Indel molecular marker linked with NWB-CMS fertility restoring gene of radish and application

Abstract

The invention belongs to the technical field of biology, and particularly relates to an indel molecular marker linked with a radish NWB cytoplasmic male sterility (NWB-CMS) fertility restoring gene and application. Comprising first to fourth Indel marks. The size of the first Indel marker is 156 bp or 150 bp, the size of the second Indel marker is 115 bp or 109 bp, the size of the third Indel marker is 179 bp or 171 bp, and the size of the fourth Indel marker is 106 bp or 90 bp. According to the invention, a locus for controlling NWB-CMS fertility recovery of radish is excavated, and a molecular marker related to the locus is developed, so that micro-powder and sterile plants can be identified and selected more quickly and accurately, and fertile plants can be effectively eliminated, thereby accelerating the breeding process and improving the breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an indel molecular marker linked to a radish NWB-CMS fertility restoration gene and an application thereof. Background Art

[0002] my country is the secondary origin center of radish (Raphanus sativus L.), with a long history of cultivation and diverse types. Radish is a cross-pollinated crop with obvious hybrid vigor. More than 90% of the main varieties on the market are hybrids. Male sterile lines are the main way to produce radish hybrid seeds. They have two obvious advantages. One is that they can improve the purity of hybrids, and the other is that they can avoid the loss of parents, thereby ensuring the interests of breeders. Ogura cytoplasmic male sterility (Ogura-CMS, OguraCytoplasmic Male Sterility) and NWB, cytoplasmic male sterility (NWB-CMS, NongWoo BioCytoplasmic Male Sterility) are currently the most widely used types of male sterility.

[0003] The NWB-CMS sterile source was discovered by South Korea's NongWoo Bio in 2003. This sterile source is significantly different from Ogura-CMS in terms of genetic pattern, abortion period, and abortion method. As a new sterile source, NWB-CMS has unique advantages compared to Ogura-CMS. First, because the abortion period of NWB-CMS is relatively late during the microspore period, its anthers are larger, the morphology of floral organs such as nectaries is close to that of fertile materials, there is almost no yellowing of flower buds, and the seed production yield is higher. Secondly, sterility is easier to maintain in East Asian long radishes, especially for breeding materials that cannot be converted to the Ogura male sterile line (such as Xinlimei radishes).

[0004] Mitochondrial genome sequencing revealed that NWB-CMS and another sterility source DCGMS (Dongbu cytoplasmic and genic male-sterility) are mitochondrial isomorphs, with only genomic subquantitative differences, and male sterility is controlled by the mitochondrial gene orf463. orf463 originated from European wild radish (Raphanus raphanistrum) and is widely present in black radish (R. sativus var. niger Kerner) subspecies. Fertility restoration of NWB-CMS is controlled by nuclear genes. Studies have shown that there are fewer restoration genes in East Asian long radish subspecies, while they are common in European cherry radish and black radish subspecies. Kim et al. (2010) and Li Xiaomei et al. (2021) both believed that at least three genes are involved in the fertility restoration of NWB-CMS (DCGMS). Rfd1 is the first identified DCGMS fertility restoration site, which contains 25 genes in an 83-kb positioning interval and is located on radish chromosome 6.

[0005] In the process of radish hybrid seed production, the female parent needs a male sterile line. The breeding process of male sterile lines requires continuous backcrossing between the maintainer line and the sterile source, so there should be no fertility restorer gene in the maintainer line. In the process of breeding male sterile lines, the use of molecular markers to assist in the selection of single plants without fertility restorer genes as maintainer lines will greatly improve the selection efficiency. However, there are few studies on NWB-CMS fertility restorer genes and related molecular markers. Summary of the invention

[0006] In order to solve the above problems existing in the prior art, the present invention provides an Indel molecular marker closely linked to the radish NWB-CMS fertility restorer gene, including a first Indel marker, a second Indel marker, a third Indel marker, and a fourth Indel marker, wherein:

[0007] The size of the first Indel marker is 156 bp, and its nucleotide sequence is shown in Sequence 1; or: the size of the first Indel marker is 150 bp, and its nucleotide sequence is shown in Sequence 2;

[0008] The size of the second Indel marker is 115 bp, and its nucleotide sequence is shown in Sequence 3; or: the size of the first Indel marker is 109 bp, and its nucleotide sequence is shown in Sequence 4;

[0009] The size of the third Indel marker is 179 bp, and its nucleotide sequence is shown in Sequence 5; or: the size of the third Indel marker is 171 bp, and its nucleotide sequence is shown in Sequence 6;

[0010] The size of the fourth Indel marker is 106 bp, and its nucleotide sequence is shown in Sequence 7; or: the size of the fourth Indel marker is 90 bp, and its nucleotide sequence is shown in Sequence 8.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] 1. The present invention has discovered the fertility restoration site controlling radish NWB-CMS and developed molecular markers related thereto, which can more quickly and accurately identify and select micro-pollen and sterile plants, effectively exclude fertile plants, thereby accelerating the breeding process and improving breeding efficiency.

[0013] 2. Since NWB-CMS has at least three pairs of fertility restorer genes, the efficiency of selecting maintainer lines using a single gene or molecular marker in the natural population of European radish is low. The molecular markers developed by the present invention can assist in tracking the fertility restorer gene Rfn4 site, so as to better screen and locate other fertility restorer gene sites, construct a fertility restorer gene molecular marker network, and optimize the NWB-CMS breeding system.

[0014] 3. The identification method of the present invention is simple to operate and saves resources; the various operation steps of the identification method work synergistically to achieve excellent results. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the ΔSNP / Indel-index distribution diagram of Example 1.

