Systems and kits for the diagnosis of natural regression of neuroblastoma

Abstract

The present invention discloses a system and a kit for diagnosing the natural regression of neuroblastoma, which relates to the technical field of medical diagnosis. The system and the kit provided by the present invention diagnose whether the tumor of a child with neuroblastoma in the Ms stage naturally regresses based on the read values of the target miRNA mature body and its isomers, and have high sensitivity and specificity, and can provide effective suggestions for clinical treatment on whether surgical resection is needed.

Description

Technical Field

[0001] The present invention relates to the field of medical diagnosis technology, and more particularly, to a system and a kit for diagnosing the natural regression of neuroblastoma. Background Art

[0002] Among pediatric malignancies, neuroblastoma (NBL) is characterized by its genetic complexity and diverse clinical behaviors and is the most common extracranial solid tumor in children. As is well known, traditional tumor biopsy is the gold standard for diagnosing primary or metastatic tumors, which can reveal the biological characteristics of tumors and guide treatment decisions. However, performing invasive biopsies in patients with NBL poses significant challenges and risks. In addition, due to the high heterogeneity of NBL, biopsies may not fully reflect all the characteristics of the disease. Especially in children, biopsies require repeated sedation and / or anesthesia. To address these issues, there has been a gradual shift towards research on non-invasive assessment and monitoring methods for NBL (including prognosis and treatment monitoring).

[0003] Since NBL is a highly heterogeneous pediatric tumor, its diagnosis faces many difficulties. The International Neuroblastoma Risk Group Staging System (INRGSS) is the currently widely used neuroblastoma staging system, which can stage neuroblastoma before the start of treatment. INRGSS divides NBL into the following four stages.

[0004] Among these four stages, the NBL patients in the Ms stage are relatively special. Their main feature is that the prognosis of the patients is relatively good, and the tumors of some patients may regress spontaneously. However, how to identify at an early stage the patients whose tumors can regress spontaneously and adopt an active treatment plan for the patients whose tumors cannot regress spontaneously and progress is currently a difficult point in clinical practice.

[0005] In view of this, the present invention is specifically proposed. Summary of the Invention

[0006] The purpose of the present invention is to provide a system and a kit for diagnosing the natural regression of neuroblastoma, which can be used to evaluate the risk of natural regression and progression of tumors in Ms-stage pediatric neuroblastoma patients and has good diagnostic performance.

[0007] The present invention is implemented as follows:

[0008] In a first aspect, the present invention provides a system for diagnosing the natural regression of tumors in Ms-stage pediatric neuroblastoma patients, which includes: an information acquisition module, a calculation module, and a diagnosis module;

[0009] The information acquisition module is used to perform the step of acquiring the reads values of the target miRNA mature forms and their isomers in the sample to be tested; the isomers include a first isomer, a second isomer, a third isomer, and a fourth isomer;

[0010] The first isomer lacks 1 nucleotide at the 3' end relative to its target miRNA mature form;

[0011] The second isomer lacks 2 nucleotides at the 3' end relative to its target miRNA mature form;

[0012] The third isomer has 1 nucleotide added at the 3' end relative to its target miRNA mature form;

[0013] The fourth isomer has 2 nucleotides added at the 3' end relative to its target miRNA mature form;

[0014] The sample to be tested is from a child neuroblastoma patient to be identified in the Ms phase;

[0015] The calculation module is used to perform the step of substituting the reads values into a calculation model to calculate a threshold;

[0016] The diagnosis module is used to perform the step of judging the possibility of natural regression of the tumor of the child neuroblastoma patient to be identified according to the threshold;

[0017] Wherein, the target miRNA mature forms include at least one of the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p.

[0018] The system of the present invention diagnoses whether the tumor of a child neuroblastoma patient in the Ms phase will regress naturally based on the reads values of the above 18 target miRNA mature form molecules and their isomers, and has good diagnostic performance, with a sensitivity of 92.77% and a specificity of 95.81%; it can provide effective suggestions for clinical treatment on whether surgical resection is needed.

