InDel molecular marker related to content of high benzyl alcohol primuroside, primer pair, kit and application

Abstract

The invention relates to an InDel molecular marker, a primer pair and a kit related to the content of high-benzyl-alcohol primuroside and application, and belongs to the technical field of plant molecular biology and genetic breeding. The sequence of the InDel molecular marker is as shown in SEQ ID No. 1. The method for identifying the high-benzyl-alcohol primuloside by using the InDel molecular marker has the characteristics of simplicity and convenience in operation, rapidness, high efficiency and high accuracy, the breeding period of tea trees can be remarkably shortened, and the cost and complexity of traditional phenotype screening are reduced. The method is suitable for large-scale screening of high-benzyl-alcohol primuroside tea tree varieties, and important technical support is provided for tea aroma quality improvement and high-quality tea tree variety breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology and genetic breeding, and particularly relates to an InDel molecular marker related to high benzyl alcohol primulosidase content, a primer pair, a kit and an application thereof. Background Art

[0002] The aroma and flavor of tea are one of the key factors that determine its quality and market competitiveness. Benzyl alcohol primulosides are important aroma precursors in tea. They can be hydrolyzed to form benzyl alcohol during tea processing, giving tea a unique aroma characteristic. Tea varieties with high Benzyl alcohol primulosides content usually have better aroma potential, so breeding tea varieties with high Benzyl alcohol primulosides has become an important goal of tea breeding.

[0003] Traditional tea tree breeding methods mainly rely on phenotypic selection, that is, the content of benzyl alcohol primulosides in tea leaves is determined through sensory evaluation or chemical analysis, and then high benzyl alcohol primulosides varieties are screened out. However, this method has many limitations: first, phenotypic selection is greatly affected by environmental factors (such as climate, soil, cultivation conditions, etc.), and the screening results are unstable; second, although chemical analysis methods (such as high-performance liquid chromatography, gas chromatography-mass spectrometry, etc.) are accurate, they are complex to operate, time-consuming, and costly, and it is difficult to meet the needs of large-scale breeding; in addition, traditional breeding cycles are long, inefficient, and it is difficult to quickly obtain target varieties.

[0004] With the rapid development of molecular biology technology, Marker-Assisted Selection (MAS) technology has provided a new solution for plant breeding. Molecular marker technology can directly screen target traits at the DNA level, and has the advantages of being fast, accurate, and not affected by the environment. Insertion / Deletion (InDel) markers are polymorphic markers based on insertion or deletion variations in genome sequences. They are highly stable and easy to detect, and have been widely used in plant genetic breeding.

[0005] At present, the research on molecular markers of tea aroma components has made some progress, but there is still a lack of efficient and reliable technical means for the rapid identification of tea varieties with high benzyl alcohol primulosides. In the prior art, there is no report on the rapid identification of tea varieties with high benzyl alcohol primulosides using InDel markers. Therefore, the development of an InDel marker related to high benzyl alcohol primulosides is of great significance for improving the efficiency of tea breeding and accelerating the breeding of tea varieties with high aroma potential. Summary of the invention

[0006] The present invention aims at the problems of low efficiency, high cost and great environmental impact of the identification method of high benzyl alcohol primulosidase tea varieties in the prior art, and provides an InDel molecular marker related to the high benzyl alcohol primulosidase content. The method of identifying high benzyl alcohol primulosidase tea varieties using the InDel molecular marker can quickly and accurately screen out high benzyl alcohol primulosidase tea varieties, providing an efficient technical means for tea breeding and tea quality improvement.

[0007] In order to achieve the above object, the present invention adopts the following technical solution: In a first aspect of the present invention, an InDel molecular marker related to high benzyl alcohol primulosides content is provided, wherein the sequence of the InDel molecular marker is shown in SEQ ID No. 1, and the InDel molecular marker is a gene encoding a benzyl alcohol primulosides synthesis gene in tea tree. CsUGT6 Polymorphic sites of deletion or insertion in the promoter region.

[0008] In a second aspect of the present invention, a primer pair for detecting the InDel molecular marker is provided, characterized in that the primer pair comprises a forward primer and a reverse primer; Forward primer: 5′-TTCACTCCCGTTTACTAAGC-3′; Reverse primer: 5′-GAGAGCCGAACAGAGGAA-3′.

