A coronavirus-like protein delivery system, its preparation method and application

By constructing IFN-α@Encap-LinTT1 nanodrug, the problem of drugs in the prior art being difficult to penetrate the blood-brain barrier and target cancer cells is solved, efficient cancer cell therapy is achieved, and production costs are reduced.

CN120000809BActive Publication Date: 2025-07-25INNER MONGOLIA HEXUN BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510487316.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-18
Publication Date
2025-07-25
Estimated Expiration
2045-04-18

AI Technical Summary

Technical Problem

Existing drug delivery systems are difficult to penetrate the blood-brain barrier and target delivery of IFN-α to cancer cells, resulting in limited therapeutic effects and the risk of immune responses for engineered synthetic polymers and liposomes.

Method used

The engineered coronavirus-like protein delivery system is adopted to encapsulate IFN-α using Encap as the protein capsid, and the targeting peptide LinTT1 is externally modified through a chemical click strategy to form IFN-α@Encap-LinTT1 nanodrug, improving BBB penetration and cancer cell targeting.

Benefits of technology

It enhances the targeting and accumulation of IFN-α in cancer cells, improves the therapeutic effect, reduces systemic side effects, and has a low production cost, and can be mass-produced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120000809B_ABST
    Figure CN120000809B_ABST
Patent Text Reader

Abstract

An embodiment of the present invention discloses a coronavirus-like protein delivery system, its preparation method and application. Based on the basic principle of protein supramolecules, taking the protein cage Encap as the research object, Encap is used as a protein capsid to encapsulate therapeutic proteins such as IFN-α within the self-assembled protein of Encap, and the chemical click strategy is used to achieve the external modification of the targeting peptide LinTT1 on Encap. The constructed coronavirus-like protein delivery system has blood-brain barrier penetrability, realizes targeted cancer cell therapy, and at the same time prolongs the half-life of therapeutic proteins, opening up a new path for their in vivo delivery. In addition, the protein delivery system of the present invention has a relatively low production cost, can be mass-produced, and has good application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of biomedical technologies, and particularly to a coronavirus-like protein delivery system, a preparation method thereof, and an application thereof. Background Art

[0002] In current biomedical research, the development of cancer treatment strategies is a highly challenging task. Cancer is a complex disease characterized by rapid cell proliferation, high invasiveness, and resistance to treatment. Interferon-α (IFN-α), as a therapeutic protein with antiviral, anti-proliferative, and immunomodulatory effects, shows potential application value in the treatment of various tumors. However, due to its molecular weight and polarity, IFN-α is difficult to penetrate physiological barriers such as the blood-brain barrier (BBB), which greatly limits the efficacy of the drug. Therefore, developing an effective drug delivery system that can penetrate physiological barriers and target cancer cells is the key to improving the treatment effect.

[0003] In the field of drug delivery, engineered synthetic polymers and liposomes, as the main nanocarriers, have achieved extensive applications by virtue of their unique physicochemical properties and biocompatibility. Despite their many advantages, they still face major obstacles when targeting specific cancer types. The variability in polymer chain length and the inconsistency in the lipid bilayer composition in liposomes result in structural heterogeneity. This heterogeneity affects biocompatibility, especially when manufacturing nanocarriers using various methods (such as thin-film hydration and reverse evaporation). In addition, as artificial synthetic constructs, both engineered polymers and liposomes have chemical structures different from those of molecules naturally occurring in the body. In particular, synthetic polymers exhibit a series of surface functional groups that are prone to attracting protein adsorption. This leads to the formation of a "protein corona", which can be recognized by the immune system. Once recognized, the immune system may regard these nanocarriers as foreign substances and trigger an immune response. This response may cause the rapid clearance of the drug carriers from the body, thereby reducing the drug concentration at the tumor site.