[0019] The definitions of different stages of tumors are as follows:

[0020] Stage Definition Stage L1 Local tumor, without radiologically defined risk factors, the tumor is confined and can be resected surgically Stage L2 Local tumor, with one or more radiologically defined risk factors, difficult to completely resect even by surgery Stage M Distant metastatic disease, the tumor has spread to other parts of the body, such as bones, bone marrow, lymph nodes, etc. Stage Ms Local tumor (Stage L1 or L2) with special metastasis, limited to skin, liver and / or bone marrow (less than 10% tumor cells in bone marrow), and the patient is less than 18 months old

[0021] Optionally, in some embodiments of the present invention, the mathematical formula of the calculation model in the calculation module is as follows or its equivalent deformation formula:

[0022] S = 1.67×R1 + 2.34×R2 + 8.04×R3 + 4.76×R4 + 7.12×R5 + 1.45×R6 + 1.64×R7 + 9.31×R8 + 3.26×R9 + 7.18×R10 + 5.64×R11 + 5.07×R12 + 9.78×R13 + 2.06×R14 + 6.54×R15 + 6.03×R16 + 1.35×R17 + 1.69×R18;

[0023] Wherein, S represents the scoring value for identifying the natural regression of tumors in pediatric neuroblastoma patients;

[0024] R1 - R18 respectively and sequentially represent the reads ratios of the following target miRNA mature molecules to their corresponding isomers; hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p;

[0025] The reads ratios of each target miRNA mature molecule to its corresponding isomer are calculated according to the following mathematical formula or its equivalent deformation formula:

[0026] Rn = (R second isomer / R target miRNA mature + R first isomer / R target miRNA mature) / (R third isomer / R target miRNA mature + R fourth isomer / R target miRNA mature); n is any positive integer selected from 1 - 18.

[0027] It should be noted that the fixed coefficients in the mathematical formulas of the above models (such as 1.67, 2.34, 1.69) can float within a certain range, such as ±3%. Therefore, in other embodiments, as long as the calculation models are within this range, they fall within the protection scope of the present invention.

[0028] It should be noted that the sequencing reads of miRNAs and their isomers can be measured by common sequencing techniques or qRCR in the art. For example, the iSeq100, MiniSeq, MiSeq, NextSeq550, NextSeq2000, NovaSeq6000 sequencers of Illumina company are based on PE150 or SE50 sequencing techniques; the MGI sequencing platform of BGI is based on SE100, PE100 and PE150 sequencing techniques, etc.

[0029] It should be noted that the methods for extracting and separating plasma small extracellular vesicles (exosomes) and enriching miRNAs and their isomers applied to the present invention can all be carried out using conventional techniques and kits in the art.

[0030] Optionally, in some embodiments of the present invention, the diagnostic module makes a judgment based on the S value, and the judgment method is as follows:

[0031] If S > 35.80, it is judged that the tumor cannot regress spontaneously and has a risk of progression;

[0032] If S < 27.60, it is judged that the tumor can regress or remit without intervention;

[0033] If 27.60 ≤ S ≤ 35.80, no judgment is made, and it is recommended to retest or make a judgment in combination with other clinical indicators.

[0034] Optionally, in some embodiments of the present invention, the test sample is from the plasma exosomes of children with neuroblastoma to be differentiated.

[0035] Optionally, in some embodiments of the present invention, the nucleotide sequences of hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p are shown as SEQ ID NO.1-18 respectively.

[0036] On the other hand, the present invention provides a kit for diagnosing tumor regression in pediatric neuroblastoma patients in the Ms phase, and the kit can detect reagents for the read values of the target miRNA mature body and its isomers;

[0037] The target miRNA mature body includes at least one of the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p;

[0038] The isomer has a deletion or addition of 1-2 nucleotides at the 3' end relative to its target miRNA mature body.

[0039] Optionally, in some embodiments of the present invention, the isomers include a first isomer, a second isomer, a third isomer, and a fourth isomer; the first isomer is missing 1 nucleotide at the 3' end relative to its target miRNA mature form; the second isomer is missing 2 nucleotides at the 3' end relative to its target miRNA mature form; the third isomer has 1 nucleotide added at the 3' end relative to its target miRNA mature form; the fourth isomer has 2 nucleotides added at the 3' end relative to its target miRNA mature form.

[0040] Optionally, in some embodiments of the present invention, the test sample of the kit is from the plasma exosomes of pediatric neuroblastoma patients in the Ms phase.