[0016] A: Comparison between fertile pool and sterile pool; B: Comparison between micronized pool and sterile pool; C: Comparison between fertile pool and micronized pool. The scatter plot is the original value, and the black curve is the window fitting value. 1000 permutation tests were performed randomly. The red line indicates the 99% confidence level, and the blue line indicates the 95% confidence level.

[0017] Figure 2 This is a schematic diagram of the InDel-marked genotype of the recombinant individual in the F2 population within the Rfn4 mapping interval of Example 1. The area between the dotted lines represents the fine interval for further gene mapping.

[0018] Figure 3 The electrophoresis diagram of the PCR amplification products of primers Rf-118, primers Rf-119, primers Rf-120, and primers Rf-122 in sterile plants, micro-powder plants, and fertile plants in Example 1. (In the electrophoresis bands of primers Rf-118, Rf-119, and Rf-120, the bands in lanes 1 and 2 are located upward because: the edge voltage of the electrophoresis tank is slightly lower than that in the middle, so the edge bands are higher) DETAILED DESCRIPTION

[0019] To make the technical solution, purpose and advantages of the present invention clearer, the present invention is further described in detail below through specific implementation examples. It should be understood that the specific implementation methods described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0020] In a first aspect, the present invention provides Indel molecular markers tightly linked to the radish NWB-CMS fertility restorer gene, including a first Indel marker (Rf-118), a second Indel marker (Rf-119), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122).

[0021] The size of the first Indel marker (Rf-118) is 156 bp, and its nucleotide sequence is shown in Sequence 1; or: its size is 150 bp, and its nucleotide sequence is shown in Sequence 2.

[0022] Sequence 1: Rf-118 (156 bp)

[0023]

[0024] Sequence 2: Rf-118 (150 bp)

[0025] AGTGACGTGGCACTCTCAAAGAAGAGAGTGCTTTTCTTTATATATAT

[0026] ATAGATATAAGAAGATGTAAATAAAAACGTTTGAAAATTAAAAATTACAT

[0027] ATCTTGAAATCCTACAATTAATTATTATATCATCAAATTTTGCCGACGATAAA.

[0028] The size of the second Indel marker (Rf-119) is 115 bp, and its nucleotide sequence is shown in Sequence 3; or: its size is 109 bp, and its nucleotide sequence is shown in Sequence 4.

[0029] Sequence 3: Rf-119 (115 bp)

[0030]

[0031] Sequence 4: Rf-119 (109 bp)

[0032] CCCGAGAAAGCCTAACTGCTATTAAAAAGATTTAGACAAATGGTAT

[0033] TTTACCTACACAGTGCTTAACTTTGGGTAAATATTTTACCTTTACCCTTGGCCTTTGTTCCTT.

[0034] The size of the third Indel marker (Rf-120) is 179 bp, and its nucleotide sequence is shown in Sequence 5; or: its size is 171 bp, and its nucleotide sequence is shown in Sequence 6.

[0035] Sequence 5: Rf-120 (179 bp)

[0036]

[0037] Sequence 6: Rf-120 (171 bp)

[0038] CCACATACAGATTAACAGTGCCCAATAAGTGTTTTATTCCATTTATA

[0039] AAAGTACTAAGTCTGATAGAAACAAATAGAACACCTTTCATTTCAAAATA

[0040] AACCCTATATCCAATCCCTACACCTAAATACTAAATCCTAACGAATTCTTAAACCAAAACCCAAAAGTGAAATCT.

[0041] The size of the fourth Indel marker (Rf-122) is 106 bp, and its nucleotide sequence is shown in Sequence 7; or: its size is 90 bp, and its nucleotide sequence is shown in Sequence 8.

[0042] Sequence 7: Rf-122 (106 bp)

[0043]

[0044] Sequence 8: Rf-122 (90 bp)

[0045] GGCATAGGTAGCAGGAGGCATAGTGTAACTAACTAGTGCCTTCTATTTTTTTTATAATTATGATAAGGTTGCGGTTTAGGGTTTTACGGA.

[0046] The first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) are all located within the range of 31.29 to 38.86 Mb of chromosome 4 of radish.

[0047] In a second aspect of the present invention, a primer set for identifying the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) is provided, comprising:

[0048] Primer set for identifying the first Indel marker (Rf-118):

[0049] Forward primer: 5′-AGTGACGTGGCACTCTCAAA-3′ (SEQ ID NO: 9);

[0050] Reverse primer: 5′-TTTATCGTCGGCAAAATTTGATGA-3′ (SEQ ID NO: 10);

[0051] Primer set for identification of the second Indel marker (Rf-119):

[0052] Forward primer: 5′-CCCGAGAAAGCCTAACTGCT-3′ (SEQ ID NO: 11);

[0053] Reverse primer: 5′-AAGGAACAAAGGCCAAGGGT-3′ (SEQ ID NO: 12);

[0054] Primer set for identification of the third Indel marker (Rf-120):

[0055] Forward primer: 5′-CCACATACAGATTAACAGTGCCC-3′ (SEQ ID NO: 13);

[0056] Reverse primer: 5′-AGATTTCACTTTTGGGTTTTGGTTT-3′ (SEQ ID NO: 14);

[0057] Primer set for identifying the fourth Indel marker (Rf-122):

[0058] Forward primer: 5′-GGCATAGGTAGCAGGAGGC-3′ (SEQ ID NO: 15);

[0059] Reverse primer: 5'-TCCGTAAAACCCTAAACCGCA-3' (SEQ ID NO: 16).

[0060] In a third aspect of the present invention, a kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene is provided, the kit comprising a primer set for identifying at least one of the primer sets of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) provided in the second aspect of the present invention.

[0061] According to the third aspect of the present invention, the kit may further include at least one of a PCR amplification buffer, dNTPs, and Taq enzyme.

