0033] 3. Genetic analysis of γ-decanolide in hybrid population According to the γ-decanolide test results of the population, genetic analysis was carried out, frequency distribution diagrams were drawn, and segregation ratio chi-square tests were performed to analyze the possible genetic control mechanism of the trait. Distribution analysis found that among the 170 F1 offspring tested in the 2020-2021 production season, 108 contained γ-decanolide and 62 did not, and the chi-square test met the segregation ratio of 2:1; among the 134 F1 offspring tested in the 2021-2022 production season, 73 contained γ-decanolide and 61 did not, and the chi-square test met the segregation ratio of 1:1. In summary, it can be inferred that whether the offspring of the population contains γ-decanolide may be a quality trait controlled by 1-2 major effect genes.
[0034] The distribution analysis of individual plants containing γ-decanolide in two production seasons showed that its content showed continuous changes, which was consistent with the skewed distribution with a concentration of less content. It was speculated that the content of γ-decanolide in the offspring of the population might be a quantitative trait controlled by multiple genes.
[0035] Example 2: γ-decalactone QTL positioning and linkage molecular marker development 1. QTL Mapping of γ-Decalactone The phenotypic data and genetic linkage map were combined to locate the QTL for γ-decanolide content in strawberry. The interval mapping method in the software MapQTL6.0 was used to detect the QTL loci. Finally, the extremely significant QTL loci related to γ-decanolide content were located on LGFvb3-2, with a peak LOD = 10.33, an explained phenotypic variation rate of 24.5%, and the most closely linked markers were Block2216 and Block2217 (Table 2).
[0036] Table 2 Detailed location information of the QTL loci for γ-decanolide content.
[0037]
[0038] 2. Development of γ-decanolide linked molecular markers Based on the above QTL positioning results, linkage marker verification and screening were carried out for the γ-decanolide content trait. According to the physical position of the tightly linked markers and the development results of resequencing markers, 20 SNP markers were extracted within the QTL interval on LGFvb3-2 for linkage analysis. Finally, three linkage molecules with the γ-decanolide content in strawberry fruit were obtained, namely: Marker959933, Marker960055 and Marker960072, and their primer sequences are shown in Table 3.
[0039] Table 3 Primer sequences of three closely linked markers
[0040] The PCR product of the Marker959933 primer pair is sequence 7 (SEQ ID NO: 7, 358 bp) in the sequence list. Marker959933 is located at base position 29084958 of chromosome Fvb3-2 of the cultivated strawberry reference genome (Fragaria xananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1, Date performed: 2019-02-28), corresponding to the 185th nucleotide of sequence 7, which is C or G (indicated by "S"), and its polymorphism is CC / CG, as follows: 5'-CGATTTTTCTTTTTCCTCTTTTCTTGCAGATGGTGACTTACTAGAAGCATTTATCGCCTTCTTCCTGAGGTTGCAAATCCTTGAACGCCTTCTCTTCTTCAGAATTCTCAAAATCTGCTCTTCTGTCTCTAAATTCATCTTGAGTTCCCCACCCTTCTAGACCTTCAATGAACAAAA TGTAASCAGTTACATATCAGATACACTCTTTCGGGCTCGCCCTTCCCTTTCCCTCTTTTGTACAAGTAACATTACTTAGCCTCAATTCATAATGTCTGGAACTTCTACACAGCTTTTTTAATACATAAATCCCCTCATACCATCAAATTGCCTTGTGTGAGCGAGAAACCATACCTGAC-3'.
[0041] The PCR product of the Marker960055 primer pair is sequence 8 in the sequence list (SEQ ID NO: 8, 366 bp). Marker960055 is located at base position 29107970 of chromosome Fvb3-2 of the cultivated strawberry reference genome (Fragaria xananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1, Date performed: 2019-02-28), corresponding to the 206th nucleotide of sequence 8, which is C or G (indicated by "S"), and its polymorphism is GG / CG, as follows: 5'-TCTCAAAGCAAATAATACTGAAGCACATACTTGCATACTACGTCATGTAGATCCTTAATTCTGTACAGATTGTTATTAATTCTGAACAAAGCATCCTTATCGAGAGAAGTTACTATCAAGTAGCCAAGTATTCATCTGTACGCATCCACATGAGCTATGGTTGTACTTGCAGAAATTACT TCAGTTCGATAAATGATATGAASTTAGATGTTTGATTCACTGAACCTTTTACTTCTTTGTTGTTGCACAATATATGGACTGGGATAGAAATGGAATGGTGAACTTCAAGGAGTTCCTTTTCGCATTCACTCGATGGATTGGAATTGACGATCTTGATGATGAGGATGAAGAGGAGTGAAGAAG-3'.