[0041] Optionally, in some embodiments of the present invention, the kit further includes an instruction manual, and the instruction manual records the following calculation formula or its equivalent variant formula:

[0042] S = 1.67×R1 + 2.34×R2 + 8.04×R3 + 4.76×R4 + 7.12×R5 + 1.45×R6 + 1.64×R7 + 9.31×R8 + 3.26×R9 + 7.18×R10 + 5.64×R11 + 5.07×R12 + 9.78×R13 + 2.06×R14 + 6.54×R15 + 6.03×R16 + 1.35×R17 + 1.69×R18;

[0043] Wherein, S represents the scoring value for differentiating the spontaneous regression of tumors in pediatric neuroblastoma patients;

[0044] R1 - R18 respectively and sequentially represent the reads ratios of the following target miRNA mature molecules to their corresponding isomers; hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p;

[0045] The reads ratios of each target miRNA mature molecule to its corresponding isomer are calculated according to the following mathematical formula or its equivalent variant formula:

[0046] Rn = (R second isomer / R target miRNA mature form + R first isomer / R target miRNA mature form) / (R third isomer / R target miRNA mature form + R fourth isomer / R target miRNA mature form); n is any positive integer selected from 1 - 18;

[0047] If S > 35.80, it is determined that the tumor cannot regress spontaneously and there is a risk of progression;

[0048] If S < 27.60, it is determined that the tumor can regress or remit without intervention;

[0049] If 27.60 ≤ S ≤ 35.80, no determination is made, and it is recommended to retest or combine with other clinical indicators for judgment.

[0050] Optionally, in some embodiments of the present invention, the nucleotide sequences of hsa - let - 7i - 5p, hsa - miR - 122 - 5p, hsa - miR - 143 - 3p, hsa - miR - 145 - 5p, hsa - miR - 146a - 5p, hsa - miR - 148b - 3p, hsa - miR - 223 - 3p, hsa - miR - 26b - 5p, hsa - miR - 27b - 3p, hsa - miR - 28 - 3p, hsa - miR - 29a - 3p, hsa - miR - 30e - 5p, hsa - miR - 320a - 3p, hsa - miR - 34a - 5p, hsa - miR - 423 - 5p, hsa - miR - 7 - 5p, hsa - miR - 92a - 3p, and hsa - miR - 9a - 3p are respectively as shown in SEQ ID NO.1 - 18, as shown in Table 1 below.

[0051] Table 1

[0052]

[0053] The first isomer sequence (-1) of hsa - let - 7i - 5p: UGAGGUAGUAGUUUGUGCUGU.

[0054] The second isomer sequence (-2) of hsa - let - 7i - 5p: UGAGGUAGUAGUUUGUGCUG.

[0055] The third isomer sequence (+1) of hsa - let - 7i - 5p: UGAGGUAGUAGUUUGUGCUGUU C .

[0056] The fourth isomer sequence (+2) of hsa - let - 7i - 5p: UGAGGUAGUAGUUUGUGCUGUUCG 。 BRIEF DESCRIPTION OF THE DRAWINGS

[0057] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other relevant drawings can also be obtained based on these drawings.

[0058] Figure 1 It is a flowchart for diagnosis using the model of Embodiment 1 in Embodiment 2.

[0059] Figure 2 It is the ROC curve for diagnosis using the model of Embodiment 1 in Embodiment 2 and the ROC curve for diagnosis with the MYCN gene amplification results in Embodiment 2. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0060] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those conditions not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For the reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0061] The features and performance of the present invention will be further described in detail below in conjunction with the embodiments.

[0062] Embodiment 1

[0063] This embodiment provides a diagnostic model for the natural regression of tumors in NBL patients in the Ms phase

[0064] By detecting the reads of 18 miRNA mature molecules and their corresponding isomers in the plasma exosomes of NBL patients in the Ms phase, the reads values are substituted into the following formula to calculate the S threshold:

[0065] S =

[0066] 1.67 ×

(R-2nt-hsa-let-7i-5p / R mature hsa-let-7i-5p + R-1nt-hsa-let-7i-5p / R mature hsa-let-7i-5p) / (R1nt-hsa-let-7i-5p / R mature hsa-let-7i-5p + R2nt-hsa-let-7i-5p / R mature hsa-let-7i-5p)

[0067] +2.34 ×

(R - 2nt - hsa - miR - 122 - 5p / R mature hsa - miR - 122 - 5p + R - 1nt - hsa - miR - 122 - 5p / R mature hsa - miR - 122 - 5p) / (R1nt - hsa - miR - 122 - 5p / R mature hsa - miR - 122 - 5p + R2nt - hsa - miR - 122 - 5p / R mature hsa - miR - 122 - 5p)