[0004] To solve these problems, protein-based delivery systems offer a potential solution. Proteins have good biocompatibility and low immunogenicity, which can reduce the immune clearance of the body. However, as biological macromolecules, their natural ability to penetrate the BBB is still limited, and it is difficult to achieve effective targeted delivery to cancer cells. Summary of the Invention

[0005] The applicant has found that neurotropic viruses such as rabies virus can penetrate the BBB barrier. The rabies virus has an extremely small particle size of 50-100 nm and consists of two parts: a helical nucleocapsid protein and a lipid envelope. The nucleocapsid contains the viral RNA genome and nucleoprotein, and the lipid envelope is derived from the host cell membrane, covering the surface of the nucleocapsid and containing the viral glycoprotein (G protein). The reasons are as follows: First, the rabies virus envelope has the viral glycoprotein (G protein), which can bind to the host cell receptor and then enter the nerve cells; second, the rabies virus has an extremely small particle size and can enter the CNS through axonal transport of the nervous system and then spread retrogradely along the nerves to the central nervous system.

[0006] In this context, inspired by the structural characteristics of neurotropic viruses, we hypothesized whether it is possible to target the delivery of protein drugs by engineering natural proteins to form coronavirus-like particles (VLPs). Based on this, the present invention designs an engineered coronavirus-like protein delivery system (Virus-Like Particles, VLPs): the protein cage Encapsulin (Encap) is used as the VLPs delivery carrier to target the delivery of IFN-α to cancer cells. Through the engineering design of Encap, the present invention not only improves the BBB penetrability of IFN-α but also enhances its targeting and accumulation in cancer cells, which is expected to improve the therapeutic effect on cancer cells and reduce systemic side effects.

[0007] Therefore, the embodiments of the present invention provide a coronavirus-like protein delivery system, a preparation method thereof, and an application thereof.

[0008] In order to achieve the above object, the embodiments of the present invention provide the following technical solutions:

[0009] According to the first aspect of the embodiments of the present invention, the present invention provides a preparation method of a coronavirus-like protein delivery system, and the method includes:

[0010] (1) Constructing recombinant vector 1 carrying the nucleotide sequence shown in SEQ ID No.1, recombinant vector 2 carrying the nucleotide sequence shown in SEQ ID No.2, and recombinant vector 3 carrying the nucleotide sequence shown in SEQ ID No.3;

[0011] (2) Co-expressing recombinant vector 1 and recombinant vector 2 to obtain the self-assembled protein IFN-α@Encap-ST;

[0012] (3) Expressing recombinant vector 3 to obtain the protein SC-LinTT1;

[0013] (4) IFN-α@Encap-ST and SC-LinTT1 undergo a click chemistry reaction to obtain the coronavirus-like protein delivery system.

[0014] Further, the expression vector of the recombinant vector 1 is pBAD, the expression vector of the recombinant vector 2 is pET-28a(+), and the expression vector of the recombinant vector 3 is pET-28a(+).

[0015] Further, the preparation method of the self-assembled protein IFN-α@Encap-ST is as follows:

[0016] Transform the recombinant vector 1 and the recombinant vector 2 into Escherichia coli BL21(DE3), inoculate into an LB liquid medium containing ampicillin and kanamycin antibiotics, and when the OD value reaches 0.4 - 0.6, add IPTG with a final concentration of 0.3 mM, and induce at 16°C and 200 rpm for 4 h. Then add arabinose with a final concentration of 0.1% and induce at 16°C and 200 rpm for 16 h. Collect the bacterial cells, lyse them, ultrasonically disrupt them, and purify them to obtain the self-assembled protein IFN-α@Encap-ST.

[0017] More specifically, the preparation method of the protein SC-LinTT1 is as follows:

[0018] Transform the recombinant vector 3 into Escherichia coli BL21(DE3), inoculate into an LB liquid medium containing kanamycin antibiotic, and when the OD value reaches 0.4 - 0.6, add IPTG with a final concentration of 0.3 mM, and induce at 16°C and 160 rpm for 20 h. Collect the bacterial cells, lyse them, ultrasonically disrupt them, and purify them to obtain the protein SC-LinTT1.