[0062] In a fourth aspect, the present invention provides a method for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene, the method comprising the operation of identifying at least one of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) that are closely linked to the radish NWB-CMS fertility restorer gene.

[0063] According to a fourth aspect of the present invention, the method comprises the operation of identifying any of the following markers / marker combinations:

[0064] Any one of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), or the fourth Indel marker (Rf-122);

[0065] A first Indel marker (Rf-118) and a second Indel marker (Rf-119), or a first Indel marker (Rf-118) and a third Indel marker (Rf-120), or a first Indel marker (Rf-118) and a fourth Indel marker (Rf-122), or a second Indel marker (Rf-119) and a third Indel marker (Rf-120), or a second Indel marker (Rf-119) and a fourth Indel marker (Rf-122), or a third Indel marker (Rf-120) or a fourth Indel marker (Rf-122);

[0066] A first Indel marker (Rf-118), a second Indel marker (Rf-119), and a third Indel marker (Rf-120), or a first Indel marker (Rf-118), a second Indel marker (Rf-119), and a fourth Indel marker (Rf-122), or a first Indel marker (Rf-118), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122); or a second Indel marker (Rf-119), a third Indel marker (Rf-120), and a fourth Indel marker (Rf-122);

[0067] The first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120) and the fourth Indel marker (Rf-122).

[0068] According to the fourth aspect of the present invention, the method may include using a primer set provided in the second aspect of the present invention for identifying at least one of the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122), performing a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification product.

[0069] According to the fourth aspect of the present invention, the method may include using the kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene provided by the third aspect of the present invention, performing a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification product.

[0070] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification product may include: performing electrophoresis (such as polyacrylamide gel electrophoresis) on the PCR amplification product and then detecting and analyzing the electrophoresis bands; or sequencing the PCR amplification product.

[0071] As a preferred embodiment, the reaction system (20 μL) of the above-mentioned PCR amplification reaction includes: 2 μL of radish genomic DNA (40 ng), 2 μL of 10×PCR Buffer (containing MgCl2), 0.5 μL of each upstream and downstream primers (10 μM), 1.6 μL of dNTPs (10 mM), 0.5 μL of Taq enzyme (2.0 U / μL), and 12.9 μL of ddH2O.

[0072] As a preferred embodiment, the PCR amplification program is: 94°C, 4 min; 94°C 20 s, 60°C 20 s, 72°C 30 s, a total of 35 cycles; 72°C, 10 min; and stored at 4°C.

[0073] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification product may include at least one of the following four PCR amplification results:

[0074] The primer set used to amplify the first Indel marker (Rf-118) amplified only a 156 bp band;

[0075] The primer set used to amplify the second Indel marker (Rf-119) amplified only a 115 bp band;

[0076] The primer set used to amplify the third Indel marker (Rf-120) amplified only a 179 bp band;

[0077] The primer set used to amplify the fourth Indel marker (Rf-122) amplified only a 106 bp band;

[0078] The radish genome does not contain a fertility restoration gene, and the radish is a micro-pollen plant or a sterile plant, which can be used for the selection and breeding of male sterile lines and hybrid breeding.

[0079] In a fifth aspect, the present invention provides an Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene provided by the first aspect of the present invention, and / or the primer set for identifying the first Indel marker (Rf-118), the second Indel marker (Rf-119), the third Indel marker (Rf-120), and the fourth Indel marker (Rf-122) provided by the second aspect of the present invention, and / or the kit for identifying / assisting identification of radish NWB-CMS fertility restorer provided by the third aspect of the present invention, and / or the method for identifying / assisting identification of radish NWB-CMS fertility restorer gene provided by the fourth aspect of the present invention, and use thereof in identification / assisting identification of radish NWB-CMS fertility restorer gene, in radish breeding / assisting breeding, and in assisting tracking of radish fertility restorer gene loci.

[0080] The various reagents, materials, etc. used in the following examples, unless otherwise specified, are all products that can be obtained from commercial channels; the various tests and detection methods used in the following examples, unless otherwise specified, are all conventional tests and detection methods in the art and can be obtained from textbooks, reference books or academic journals.

[0081] The radish varieties YB-A, YB-B, Shinong 301, KP, Red Price, Red Baron, Snow Belle, Red King, Vyurtcburgskii, Ldinka Skvirska, Tashkentsky, Ledianaya, Earliest Scarlet White, Icicle Short Top, No.8891, and GiSi used in Examples 1 to 4 are now stored in the Germplasm Resource Bank of the Vegetable Research Institute of Beijing Academy of Agriculture and Forestry Sciences (contact number 010-81127153). For the purpose of implementing the technical solution of the present invention, anyone can contact our unit to obtain the above-mentioned plant varieties within the validity period of the patent right from the application date of the present invention.

[0082] Example 1 Acquisition of molecular markers

[0083] This embodiment is used to describe the acquisition of the first to fourth Indel markers.

[0084] 1. Construction of genetic population

[0085] The maternal NWB cytoplasmic sterile line YB-A and the paternal European cherry radish high-generation inbred line variety KP were hybridized to obtain the offspring F1 population. The fertile progeny of the offspring F1 were self-pollinated to obtain the F2 population (n=335). The fertile plants in the F2 population were then backcrossed with the maternal sterile line YB-A to obtain F2BC1 families (10-20 plants in each family), which were used to determine the genotype of the individual plants in the F2 population and the location of the restored gene.

[0086] After vernalization of all populations in the seedling stage, they were planted in the greenhouse of Sijiqing Farm of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences in April 2023, and three fertility surveys were conducted at the early flowering period, peak flowering period and late flowering period.

[0087] The maternal NWB cytoplasmic sterile line YB-A was developed by continuous backcrossing (9 generations) between YB-B (Yangzhou round white inbred line) and the sterile source "Shinong 301".