[0068] +8.04 ×

(R - 2nt - hsa - miR - 143 - 3p / R mature hsa - miR - 143 - 3p + R - 1nt - hsa - miR - 143 - 3p / R mature hsa - miR - 143 - 3p) / (R1nt - hsa - miR - 143 - 3p / R mature hsa - miR - 143 - 3p + R2nt - hsa - miR - 143 - 3p / R mature hsa - miR - 143 - 3p)

[0069] +4.76 ×

(R - 2nt - hsa - miR - 145 - 5p / R mature hsa - miR - 145 - 5p + R - 1nt - hsa - miR - 145 - 5p / R mature hsa - miR - 145 - 5p) / (R1nt - hsa - miR - 145 - 5p / R mature hsa - miR - 145 - 5p + R2nt - hsa - miR - 145 - 5p / R mature hsa - miR - 145 - 5p)

[0070] +7.12 ×

(R - 2nt - hsa - miR - 146a - 5p / R mature hsa - miR - 146a - 5p + R - 1nt - hsa - miR - 146a - 5p / R mature hsa - miR - 146a - 5p) / (R1nt - hsa - miR - 146a - 5p / R mature hsa - miR - 146a - 5p + R2nt - hsa - miR - 146a - 5p / R mature hsa - miR - 146a - 5p)

[0071] +1.45 ×

(R - 2nt - hsa - miR - 148b - 3p / R mature hsa - miR - 148b - 3p + R - 1nt - hsa - miR - 148b - 3p / R mature hsa - miR - 148b - 3p) / (R1nt - hsa - miR - 148b - 3p / R mature hsa - miR - 148b - 3p + R2nt - hsa - miR - 148b - 3p / R mature hsa - miR - 148b - 3p)

[0072] +1.64×

(R - 2nt - hsa - miR - 223 - 3p / R mature hsa - miR - 223 - 3p + R - 1nt - hsa - miR - 223 - 3p / R mature hsa - miR - 223 - 3p) / (R1nt - hsa - miR - 223 - 3p / R mature hsa - miR - 223 - 3p + R2nt - hsa - miR - 223 - 3p / R mature hsa - miR - 223 - 3p)

[0073] +9.31×

(R - 2nt - hsa - miR - 26b - 5p / R mature hsa - miR - 26b - 5p + R - 1nt - hsa - miR - 26b - 5p / R mature hsa - miR - 26b - 5p) / (R1nt - hsa - miR - 26b - 5p / R mature hsa - miR - 26b - 5p + R2nt - hsa - miR - 26b - 5p / R mature hsa - miR - 26b - 5p)

[0074] +3.26×

(R - 2nt - hsa - miR - 27b - 3p / R mature hsa - miR - 27b - 3p + R - 1nt - hsa - miR - 27b - 3p / R mature hsa - miR - 27b - 3p) / (R1nt - hsa - miR - 27b - 3p / R mature hsa - miR - 27b - 3p + R2nt - hsa - miR - 27b - 3p / R mature hsa - miR - 27b - 3p)

[0075] +7.18×

(R - 2nt - hsa - miR - 28 - 3p / R mature hsa - miR - 28 - 3p + R - 1nt - hsa - miR - 28 - 3p / R mature hsa - miR - 28 - 3p) / (R1nt - hsa - miR - 28 - 3p / R mature hsa - miR - 28 - 3p + R2nt - hsa - miR - 28 - 3p / R mature hsa - miR - 28 - 3p)

[0076] +5.64×

(R - 2nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p + R - 1nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p) / (R1nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p + R2nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p)

[0077] +5.07×

(R - 2nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p + R - 1nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p) / (R1nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p + R2nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p)

[0078] +9.78×

(R - 2nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p + R - 1nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p) / (R1nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p + R2nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p)

[0079] +2.06×

(R - 2nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p + R - 1nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p) / (R1nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p + R2nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p)

[0080] +6.54×

(R - 2nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p + R - 1nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p) / (R1nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p + R2nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p)

[0081] +6.03×

(R - 2nt - hsa - miR - 7 - 5p / R mature hsa - miR - 7 - 5p + R - 1nt - hsa - miR - 7 - 5p / R mature hsa - miR - 7 - 5p) / (R1nt - hsa - miR - 7 - 5p / R mature hsa - miR - 7 - 5p + R2nt - hsa - miR - 7 - 5p / R mature hsa - miR - 7 - 5p)