[0042] The PCR product of the primer pair Marker960072 is sequence 9 in the sequence list (SEQ ID NO: 9, 290 bp). Marker960072 is located at base position 29109249 of chromosome Fvb3-2 of the reference genome of cultivated strawberry (Fragaria xananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1, Date performed: 2019-02-28), corresponding to the 149th nucleotide of sequence 9, which is T or A (indicated by "W"), and its polymorphism is TT / AT, as follows: 5'-GTTGAAGGGTGACACAGAACCAGACGTGTACCAGTTGAGCATTGCCAATTCTCGGCAGCTGCTGCTTCTTGTAGAAATCTTGAGATTCATCCTATATTAATTTCAGCAGCAATAACACAATTAATATAGACATCATGCCAAGTTTC ATCWCTTGCAGGTGGAATAAACAATATTTACTAGAGAGGAGGGGAAGAAATCTTTTCTTTTGAGAAGGAAAGGAAAAACATACCACAGGCCTGAGCAGATCTTCAAGAACTTCTTACCGCTTGCAATAAACGAGCATCGATAATTT-3'.
[0043] The detailed genome sequence of cultivated strawberry is available at the following website: https: / / www.rosaceae.org / species / fragaria_x_ananassa / genome_v1.0.a1.
[0044] Example 3: Molecular marker detection of γ-decanolide content in strawberry fruit The three markers were used to verify 60 phenotypic difference plants in the F1 hybrid population of 'Monterey'×'Jingtaoxiang'. The PCR reaction system was 50 ul, including 2× pcr mix 25 ul, F primer 2.5 ul (10uM), R primer2.5 ul (10uM), DNA 2 ul (100ng / ul), ddH2O 18 ul. The PCR program was: 95℃ 3 min; 95℃ 15s, 58℃ 15s, 72℃ 30s, 36 cycles; 72℃ 5min. The PCR amplification products were sequenced and it was confirmed that the three markers were closely linked to the γ-decanolide content of strawberry fruit.
[0045] The results showed that for the marker Marker959933, among the 30 F1 strawberries with γ-decanolide content of 0.00µg / kg, 26 were heterozygous genotypes; among the 30 F1 strawberries with γ-decanolide content greater than 30µg / kg, all were homozygous genotypes. Therefore, the accuracy of identifying the γ-decanolide content trait based on the genotype of Marker959933 was 93.33%. The homozygous genotype of Marker959933 is CC, and the genotype of Marker959933 is CC, which means that Marker959933 is homozygous for C; the heterozygous genotype of Marker959933 is CG, and the genotype of Marker959933 is CG, which means that Marker959933 is heterozygous for CG.
[0046] For marker Marker960055, 27 of the 30 F1 strawberries with γ-decanolide content of 0.00µg / kg were heterozygous; all of the 30 F1 strawberries with γ-decanolide content greater than 30µg / kg were homozygous. Therefore, the accuracy of identifying the γ-decanolide content trait based on the genotype of Marker960055 is 95%. The homozygous genotype of Marker960055 is GG, and the genotype of Marker960055 is GG, which means that Marker960055 is homozygous for G; the heterozygous genotype of Marker960055 is CG, and the genotype of Marker960055 is CG, which means that Marker960055 is heterozygous for CG.
[0047] For marker Marker960072, 26 of the 30 F1 strawberries with γ-decanolide content of 0.00µg / kg were heterozygous; all of the 30 F1 strawberries with γ-decanolide content greater than 30µg / kg were homozygous. Therefore, the accuracy of identifying the γ-decanolide content trait according to the genotype of Marker960072 was 93.33%. The homozygous genotype of Marker960072 is TT, and the genotype of Marker960072 is TT, which means that Marker960072 is homozygous for T; the heterozygous genotype of Marker960072 is AT, and the genotype of Marker960072 is AT, which means that Marker960072 is heterozygous for AT.
[0048] The experimental results showed (Table 4) that when the genotypes of the three SNPs Marker959933, Marker960055 and Marker960072 in the F1 generation strawberries were homozygous CC / GG / TT, the γ-decanolide content in the F1 generation strawberries was not 0, and the γ-decanolide content was above 30µg / kg.