[0088] 2. Analysis of genetic pattern of fertility restoration in NWB-CMS

[0089] The results of the fertility survey showed that there were fertile plants (shown by visible pollen on anthers, abundant pollen, and light yellow), sterile plants (small and shriveled anthers, no visible pollen on anthers), and trace pollen plants (i.e., "micro-pollen plants", with a small amount of visible pollen on anthers, dry pollen aggregated into clumps, and no seeds produced by self-pollination or test crosses during the flowering period) in the F2 population. There were 238 fertile plants, 68 trace pollen plants, and 29 sterile plants in the F2 population. The segregation ratio of individual plants did not conform to the classic Mendelian inheritance law, indicating that its fertility restoration inheritance pattern was complex and may be controlled by major effect restoration genes and minor effect genes, or there was a gene interaction effect.

[0090] 3. Preliminary positioning of NWB-CMS fertility restorer genes

[0091] 1. Use the CTAB method to extract the total DNA of the F2 population.

[0092] 2. From the 335 F2 populations, 23 fertile plants, 23 trace pollen plants, and 23 sterile plants were selected, and their DNAs were mixed in equal amounts to construct the following three extreme pools: fertile pool (F_pool), trace pollen pool (SW_pool), and sterile pool (S_pool).

[0093] 2. The parental and extreme pool DNA were sent to Tianjin Jizhi Gene Technology Co., Ltd. for double-end 150bp sequencing using an Illumina HiSeq2000 sequencer. The sequencing depth of each extreme pool was 40×, and the sequencing depth of the parent was 20×.

[0094] 3. QTL-seq analysis was performed using cherry radish “ROD” as the reference genome (Takagi et al., 2013). The alignment rates of the three extreme pools were 94.93%, 95.02%, and 94.88%, respectively, and the average sequencing depths were 49.92×, 43.15×, and 43.83×, respectively.

[0095] 4. Use Sentieon software to detect SNPs and InDels, filter and select polymorphic markers, calculate the SNP / Indel-index of the progeny pool at these marker sites and the ΔSNP / Indel-index between the progeny pools. Select the sites with SNP / Indel index>0.3 in the progeny pool for further calculation, and use a sliding window to fit the calculated SNP / Indel-index and ΔSNP / Indel-index. The sliding window size is 1Kb and the step size is 0.1Kb. Select the window larger than the threshold at a 95% confidence level as the candidate interval.

[0096] The results show that Figure 1As shown in Table 1, at the 95% confidence level, QTL-seq analysis of the fertile pool and the sterile pool located the fertility restorer gene within the range of 32.5-33.7 Mb (Rfn1.1) on chromosome 1; QTL-seq analysis of the pollen pool and the sterile pool located the fertility restorer gene within the range of 32.5-33.7 Mb (Rfn1.1) on chromosome 1 and 12.2-13.3 Mb (Rfn9.1) on chromosome 9; QTL-seq analysis of the fertile pool and the pollen pool located the fertility restorer gene within the range of 16.7-18.6 Mb (Rfn4.1), 31.9-33.1 Mb (Rfn4.2), and 34.3-37.9 Mb (Rfn4.3) on chromosome 4.

[0097] Table 1: Initial location interval of NWB-CMS fertility restoration gene and gene statistics within the interval

[0098]

[0099] IV. Analysis of Rfn4 loci in fertility restoration of NWB-CMS

[0100] The present invention only further analyzes the Rfn4 locus. According to the genome resequencing information of the parents YB-A and KP, the InDel locus was screened in the 16.11-40.48Mb interval of radish chromosome 4 to develop primers, and used for genotyping of individual plants in the F2 population (n=335) of YB-A×KP. According to the exchanged individual plant information, the Rfn4 locus was located between the Rf-1 and Rf-10 molecular markers, with a physical interval of 31.29-38.86Mb ( Figure 2 ). It is worth noting that no recombinant strains were detected within 7.57Mb using the F2 population containing 335 strains. We speculate that structural variations such as chromosomal inversion and large segment duplication may exist in this interval.

[0101] Then the inventors used pan-genome data to analyze the linear relationship of different genomes in this interval (Table 2). The results showed that the Rfn4.1, Rfn4.2 and Rfn4.3 loci of chromosome 4 identified by the ROD genome were in the same interval in the WK10039 genome, and in the XYB36-2 genome, Rfn4.2 and Rfn4.3 were in the same interval, indicating that these three intervals may be large-segment chromosome duplications. In addition, the positions of the Rfn4.2 and Rfn4.3 loci in the ROD genome are reversed in the R03, RS04, RS05 and RS06 genomes, suggesting that there may be a chromosome fragment inversion here. This result explains the problem that there is no recombinant single plant in the 31.29-38.86Mb interval of the Rfn4 locus.

[0102] Table 2: Linear alignment of NWB-CMS fertility restorer gene QTL regions in different genomes

[0103] Genome Rfn4.1 locus Rfn4.2 locus Rfn4.3 locus ROD 15.4-18.7Mb 31.9-33.1Mb 34.2-37.9Mb RS03 15.9-19.0Mb 35.6-36.5Mb 33.2-34.5Mb RS04 16.0-19.4Mb 35.2-36.1Mb 32.7-33.7Mb RS05 16.4-19.8Mb 36.3-37.2Mb 33.4-35.2Mb RS06 16.0-19.2Mb 35.9-36.4Mb 33.4-34.4Mb WK10039 18.7-23.7Mb 29.0-29.2Mb 19.1-23.7Mb XYB36-2 16.0-21.1Mb 25.2-27.6Mb 25.4-26.5Mb

[0104] 5. Screening and obtaining Indel molecular markers and primers

[0105] The genomic DNA of young leaves of different radish genetic materials in the F2 population was extracted using the modified CTAB method (Aboul-Maaty, N.AF., Oraby, H.AS. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull Natl Res Cent 43, 25 (2019). https: / / doi.org / 10.1186 / s42269-019-0066-1), and the whole genomic DNA was dissolved using ddH2O.