[0082] +1.35×

(R-2nt-hsa-miR-92a-3p / Rmature hsa-miR-92a-3p+R-1nt-hsa-miR-92a-3p / Rmature hsa-miR-92a -3p) / (R1nt-hsa-miR-92a-3p / Rmature hsa-miR-92a-3p+R2nt-hsa-miR-92a-3p / Rmature hsa-miR-92a-3p)

[0083] +1.69×

(R-2nt-hsa-miR-9a-3p / Rmature hsa-miR-9a-3p+R-1nt-hsa-miR-9a-3p / Rmature hsa-miR-9a -3p) / (R1nt-hsa-miR-9a-3p / Rmature hsa-miR-9a-3p+R2nt-hsa-miR-9a-3p / Rmature hsa-miR-9a-3p)

[0084] If S>35.80, the tumor is judged to be unable to regress on its own and is at risk of progression;

[0085] If S < 27.60, the tumor is judged to be regressing or remitting without intervention;

[0086] If 27.60≤S≤35.80, it means that the model is not applicable and no result prediction is made. It is recommended to retest or combine other clinical indicators for judgment.

[0087] In the formula:

[0088] -2nt-hsa-let-7i-5p, representing a deletion of 2 nucleotides at the 3′ end relative to the mature hsa-let-7i-5p molecule;

[0089] -1nt-hsa-let-7i-5p, representing a deletion of 1 nucleotide at the 3′ end relative to the mature hsa-let-7i-5p molecule;

[0090] 1nt-hsa-let-7i-5p, representing an increase of 1 nucleotide at the 3′ end relative to the mature hsa-let-7i-5p molecule;

[0091] 2nt-hsa-let-7i-5p, representing the addition of 2 nucleotides to the 3′ end of the mature hsa-let-7i-5p molecule;

[0092] Other molecules containing the characters "-2nt, -1nt, 1nt, 2nt" should be understood similarly.

[0093] R-2nt-hsa-let-7i-5p, R-1nt-hsa-let-7i-5p, R mature hsa-let-7i-5p, R1nt-hsa-let-7i-5p, R2nt-hsa-let-7i-5p represent the read values of the mature hsa-let-7i-5p molecule and its isomers; similar understanding applies to other molecules.

[0094] Example 2

[0095] The model of Example 1 was used for risk management and auxiliary diagnosis of NBL patients in the Ms phase. 286 patients based on the INRGSS stage were enrolled, and miRNA sequencing and data analysis of plasma exosomes were completed, and reports were generated based on the model. The model determined that the NBL of 161 patients could regress naturally or achieve remission without clinical intervention, determined that the NBL of 75 patients could not regress naturally without clinical intervention and had a risk of tumor progression, and the sequencing data of another 50 patients were not applicable to model analysis. Detection was performed again within 3 - 6 months and reports were generated. Finally, there were still 18 patients whose data were not applicable to model analysis, and these patients were no longer followed up. Patients in the group determined by the model to regress naturally and achieve remission were followed up for up to 18 months, and MYCN amplification was detected at the end of the follow-up. Patients in the group determined by the model to be unable to regress spontaneously and have a risk of progression were followed up for up to 24 months, and MYCN amplification was detected at the end of the follow-up. Finally, the number of patients with complete regression, partial remission, no change, and tumor progression in each group based on the model interpretation was counted. The interpretation results are as Figure 1 shown. Among 268 valid data, a total of 185 cases of natural regression and remission were obtained for the NBL discrimination model in the Ms phase, and 83 cases were unable to regress spontaneously and progressed. Through follow-up, 189 cases of NBL regression were finally achieved without clinical intervention.

[0096] MYCN gene amplification (which can be achieved by existing technologies) is the most critical molecular marker in NBL and is widely used for disease risk stratification, prognosis assessment, and treatment strategy formulation. In the INRGSS system, MYCN amplification is the core indicator for high-risk stratification, and its association with poor prognosis, high-risk stratification, and treatment options has been verified through large-scale clinical studies and guideline consensus. In the embodiments of the present invention, as shown in Table 2 below, the data statistics of MYCN gene amplification were included in the clinical follow-up. Among the 83 NBL patients judged by the model to be at risk of progression, 58 were positive for MYCN gene amplification and 25 were negative for MYCN gene amplification. Among the 185 NBL patients judged by the model to be in the spontaneous regression or remission group, 1 was positive for MYCN gene amplification and 184 were negative for MYCN gene amplification. Therefore, the sensitivity of using MYCN gene amplification for the high-risk diagnosis of NBL is 73.42%, and the specificity is 89.52%. While the sensitivity of predicting high-risk NBL in the M s phase by the model of Example 1 of the present invention is 92.77%, and the specificity is 95.81%, both are significantly higher than the high-risk stratification function of only using the MYCN gene amplification index ( Figure 2 ).