[0049] The γ-decanolactone content in the F1 generation strawberries with at least two SNP genotypes as heterozygous genotypes was 0.00µg / kg, and the γ-decanolactone content in the F1 generation strawberries with at least two SNP genotypes as homozygous genotypes was not 0, and the γ-decanolactone content was above 30µg / kg, indicating that among the three SNPs Marker959933, Marker960055 and Marker960072, the γ-decanolactone content in the F1 generation strawberries with at least two SNP genotypes as heterozygous genotypes was significantly lower than the γ-decanolactone content in the F1 generation strawberries with all three SNP genotypes as homozygous genotypes.
[0050] In summary, the above markers are closely linked to the γ-decanolide content trait of strawberry fruit, can be used to identify the γ-decanolide content in the strawberry breeding process, and can be directly used in molecular marker-assisted selection breeding.
[0051] Table 4 Linked marker genotyping results
[0052]
[0053] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.
Claims
1. Application of a substance for detecting SNP in a strawberry genome, characterized in that: The SNPs are Marker959933, Marker960055 and Marker960072; Marker959933 is a SNP in the strawberry genome, which is the 29084958th nucleotide of the Fvb3-2 chromosome, which is C or G; Marker960055 is a SNP in the strawberry genome, which is the 29107970th nucleotide of the Fvb3-2 chromosome, which is C or G; Marker960072 is a SNP in the strawberry genome, which is the 29109249th nucleotide of the Fvb3-2 chromosome, which is A or T; the application is for identifying or assisting in identifying the γ-decalactone content of strawberries and / or strawberry breeding.
2. The use of the substance for detecting SNP in the strawberry genome according to claim 1, characterized in that: The substance is a primer composition for amplifying a strawberry genomic DNA fragment including the SNP site, a PCR reagent containing the primer composition, and / or a kit containing the primer composition or the PCR reagent.
3. The use of the substance for detecting SNP in the strawberry genome according to claim 2, characterized in that: The primer composition consists of a Marker959933 primer pair, a Marker960055 primer pair and / or a Marker960072 primer pair; the Marker959933 primer pair consists of the single-stranded DNA of sequence 1 in the sequence list and sequence 2 in the sequence list, the Marker960055 primer pair consists of the single-stranded DNA of sequence 3 in the sequence list and sequence 4 in the sequence list, and the Marker960072 primer pair consists of the single-stranded DNA of sequence 5 in the sequence list and sequence 6 in the sequence list.
4. A method for identifying or assisting in identifying the content of γ-decanolide in strawberries, characterized in that: The method comprises detecting the genotype of the SNP according to claim 1 in the genome of the strawberry to be tested, and identifying or assisting in identifying the content of γ-decalactone in the strawberry according to the genotype.
5. Application of the method for identifying or assisting in identifying the content of γ-decanolide in strawberry in strawberry breeding, characterized in that: The method is the method described in claim 4.
6. A method for strawberry breeding, characterized in that: The method comprises detecting the genotypes of Marker959933, Marker960055 and Marker960072 in claim 1 in the strawberry genome, and selecting strawberries whose genotype of Marker959933 is CC, whose genotype of Marker960055 is GG and whose genotype of Marker960072 is TT as parents for breeding.
7. A primer composition for detecting the polymorphism or genotype of a SNP site in a strawberry genome, characterized in that: The primer composition consists of a Marker959933 primer pair, a Marker960055 primer pair and / or a Marker960072 primer pair; the Marker959933 primer pair consists of the single-stranded DNA of sequence 1 in the sequence list and sequence 2 in the sequence list, the Marker960055 primer pair consists of the single-stranded DNA of sequence 3 in the sequence list and sequence 4 in the sequence list, and the Marker960072 primer pair consists of the single-stranded DNA of sequence 5 in the sequence list and sequence 6 in the sequence list.
8. A PCR reagent comprising the primer combination for detecting the polymorphism or genotype of a SNP site in a strawberry genome according to claim 7.
9. A kit comprising the PCR reagent for detecting the polymorphism or genotype of a SNP site in a strawberry genome as claimed in claim 8.
10. A nucleic acid molecule, characterized in that The nucleotide sequence of the nucleic acid molecule is sequence 7, sequence 8 and / or sequence 9 in the sequence listing.