[0106] 1. Within the range of 16.7-18.6 Mb (Rfn4.1), 31.9-33.1 Mb (Rfn4.2), and 34.3-37.9 Mb (Rfn4.3) on chromosome 4, the following 15 pairs of primers were designed to detect polymorphic Indel sites closely linked to the NWB-CMS fertility restorer gene, as shown in Table 3.

[0107] Table 3: 15 pairs of primers for Indel markers

[0108] mark Location Forward Primer Reverse primer Rf-117 16109162 TCTCGCGGATGTAGTAAGCT TTACGTGCCAATTATGTAGGAGAA Rf-6 17270936 GCCACTATCACAATACTAGCATGA ACTTGATTCTTGCAGAGTGATTGA Rf-8 18574289 ACGCATTTTCGATGTGTGTACA TGAGGGATATGATCTGCATTGTCA Rf-113 19086196 TCTGGTCCAAGTCAGGAGGA GGGGAGTGACAAGAACCTGA Rf-1 31297167 CCACCTGTCTCGTTGAAGGA TCTCAAGTCTGATTCCCCGC Rf-120 33851811 CCACATACAGATTAACAGTGCCC AGATTTCACTTTTGGGTTTTGGTTT Rf-119 34029651 CCCGAGAAAGCCTAACTGCT AAGGAACAAAGGCCAAGGGT Rf-122 37683242 GGCATAGGTAGCAGGAGGC TCCGTAAAACCCTAAACCGCA Rf-118 38202091 AGTGACGTGGCACTCTCAAA TTTATCGTCGGCAAAATTTGATGA Rf-10 38864737 CTTTGCGCGGGTCTTTCAAA ACACCTTGTGACTGAAGAGGA Rf-11 39147363 TCCAATATATAATGGCTTTTGTGCAAA TGAGATCGGCGGAAGACTTG Rf-14 40214027 AAACTTACTTGTGTCGGAGATCC CCTTCTAGAACATTTACTCTCCAGGT Rf-16 42080242 GCCAAGACACAGTACGGTCA CGAGTCAGGAAGCTGGTCAT Rf-128 42368813 ACATCTCTGGGGAAAAAGCTTT GCTATAGTCCCCGCATCAAGT Rf-131 42586659 TGTTTTACCGTTACATTCAGTTTCAGT CCAAAAGCCTATTCAACACTCGT

[0109] 2. Extract genomic DNA from the above-mentioned parents and offspring F2 population, and perform PCR amplification reaction using the above 15 pairs of primers.

[0110] The PCR amplification reaction system (20 μL) included: 2 μL of radish genomic DNA (40 ng), 2 μL of 10×PCR Buffer (containing MgCl2), 0.5 μL of each upstream and downstream primers (10 μM), 1.6 μL of dNTPs (10 mM), 0.5 μL of Taq enzyme (2.0 U / μL), and 12.9 μL of ddH2O.

[0111] The PCR amplification program was as follows (MyCycler, Bio-Rad Laboratories, USA): 94°C, 4 min; 35 cycles (94°C, 20 s; 60°C, 20 s; 72°C, 30 s); 72°C, 10 min; and storage at 4°C.

[0112] 3. The PCR amplification products were subjected to 8% polyacrylamide gel electrophoresis at 160V constant power for 1.5h. After silver staining, the band types were counted under a film observation lamp.

[0113] 4. Statistical analysis of electrophoresis band patterns

[0114] like Figure 3 As shown, the Rf-118, Rf-119, Rf-120 and Rf-122 markers within the Rfn4 locus gave consistent genotyping results for individual plants in the F2 population, so any pair of these four pairs of primers can be selected to detect the presence of the NWB-CMS fertility restorer gene in the material.