[0009] The third aspect of the present invention provides a kit comprising the primer pair.

[0010] In a fourth aspect, the present invention provides a use of the InDel molecular marker, the primer pair or the kit in identifying tea varieties with high benzyl alcohol primulosidase.

[0011] In a fifth aspect, the present invention provides a method for identifying tea varieties with high benzyl alcohol primulosides, comprising the following steps: Extracting genomic DNA of the tea tree variety to be tested; Using the genomic DNA as a template, and using the primer pair to perform PCR amplification; The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or at both 264 bp and 236 bp, the amplification product was identified as a tea tree variety with high benzyl alcohol primrose glycoside content.

[0012] As a preferred embodiment of the present invention, the reaction procedure of PCR amplification is: initial denaturation at 95°C for 3 minutes; followed by 34 cycles, each cycle including 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and finally extension at 72°C for 5 minutes.

[0013] As a preferred embodiment of the present invention, a 25 μL PCR reaction system is composed of the following components: 1 μL of 50 ng template DNA, 1 μL of each 10 μM specific primer, 2 μL of 2.5 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 2.5 μL of 10× PCR buffer, and water is added to the mixture.

[0014] In a sixth aspect, the present invention provides a use of the InDel molecular marker, the primer pair or the kit in the breeding of high-benzyl alcohol primulosidase tea trees.

[0015] In a seventh aspect, the present invention provides a method for cultivating a tea tree containing high benzyl alcohol primulosides, comprising the following steps: Extracting genomic DNA of the tea tree variety to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 2; The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or specific bands appeared at both 264 bp and 236 bp, the tea tree variety was selected as the male or female parent of high-benzyl alcohol primulosidase tea tree for breeding.

[0016] As a preferred embodiment of the present invention, the reaction procedure of PCR amplification is: initial denaturation at 95°C for 3 minutes; followed by 34 cycles, each cycle including 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and finally extension at 72°C for 5 minutes.

[0017] As a preferred embodiment of the present invention, a 25 μL PCR reaction system is composed of the following components: 1 μL of 50 ng template DNA, 1 μL of each 10 μM specific primer, 2 μL of 2.5 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 2.5 μL of 10× PCR buffer, and water is added to the mixture.

[0018] Compared with the prior art, the beneficial effects of the present invention are: The present invention first discovered that high benzyl alcohol primrose glycoside tea varieties CsUGT6A 28 bp DNA sequence was inserted into the promoter region of the gene, which can be used as an InDel molecular marker to quickly identify tea varieties with high benzyl alcohol primulosides. The PCR amplification products of tea varieties with high benzyl alcohol primulosides showed a clear 264 bp band or a clear 264 bp band and a clear 236 bp band on the electrophoresis map, while the PCR amplification products of ordinary tea varieties showed only a 236 bp band on the electrophoresis map. Based on this, it can be used to screen tea varieties with high benzyl alcohol primulosides on a large scale, providing important technical support for improving the aroma quality of tea and selecting and breeding high-quality tea varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Different tea tree resources CsUGT6 Promoter sequence alignment; Figure 2 InDel marker amplification results of different tea tree resources. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with specific examples, which are intended to explain the present invention rather than to limit it.

[0021] The aroma and flavor of tea are one of the key factors that determine its quality and market competitiveness. Benzyl alcohol primulosides are important aroma precursors in tea. They can be hydrolyzed to form benzyl alcohol during tea processing, giving tea a unique aroma characteristic. Tea varieties with high Benzyl alcohol primulosides content usually have better aroma potential, so breeding tea varieties with high Benzyl alcohol primulosides has become an important goal of tea breeding.

[0022] Traditional tea tree breeding methods mainly rely on phenotypic selection, that is, the content of benzyl alcohol primulosides in tea leaves is determined through sensory evaluation or chemical analysis, and then high benzyl alcohol primulosides varieties are screened out. However, this method has many limitations: first, phenotypic selection is greatly affected by environmental factors (such as climate, soil, cultivation conditions, etc.), and the screening results are unstable; second, although chemical analysis methods (such as high-performance liquid chromatography, gas chromatography-mass spectrometry, etc.) are accurate, they are complex to operate, time-consuming, and costly, and it is difficult to meet the needs of large-scale breeding; in addition, traditional breeding cycles are long, inefficient, and it is difficult to quickly obtain target varieties.