[0097] Table 2

[0098]

[0099] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A system for diagnosing the natural regression of tumors in pediatric neuroblastoma patients in the M phase, characterized in that, It includes: an information acquisition module, a calculation module, and a diagnosis module; The information acquisition module is used to execute the step of acquiring the reads values of the target miRNA mature form and its isomers in the sample to be tested; the isomers include a first isomer, a second isomer, a third isomer, and a fourth isomer; The first isomer lacks 1 nucleotide at the 3' end relative to its target miRNA mature form; The second isomer lacks 2 nucleotides at the 3' end relative to its target miRNA mature form; The third isomer has 1 nucleotide added at the 3' end relative to its target miRNA mature form; The fourth isomer has 2 nucleotides added at the 3' end relative to its target miRNA mature form; The sample to be tested is from a child neuroblastoma patient to be identified in the Ms phase; The calculation module is used to execute the step of substituting the reads values into a calculation model to calculate a threshold; The diagnosis module is used to execute the step of judging the possibility of natural regression of the tumor of the child neuroblastoma patient to be identified according to the threshold; Among them, the target miRNA mature form includes the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p.

2. The system according to claim 1, wherein The mathematical formula of the calculation model in the calculation module is as follows or its equivalent deformation formula: S = 1.67×R1 + 2.34×R2 + 8.04×R3 + 4.76×R4 + 7.12×R5 + 1.45×R6 + 1.64×R7 + 9.31×R8 + 3.26×R9 + 7.18×R10 + 5.64×R11 + 5.07×R12 + 9.78×R13 + 2.06×R14 + 6.54×R15 + 6.03×R16 + 1.35×R17 + 1.69×R18; Among them, S represents the scoring value for identifying the natural regression of the tumor of a child neuroblastoma patient; R1 - R18 respectively and sequentially represent the read ratios of the following target miRNA mature molecules to their corresponding isomers; hsa - let - 7i - 5p, hsa - miR - 122 - 5p, hsa - miR - 143 - 3p, hsa - miR - 145 - 5p, hsa - miR - 146a - 5p, hsa - miR - 148b - 3p, hsa - miR - 223 - 3p, hsa - miR - 26b - 5p, hsa - miR - 27b - 3p, hsa - miR - 28 - 3p, hsa - miR - 29a - 3p, hsa - miR - 30e - 5p, hsa - miR - 320a - 3p, hsa - miR - 34a - 5p, hsa - miR - 423 - 5p, hsa - miR - 7 - 5p, hsa - miR - 92a - 3p, and hsa - miR - 9a - 3p; The read ratios of each target miRNA mature molecule to its corresponding isomer are calculated according to the following mathematical formula or its equivalent deformation formula: R n = (R 第二异构体 / R 目标miRNA成熟体 + R 第一异构体 / R 目标miRNA成熟体 ) / (R 第三异构体 / R 目标miRNA成熟体 + R 第四异构体 / R 目标miRNA成熟体 ); n is any positive integer selected from 1 - 18.

3. The system according to claim 2, wherein The diagnostic module makes a judgment based on the S value, and the judgment method is as follows: If S > 35.80, it is judged that the tumor cannot regress spontaneously and has a risk of progression; If S < 27.60, it is judged that the tumor can regress or remit without intervention; If 27.60 ≤ S ≤ 35.80, no judgment is made, and it is recommended to retest or make a judgment in combination with other clinical indicators.

4. The system according to any one of claims 1-3, characterized in that, The test sample is from the plasma exosomes of children with neuroblastoma to be differentiated.

5. The system according to any one of claims 1 to 3, characterized in that The nucleotide sequences of hsa - let - 7i - 5p, hsa - miR - 122 - 5p, hsa - miR - 143 - 3p, hsa - miR - 145 - 5p, hsa - miR - 146a - 5p, hsa - miR - 148b - 3p, hsa - miR - 223 - 3p, hsa - miR - 26b - 5p, hsa - miR - 27b - 3p, hsa - miR - 28 - 3p, hsa - miR - 29a - 3p, hsa - miR - 30e - 5p, hsa - miR - 320a - 3p, hsa - miR - 34a - 5p, hsa - miR - 423 - 5p, hsa - miR - 7 - 5p, hsa - miR - 92a - 3p, and hsa - miR - 9a - 3p are respectively shown as SEQ ID NO.1 - 18.