[0115] (1) The electrophoresis results of the PCR products of primer Rf-118 showed that the genotypes of the sterile plants in the F2 population were: homozygous 156bp / 156bp band (only 156bp band was visible), homozygous 150bp / 150bp band (only 150bp band was visible), and heterozygous 156bp / 150bp band (two bands of 150bp and 156bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 156bp / 156bp band (only 156bp band was visible), homozygous 150bp / 150bp band (only 150bp band was visible), and heterozygous 156bp / 150bp band (two bands of 150bp and 156bp were visible). The electrophoresis bands of the fertile strains include: homozygous 150bp / 150bp band (only 150bp band is visible), heterozygous 156bp / 150bp band (2 bands of 150bp and 156bp are visible). It can be seen that the electrophoresis bands of the fertile strains do not include the homozygous 156bp / 156bp band (only 156bp band is visible). Therefore, it can be inferred from the above that although the electrophoresis bands of sterile plants and micro-pollen plants may have the homozygous 156bp / 156bp band (only the 156bp band is visible), the homozygous 150bp / 150bp band (only the 150bp band is visible), and the heterozygous 156bp / 150bp band (two bands of 150bp and 156bp are visible), but if the electrophoresis band is only the homozygous 156bp / 156bp band (only the 156bp band is visible), then the sample can only be a sterile plant or a micro-pollen plant, and cannot be a fertile plant. That is: if the electrophoresis result of the sample only has the homozygous 156bp / 156bp band (only the 156bp band is visible), it can be determined that the genome of the sample does not contain the fertility restoration gene, and the sample is a sterile plant or a micro-pollen plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0116] (2) The electrophoresis results of the PCR products of primer Rf-119 showed that the genotypes of the sterile plants in the F2 population were: homozygous 115bp / 115bp band (only 115bp band was visible), homozygous 109bp / 109bp band (only 109bp band was visible), and heterozygous 115bp / 109bp band (two bands of 109bp and 115bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 115bp / 115bp band (only 115bp band was visible), homozygous 109bp / 109bp band (only 109bp band was visible), and heterozygous 115bp / 109bp band (two bands of 109bp and 115bp were visible). The electrophoresis bands of the fertile strains include: homozygous 109bp / 109bp band (only 109bp band is visible), heterozygous 115bp / 109bp band (2 bands of 109bp and 115bp are visible). It can be seen that the electrophoresis bands of the fertile strains do not include the homozygous 115bp / 115bp band (only 115bp band is visible). Therefore, it can be inferred from the above that although the electrophoresis bands of sterile plants and micro-pollen plants may have the homozygous 115bp / 115bp band (only the 115bp band is visible), the homozygous 109bp / 109bp band (only the 109bp band is visible), and the heterozygous 115bp / 109bp band (two bands of 109bp and 115bp are visible), but if the electrophoresis band is only the homozygous 115bp / 115bp band (only the 115bp band is visible), then the sample can only be a sterile plant or a micro-pollen plant, and cannot be a fertile plant. That is: if the electrophoresis result of the sample only has the homozygous 115bp / 115bp band (only the 115bp band is visible), it can be determined that the genome of the sample does not contain the fertility restoration gene, and the sample is a sterile plant or a micro-pollen plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0117] (3) The electrophoresis results of the PCR products of primer Rf-120 showed that the genotypes of the sterile plants in the F2 population were: homozygous 179bp / 179bp band (only 179bp band was visible), homozygous 171bp / 171bp band (only 171bp band was visible), and heterozygous 179bp / 171bp band (two bands of 171bp and 179bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 179bp / 179bp band (only 179bp band was visible), homozygous 171bp / 171bp band (only 171bp band was visible), and heterozygous 179bp / 171bp band (two bands of 171bp and 179bp were visible). The electrophoresis bands of the fertile strains include: homozygous 171bp / 171bp band (only 171bp band is visible), heterozygous 179bp / 171bp band (2 bands of 171bp and 179bp are visible). It can be seen that the electrophoresis bands of the fertile strains do not include the homozygous 179bp / 179bp band (only 179bp band is visible). Therefore, it can be inferred from the above that although the electrophoresis bands of sterile plants and micro-pollen plants may have the homozygous 179bp / 179bp band (only the 179bp band is visible), the homozygous 171bp / 171bp band (only the 171bp band is visible), and the heterozygous 179bp / 171bp (two bands of 171bp and 179bp are visible) bands, if the electrophoresis band is only the homozygous 179bp / 179bp band (only the 179bp band is visible), then the sample can only be a sterile plant or a micro-pollen plant, and cannot be a fertile plant. That is: if the electrophoresis result of the sample only has the homozygous 179bp / 179bp band (only the 179bp band is visible), it can be determined that the genome of the sample does not contain the fertility restoration gene, and the sample is a sterile plant or a micro-pollen plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0118] (4) For the electrophoresis results of the PCR products of primer Rf-122, the genotypes of the sterile plants in the F2 population were: homozygous 106bp / 106bp band (only 106bp band was visible), homozygous 90bp / 90bp band (only 90bp band was visible), and heterozygous 106bp / 90bp band (two bands of 90bp and 106bp were visible). The electrophoresis bands of the micropowder strains included: homozygous 106bp / 106bp band (only 106bp band was visible), homozygous 90bp / 90bp band (only 90bp band was visible), and heterozygous 106bp / 90bp band (two bands of 90bp and 106bp were visible). The electrophoresis bands of the fertile strains include: homozygous 90bp / 90bp band (only 90bp band is visible), heterozygous 106bp / 90bp band (2 bands of 90bp and 106bp are visible). It can be seen that the electrophoresis bands of the fertile strains do not include the homozygous 106bp / 106bp band (only 106bp band is visible). Therefore, it can be inferred from the above that although the electrophoresis bands of sterile plants and micro-pollen plants may have the homozygous 106bp / 106bp band (only the 106bp band is visible), the homozygous 90bp / 90bp band (only the 90bp band is visible), and the heterozygous 106bp / 90bp band (two bands of 90bp and 106bp are visible), but if the electrophoresis band is only the homozygous 106bp / 106bp band (only the 106bp band is visible), then the sample can only be a sterile plant or a micro-pollen plant, and cannot be a fertile plant. That is: if the electrophoresis result of the sample only has the homozygous 106bp / 106bp band (only the 106bp band is visible), it can be determined that the genome of the sample does not contain the fertility restoration gene, and the sample is a sterile plant or a micro-pollen plant, which can be used for molecular marker-assisted breeding of male sterile lines.

[0119] Example 2 Identification of Radish Male Sterile Lines by Molecular Marker-Assisted Breeding

[0120] This example is used to illustrate the practical application of using Rf-118, Rf-119, Rf-120, and Rf-122 markers in identifying / assisting in identifying radish male sterile lines.

[0121] In order to cultivate radish male sterile lines, YB-A was used as the female parent and cherry radish material Red Price was used as the male parent to obtain F1, and then self-pollinated to obtain F2.

[0122] S1: 100 F2 generation radish seed samples were selected and sown in plug trays. Leaves of radish seedlings were collected and genomic DNA of each radish plant was extracted according to the method of Example 1.

[0123] S2: Using the above primer sets for amplifying Rf-118, Rf-119, Rf-120, and Rf-122 markers, respectively, with each radish genome as a template, perform PCR amplification reaction according to the PCR amplification reaction system and procedure of Example 1 to obtain the PCR amplification products of each individual plant.

[0124] S3: The above PCR amplification products were subjected to 8% polyacrylamide gel electrophoresis at 160V constant power for 1.5h, and then silver-stained.