[0023] At present, the research on molecular markers of tea aroma components has made some progress, but there is still a lack of efficient and reliable technical means for the rapid identification of tea varieties with high benzyl alcohol primulosides. In the existing technology, there is no report on the rapid identification of tea varieties with high benzyl alcohol primulosides using InDel markers.

[0024] Based on this, the present invention provides an InDel molecular marker related to high benzyl alcohol primulosides content, the sequence of the InDel molecular marker is shown in SEQ ID No.1, and the InDel molecular marker is a gene encoding a benzyl alcohol primulosides synthesis gene in tea tree. CsUGT6 The polymorphic site of deletion or insertion in the promoter region can be used to quickly identify tea varieties with high benzyl alcohol primulosides.

[0025] The different tea tree varieties involved in the embodiments of the present invention include: The samples include: BY1H, Baiye No. 1; HJC2H, Huangjincha No. 2; XYJB, Xiaoye Jibai; SZNB, Shengzhou Naibai; JB, Jibai; SBC, Subei Tea; NBC, Naibai Tea; RG, Cinnamon; ZH1H, Zhonghuang No. 1; ZB1H, Zhongbai No. 1; SXH, Shengxian Huang; HD, Huangdan; TGY, Tieguanyin; EC1H, Echa No. 1; TZH, Tezaohuang; ZJ, Zijuan; SCZ, Shucha Zao; ZMG, Zimeigui; SPL, Shanpolu; XN-3-55, AH1H, Anhui No. 1; ZZ1H, Zhongzi No. 1; PYTZ, Pingyang Tezao; FS, Buddha's Hand.

[0026] Example 1 InDel marker screening and primer design 1. Test materials: The LC-MS / MS method was used to detect the content of benzyl alcohol primulosidase in 363 tea tree populations in Shaanxi.

[0027] 2. Genomic DNA extraction: The plant genomic DNA kit (DP305) of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from 363 tea plants. The specific operation was referred to the instruction manual.

[0028] 3. Genome sequence alignment: The whole genome of 363 tea plants was sequenced. The InDel sites associated with high benzyl alcohol primulosides content were screened using bioinformatics GWAS software. Combined with the analysis of tea plant genome data, it was found that compared with low benzyl alcohol primulosides tea plant varieties, high benzyl alcohol primulosides tea plant varieties had higher benzyl alcohol primulosides content. CsUGT6 A 28 bp DNA sequence was inserted into the promoter region of the gene ( Figure 1 ), whose sequence is shown in SEQ ID NO: 1:

[0029] CGTCATTTTCTTTGGTCCCAAGTCGACT 4. Primer design: Design a pair of specific primers based on the screened InDel sites: Forward primer: 5'-TTCACTCCCGTTTACTAAGC-3' (SEQ ID NO: 2) Reverse primer: 5'-GAGAGCCGAACAGAGGAA-3' (SEQ ID NO: 3).

[0030] The primers were synthesized by a professional biological company.

[0031] Example 2 DNA extraction and PCR amplification 1. DNA extraction: The CTAB method was used to extract the genomic DNA from the leaves of the tea tree varieties to be tested. The specific steps are as follows: Take 0.1 g of fresh leaves and grind them into powder in liquid nitrogen.

[0032] Add 1 mL of CTAB extraction buffer and incubate at 65°C in a water bath for 30 min.

[0033] An equal volume of chloroform-isoamyl alcohol (24:1) was added, mixed, and centrifuged (12,000 rpm, 10 min).

[0034] Take the supernatant, add an equal volume of isopropanol to precipitate DNA, wash the precipitate after centrifugation, dry it and dissolve it in 50 μL TE buffer.

[0035] The DNA concentration and purity were measured using a spectrophotometer and adjusted to 50 ng / μL for later use.