[0019] Further, the mass ratio of IFN-α@Encap-ST to SC-LinTT1 is 1:10;

[0020] The click chemistry reaction is carried out in the presence of a phosphate buffer solution;

[0021] The conditions of the click chemistry reaction are: 16°C, 200 rpm, 12 h.

[0022] According to the second aspect of the embodiments of the present invention, the present invention provides a coronavirus-like protein delivery system prepared by the method described in any one of the above.

[0023] According to the third aspect of the embodiments of the present invention, the present invention provides the application of the preparation method described in any one of the above in the preparation of a therapeutic protein delivery system.

[0024] According to the fourth aspect of the embodiments of the present invention, the present invention provides the application of the coronavirus-like protein delivery system as described above in the preparation of anti-cancer drugs.

[0025] Further, the cancer is glioblastoma or cervical cancer. More specifically, the glioblastoma is glioblastoma multiforme.

[0026] The embodiments of the present invention have the following advantages:

[0027] Based on the basic principle of protein supramolecules, the present invention takes the protein cage Encapsulin (Encap) as the research object. Using Encap as the protein capsid to encapsulate therapeutic proteins such as IFN-α within the self-assembled Encap protein, and using chemical click strategy to modify the targeting peptide LinTT1 on the outside of Encap. The constructed coronavirus-like protein delivery system has blood-brain barrier penetrability, realizes targeted therapy of cancer cells (such as glioblastoma multiforme, cervical cancer), and at the same time prolongs the half-life of therapeutic proteins, opening up a new path for their in vivo delivery. In addition, the protein delivery system of the present invention has a low production cost and can be mass-produced, with good application prospects. Description of the Drawings

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only exemplary, and for those of ordinary skill in the art, without creative efforts, other implementation drawings can be obtained according to the provided drawings.

[0029] Figure 1 Characterization of IFN-α@Encap-LinTT1 provided by the present invention;

[0030] Figure 2 Blood-brain barrier penetration effect of eGFP@Encap-LinTT1 provided by the present invention;

[0031] Figure 3 Killing effect of IFN-α@Encap-LinTT1 provided by the present invention on GL261 cells;

[0032] Figure 4 Killing effect of IFN-α@Encap-LinTT1 provided by the present invention on HeLa cells. Detailed Embodiments

[0033] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0034] The present invention provides a coronavirus-like protein delivery system, and its construction process is shown in Figure 1 A-C in