[0125] S4: Detect the electrophoresis bands under the film observation light and perform band type statistics (Table 4). The results showed that among the 96 samples, 12 samples (R3, R10, R16, R27, R34, R38, R48, R49, R50, R67, R70, R86) only amplified a 156 bp band with the Rf-118 primer, a 115 bp band with the Rf-119 primer, a 179 bp band with the Rf-120 primer, and a 106 bp band with the Rf-122 primer.

[0126] S5: The 12 seedlings were planted in the test field. After the radish bloomed, the fertility of the plants was investigated. The results showed that 8 of them (R10, R16, R34, R38, R48, R49, R67, and R86) were micro-pollen plants, 4 plants (R3, R27, R50, and R70) were sterile plants, and no fertile plants appeared. This indicates that the method provided by the present invention can accurately identify the radish NWB cytoplasmic male sterile line, and the method can be applied to the molecular marker-assisted breeding of radish in NWB-CMS fertility restoration.

[0127] Table 4: Genotype identification of F2 population Rf-118, 119, 120, 122 of YB-A and cherry radish material Red Price and fertility results of single plant that can only amplify 156bp

[0128]

[0129]

[0130]

[0131]

[0132] Example 3 Molecular marker-assisted breeding of radish NWB-CMS maintainer line

[0133] This example is used to illustrate the application of Rf-118, 119, 120 or 122 molecular markers in marker-assisted breeding of radish NWB-CMS maintainer lines.

[0134] The genotype of the sterile line of NWB-CMS is: the cytoplasm is sterile (containing the mitochondrial sterility gene orf463a), and the nucleus does not contain the restorer gene; the genotype of the maintainer line is: the cytoplasm is normal fertile (does not contain the mitochondrial sterility gene orf463a), and the nucleus does not contain the restorer gene. In breeding, it is necessary to select a suitable maintainer line for the conversion of male sterile lines.

[0135] Test materials: 105 individual plants of 10 cherry radish varieties, each material containing 10-15 plants (see Table 5 for details).

[0136] S1: First, the cytoplasm of the test material was identified. For details, please refer to “Wang YP, Wang QB, Hao W, LJX, Qi MX, Zhang L (2020) Mitochondrial genome sequencing reveals orf463a may induce male sterility in NWB cytoplasm of radish. Genes 11(1): 74” for the identification of the NWB-CMS cytoplasmic sterility gene orf463a.

[0137] The identification results are as follows: the cytoplasmic mitochondrial genome of variety PI262947 contains the orf463a gene, while the cytoplasmic mitochondrial genomes of other varieties do not contain the orf463a gene.

[0138] S2: According to the identification result of orf463a gene, select the individual plant that does not contain orf463a gene, refer to the method in Example 1, and use Rf-118, 119, 120 or 122 molecular markers to identify the genotype of nuclear fertility restoration gene (results are shown in Tables 5 to 8).

[0139] The identification results are as shown in Tables 5 to 8. For the three strains of variety PI601000 and the ten strains of variety PI262944, PCR amplification with primer Rf-118 only obtained a target band of 156 bp, PCR amplification with primer Rf-119 only obtained a target band of 115 bp, PCR amplification with primer Rf-120 only obtained a target band of 179 bp, and PCR amplification with primer Rf-122 only obtained a target band of 106 bp.

[0140] S3: According to the typing results of molecular markers, select the individual plants in PI601000 and PI262944 that only obtained a 156bp band by PCR amplification with primer Rf-118, only obtained a 115bp target band by PCR amplification with primer Rf-119, only obtained a 179bp target band by PCR amplification with primer Rf-120, and only obtained a 106bp target band by PCR amplification with primer Rf-122, respectively, hybridize them with the sterile line YB-A, and perform backcrossing for 6-7 consecutive generations to obtain radish sterile lines and corresponding maintainer lines with consistent genetic background and stable inheritance.

[0141] Table 5: Genotype detection results of cytoplasmic sterility gene orf463a and fertility restoration gene molecular marker Rf-118 of the tested materials

[0142]

[0143] Table 6: Genotype detection results of cytoplasmic sterility gene orf463a and fertility restoration gene molecular marker Rf-119 of the tested materials

[0144]

[0145] Table 7: Genotype detection results of cytoplasmic sterility gene orf463a and fertility restoration gene molecular marker Rf-120 of the tested materials

[0146]

[0147] Table 8: Genotype detection results of cytoplasmic sterility gene orf463a and fertility restoration gene molecular marker Rf-122 of the tested materials

[0148]

[0149]

[0150] Example 4 Molecular markers can assist in tracking the fertility restorer gene Rfn4 locus

[0151] This example is used to illustrate the application of Rf-118, Rf-119, Rf-120, and Rf-122 molecular markers in assisting the tracking of the fertility restorer gene Rfn4 locus.

[0152] Since NWB-CMS has multiple pairs of fertility restorer genes, especially in European cherry radish, a single material often has more than two pairs of fertility restorer genes. In order to locate and clone the fertility restorer genes, it is necessary to separate different fertility restorer genes into different radish materials to facilitate the cloning of single genes and avoid the influence of multiple genes on fertility identification.

[0153] The Rfn4 locus discovered in the present invention is an important NWB-CMS fertility restoration locus, and the developed molecular marker can be used to track the fertility restoration gene Rfn4 locus and to separate it from other restoration genes.

[0154] The test material was the cherry radish variety GiSi, which was crossed with the sterile line YB-A to obtain F1. The F1 was self-pollinated to obtain the F2 population. Fertility investigation showed that this variety had two pairs of fertility restoration genes.