6. A kit for the diagnosis of tumor regression in pediatric neuroblastoma patients in the M phase, characterized in that, The kit can detect the reagents for the read values of the target miRNA mature body and its isomers; The target miRNA mature forms include the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The isomers are deleted or increased by 1-2 nucleotides at the 3'-end relative to their target miRNA mature forms.

7. The kit according to claim 6, wherein The isomers include a first isomer, a second isomer, a third isomer, and a fourth isomer; The first isomer is deleted by 1 nucleotide at the 3'-end relative to its target miRNA mature form; The second isomer is deleted by 2 nucleotides at the 3'-end relative to its target miRNA mature form; The third isomer is increased by 1 nucleotide at the 3'-end relative to its target miRNA mature form; The fourth isomer is increased by 2 nucleotides at the 3'-end relative to its target miRNA mature form.

8. The kit according to claim 6 or 7, characterized in that, The detection sample of the kit is from the plasma exosomes of pediatric neuroblastoma patients in the Ms phase.

9. The kit according to claim 6 or 7, characterized in that, The kit further includes an instruction manual, and the instruction manual records the following calculation formula or its equivalent transformation formula: S = 1.67×R1 + 2.34×R2 + 8.04×R3 + 4.76×R4 + 7.12×R5 + 1.45×R6 + 1.64×R7 + 9.31×R8 + 3.26×R9 + 7.18×R10 + 5.64×R11 + 5.07×R12 + 9.78×R13 + 2.06×R14 + 6.54×R15 + 6.03×R16 + 1.35×R17 + 1.69×R18; Wherein, S represents the scoring value for differentiating the natural regression of tumors in pediatric neuroblastoma patients; R1 - R18 respectively and successively represent the read ratios of the following target miRNA mature molecules to their corresponding isomers; hsa - let - 7i - 5p, hsa - miR - 122 - 5p, hsa - miR - 143 - 3p, hsa - miR - 145 - 5p, hsa - miR - 146a - 5p, hsa - miR - 148b - 3p, hsa - miR - 223 - 3p, hsa - miR - 26b - 5p, hsa - miR - 27b - 3p, hsa - miR - 28 - 3p, hsa - miR - 29a - 3p, hsa - miR - 30e - 5p, hsa - miR - 320a - 3p, hsa - miR - 34a - 5p, hsa - miR - 423 - 5p, hsa - miR - 7 - 5p, hsa - miR - 92a - 3p, and hsa - miR - 9a - 3p; The read ratios of each target miRNA mature molecule to its corresponding isomer are calculated according to the following mathematical formula or its equivalent deformation formula: R n = (R 第二异构体 / R 目标miRNA成熟体 + R 第一异构体 / R 目标miRNA成熟体 ) / (R 第三异构体 / R 目标miRNA成熟体 + R 第四异构体 / R 目标miRNA成熟体 ); n is any positive integer selected from 1 - 18; If S > 35.80, it is judged that the tumor cannot regress spontaneously and has a risk of progression; If S < 27.60, it is judged that the tumor can regress or remit without intervention; If 27.60 ≤ S ≤ 35.80, no judgment is made, and it is recommended to retest or judge in combination with other clinical indicators.

10. The kit according to claim 6 or 7, characterized in that, The nucleotide sequences of hsa - let - 7i - 5p, hsa - miR - 122 - 5p, hsa - miR - 143 - 3p, hsa - miR - 145 - 5p, hsa - miR - 146a - 5p, hsa - miR - 148b - 3p, hsa - miR - 223 - 3p, hsa - miR - 26b - 5p, hsa - miR - 27b - 3p, hsa - miR - 28 - 3p, hsa - miR - 29a - 3p, hsa - miR - 30e - 5p, hsa - miR - 320a - 3p, hsa - miR - 34a - 5p, hsa - miR - 423 - 5p, hsa - miR - 7 - 5p, hsa - miR - 92a - 3p and hsa - miR - 9a - 3p are respectively shown as SEQ ID NO.1 - 18.

Images