[0036] 2. PCR amplification: PCR reaction system (25 μL): Template DNA: 1 μL (50 ng) Forward primer: 1 μL (10 μM) Reverse primer: 1 μL (10 μM) dNTPs: 2 μL (2.5 mM each) 10× PCR buffer: 2.5 μL Taq DNA polymerase: 0.2 μL (5 U / μL) ddH2O: make up to 25 μL PCR reaction procedure: Pre-denaturation: 94°C, 5 minutes; 35 cycles: 94°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec; Final extension: 72°C, 10 min.

[0037] The PCR products were stored at 4°C.

[0038] Example 3 Electrophoresis analysis and result determination 1. Agarose gel electrophoresis: Prepare 1.5% agarose gel and add 0.5 μg / mL ethidium bromide (EB) for staining.

[0039] Take 5 μL of PCR product and mix it with 1 μL of 6× loading buffer, and spot it in the gel well.

[0040] The electrophoresis was performed at 100 V for 30 min and the gel was observed and photographed using a gel imaging system.

[0041] Result judgment: The PCR amplification products of the tea tree varieties with high benzyl alcohol primulosidase showed a clear 264 bp band or a clear 264 bp band and a clear 236 bp band on the electrophoresis pattern, while the PCR amplification products of the ordinary tea tree varieties showed only a 236 bp band on the electrophoresis pattern ( Figure 2 ).

[0042] Based on the position and size of the bands, it is possible to quickly distinguish whether the tea tree variety is a high-benzyl alcohol primrose glycoside variety.

[0043] Example 4 Validation of the InDel method for rapid identification of tea varieties with high benzyl alcohol primulosides Determination of benzyl alcohol primrose glycoside content: The content of benzyl alcohol primulosidase in the screened tea varieties was determined by LC-MS / MS to verify the accuracy of the method of the present invention. The results are shown in Table 1.

[0044] Table 1 Primrose glycoside content in different tea varieties As shown in Table 1, the content of benzyl alcohol primulosidoside in the tea varieties with PCR amplification products of 264 bp or 264 bp and 236 bp is significantly higher than that in the common tea varieties, which verifies the reliability of the method of the present invention.

[0045] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, they are also intended to be included.

Claims

1. An InDel molecular marker associated with high benzyl alcohol primrose glycoside content, characterized in that: The sequence of the InDel molecular marker is shown in SEQ ID No. 1, and the InDel molecular marker is a gene for synthesizing benzyl alcohol primrose glycoside in tea tree. CsUGT6 Polymorphic sites of deletion or insertion in the promoter region.

2. A primer pair for detecting the InDel molecular marker, characterized in that: The primer pair includes a forward primer and a reverse primer; Forward primer: 5′-TTCACTCCCGTTTACTAAGC-3′; Reverse primer: 5′-GAGAGCCGAACAGAGGAA-3′.

3. A kit comprising the primer pair according to claim 2.

4. Use of the InDel molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in identifying tea varieties with high benzyl alcohol primulosidase.

5. A method for identifying tea varieties with high benzyl alcohol primulosides, characterized in that: The following steps are involved: Extracting genomic DNA of the tea tree variety to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 2; The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or at both 264 bp and 236 bp, the amplification product was identified as a tea tree variety with high benzyl alcohol primrose glycoside content.

6. The method for identifying high-benzyl alcohol primulosidase tea varieties according to claim 5, characterized in that: The reaction program of PCR amplification was as follows: initial denaturation at 95°C for 3 minutes; followed by 34 cycles, each cycle including 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and finally extension at 72°C for 5 minutes.

7. The method for identifying high-benzyl alcohol primulosidase tea varieties according to claim 5, characterized in that: The 25 μL PCR reaction system consisted of the following components: 1 μL of 50 ng template DNA, 1 μL of each 10 μM specific primer, 2 μL of 2.5 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 2.5 μL of 10× PCR buffer, and made up with water.

8. Use of the InDel molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in the breeding of high-benzyl alcohol primulosidase tea trees.

9. A method for cultivating tea trees with high benzyl alcohol primulosides, characterized in that: The following steps are involved: Extracting genomic DNA of the tea tree variety to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 2; The PCR amplification products were analyzed by agarose gel electrophoresis. When a specific band appeared at 264 bp, or specific bands appeared at both 264 bp and 236 bp, the tea tree variety was selected as the male or female parent of high-benzyl alcohol primulosidase tea tree for breeding.

Images