[0155] S1: Referring to the method in Example 1, the genotypes of the individual plants in the F2 population were identified using molecular markers Rf-118, Rf-119, Rf-120, and Rf-122, respectively. The PCR amplification product of the selected primer Rf-118 was only a 156bp band, the PCR amplification product of the primer Rf-119 was only a 115bp band, the PCR amplification product of the primer Rf-120 was only a 179bp band, and the PCR amplification product of the primer Rf-122 was only a 106bp band, but in fact the plant fertility showed a fertile individual plant GiSi-6. This indicates that the individual plant does not contain the restorer gene of the Rfn4 site, but contains other fertility restorer genes.

[0156] S2: The single plant was used for three consecutive self-pollination generations to obtain the fertility-stable inbred line GiSi-6-4-2-2.

[0157] S3: The sterile line YB-A was used as the female parent and the inbred line GiSi-6-4-2-2 was used as the male parent to obtain F1. The F2 population was obtained after self-pollination of F1. The fertility survey showed that there were 132 fertile plants and 41 sterile plants, with a segregation ratio of 3:1, which was consistent with the genetic pattern of single gene inheritance, and the gene was a restoration gene different from the Rfn4 locus.

[0158] S4: Conventional gene localization methods can be used to locate new fertility restorer genes.

[0159] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Indel molecular markers closely linked to the radish NWB-CMS fertility restoration gene, including the first Indel marker, the second Indel marker, the third Indel marker, and the fourth Indel marker; The size of the first Indel marker is 156 bp, and its nucleotide sequence is shown in Sequence 1; or: the size of the first Indel marker is 150 bp, and its nucleotide sequence is shown in Sequence 2; The size of the second Indel marker is 115 bp, and its nucleotide sequence is shown in Sequence 3; or: the size of the first Indel marker is 109 bp, and its nucleotide sequence is shown in Sequence 4; The size of the third Indel marker is 179 bp, and its nucleotide sequence is shown in Sequence 5; or: the size of the third Indel marker is 171 bp, and its nucleotide sequence is shown in Sequence 6; The size of the fourth Indel marker is 106 bp, and its nucleotide sequence is shown in Sequence 7; or: the size of the fourth Indel marker is 90 bp, and its nucleotide sequence is shown in Sequence 8.

2. The Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene according to claim 1, characterized in that: The first Indel marker, the second Indel marker, the third Indel marker and the fourth Indel marker are all located within the range of 31.29 to 38.86 Mb of chromosome 4 of radish.

3. A primer set for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene Indel molecular marker, characterized in that: The primer set is used to identify the first Indel marker, the second Indel marker, the third Indel marker, and the fourth Indel marker according to claim 1.

4. The primer set for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene Indel molecular marker according to claim 3, characterized in that: The primer set for identifying the first Indel marker includes: Forward primer: 5′-AGTGACGTGGCACTCTCAAA-3′; Reverse primer: 5′-TTTATCGTCGGCAAAATTTGATGA-3′; The primer set used to identify the second Indel marker includes: Forward primer: 5′-CCCGAGAAAGCCTAACTGCT-3′; Reverse primer: 5′-AAGGAACAAAGGCCAAGGGT-3′; The primer set for identifying the third Indel marker includes: Forward primer: 5′-CCACATACAGATTAACAGTGCCC-3′; Reverse primer: 5′-AGATTTCACTTTTGGGTTTTGGTTT-3′; The primer set for identifying the fourth Indel marker includes: Forward primer: 5′-GGCATAGGTAGCAGGAGGC-3′; Reverse primer: 5′-TCCGTAAAACCCTAAACCGCA-3′.

5. A kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene, characterized in that: The kit comprises at least one of the primer sets for identifying the first Indel marker, the second Indel marker, the third Indel marker, and the fourth Indel marker according to claim 3 or 4.

6. The kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer gene according to claim 5, characterized in that: The kit further comprises at least one of a PCR amplification buffer, dNTPs and a Taq enzyme.

7. A method for identifying / assisting identification of radish NWB-CMS fertility restorer genes, characterized in that: The method comprises the operation of identifying at least one of the first Indel marker, the second Indel marker, the third Indel marker and the fourth Indel marker tightly linked to the radish NWB-CMS fertility restorer gene of claim 1.

8. The method for identifying / assisting identification of radish NWB-CMS fertility restorer gene according to claim 7, characterized in that: The method comprises using the radish genome as a template, using the primer set of claim 3 or 4 to perform a PCR amplification reaction on the radish genome, and then detecting and analyzing the PCR amplification product. If the PCR amplification result is at least one of the following four types, the radish genome does not contain a fertility restoration gene: The primer set used to amplify the first Indel marker only amplified a 156 bp band; The primer set used to amplify the second Indel marker amplified only a 115 bp band; The primer set used to amplify the third Indel marker amplified only a 179 bp band; The primer set used to amplify the first Indel marker only amplified a 106 bp band.

9. The method for identifying / assisting identification of radish NWB-CMS fertility restorer gene according to claim 8, characterized in that: The procedure of the PCR amplification reaction is: 94°C, 4 min; 94°C 20 s, 60°C 20 s, 72°C 30 s, a total of 35 cycles; 72°C, 10 min; and storage at 4°C.

10. The Indel molecular marker tightly linked to the radish NWB-CMS fertility restorer gene according to claim 1 or 2, the primer set for identifying the first Indel marker, the second Indel marker, the third Indel marker, and the fourth Indel marker according to claim 3 or 4, the kit for identifying / assisting in identifying the radish NWB-CMS fertility restorer according to claim 5 or 6, the method for identifying / assisting in identifying the radish NWB-CMS fertility restorer according to any one of claims 7 to 9, use thereof in identifying / assisting in identifying the radish NWB-CMS fertility restorer gene, use thereof in radish breeding / assisting in breeding, and use thereof for assisting in tracing the loci of radish fertility restorer genes.

Images