[0035] We first constructed pBAD-Int C -EncapTM-ST plasmid and pET28(a)-IFN-α-Int N plasmid as shown in Figure 1 A, where EncapTM is a protein with self-assembly properties in nature (derived from the hyperthermophilic organism Thermotoga maritima), consisting of 60 identical subunits. These subunits self-assemble to form a hollow spherical icosahedral capsid structure, serving as a main outer shell part of the coronavirus-like protein delivery system. The spherical hollow structure of this protein cage nanoparticle provides two different spaces: the internal space and the outer surface. Therapeutic proteins such as IFN-α can be loaded in the internal space of EncapTM. However, to not affect the self-assembly properties of EncapTM and prevent misassembly of proteins, we introduced the Int C part of the splicing peptide at the C-terminus of EncapTM and the Int N part of the splicing peptide at the N-terminus of the loaded cargo, forming pBAD-Int C -EncapTM-ST and pET28(a)-IFN-α-Int N . These two plasmids are co-expressed in Escherichia coli BL21 to finally form the self-assembled protein IFN-α@EncapTM-ST, where the splicing peptide can effectively help EncapTM capture and encapsulate the loaded cargo as shown in Figure 1 C. The modification of the outer surface in the delivery system EncapTM is achieved by introducing Spy tag, abbreviated as ST, at the N-terminus of EncapTM, and simultaneously introducing Spy catcher, abbreviated as SC, at the C-terminus of the targeting peptide LinTT1 (the peptide modification here can be arbitrarily selected, such as homing peptides, cell-penetrating peptides CPPs, tumor cell-targeting peptides RGD, etc.), forming plasmids pBAD-Int C -EncapTM-ST and pET28(a)-SC-LinTT1 as shown in Figure 1 A and Figure 1As shown in B of [reference], the Spy tag and Spy catcher form an isopeptide bond to complete the surface targeting modification of EncapTM, and the finally formed coronavirus-like protein delivery system is IFN-α@EncapTM-LinTT1. Figure 1 D in [reference] is the SDS-PAGE and WB diagram of the above protein, indicating that the protein size meets the expectation. Figure 1 E in [reference] is the electron microscopy display of the finally formed coronavirus-like protein delivery system. Figure 1 F in [reference] and Figure 1 G in [reference] are the potential and particle size characterizations of this system. Among them, in Figure 1 A in [reference], the Linker can generally be selected as GGSGG, GGSGGGGSGG, etc. Note: Among them, Int N -Int C assembly is a protein trans-splicing belonging to an autocatalytic process, in which two split intein fragments Int N and Int C combine and fold into an active intein, and then remove itself in a seamless manner that links the fusion polypeptide with the natural peptide bond. In the coronavirus-like delivery system IFN-α@Encap-LinTT1, Int N acts as a role of capturing the cargo (IFN-α).

[0036] SpyTag (ST) and SpyCatcher (SC) are split proteins derived from the fibronectin-binding protein FbaB of Streptococcus pyogenes. The 15 kDa SC and the 13-amino acid ST peptide spontaneously form an irreversible isopeptide covalent bond after recognition, and can be individually gene-fused to any type of protein without significantly changing the function of the fusion protein.

[0037] Product working process and function: The coronavirus-like protein delivery system of the present invention can be internally encapsulated by co-expressing with a short half-life therapeutic protein such as IFN-α in Escherichia coli. Then, the targeting peptide LinTT1 modifies the delivery system Encap encapsulating the therapeutic protein to form a targeted nanodrug. Then, the nanodrug is intravenously injected, crosses the blood-brain barrier, and finally performs targeted release of the drug at the cancer cell tumor focus to achieve targeted cancer cell treatment.

[0038] Example 1

[0039] This example provides the preparation of IFN-α@Encap-LinTT1:

[0040] (1) The encoding gene of the protein Int C -Encap-ST was constructed into the Escherichia coli expression plasmid pBAD by molecular cloning technology to obtain recombinant vector 1.

[0041] Protein Int C The nucleotide sequence of the -EncapTM-ST encoding gene (derived from the hyperthermophilic organism Thermotoga maritima) is as follows:

[0042]

[0043] The protein Int N -IFN-α encoding gene (synthesized by PCR of the target gene) was constructed into the Escherichia coli expression plasmid pET-28a(+) by molecular cloning technology to obtain recombinant vector 2.

[0044] The protein Int N -The nucleotide sequence of the IFN-α encoding gene is as follows:

[0045] TGCGATCTGCCGCAGACCCACTCTCTGGGCAGCCGTCGTACCCTGATGCTGCTGGCGCAGATGCGTCGTATCTCTCTGTTCTCTTGCCTGAAAGATCGTCACGATTTCGGTTTCCCGCAGGAAGAATTTGGTAACCAGTTCCAGAAAGCGGAAACCATCCCGGTTCTGCACGAAATGATCCAGCAGATCTTCAACCTGTTCAGCACCAAAGATAGCTCTGCGGCGTGGGATGAAACCCTGCTGGATAAATTCTACACCGAACTGTACCAGCAGCTGAACGATCTGGAAGCGTGCGTTATCCAGGGCGTTGGTGTTACCGAAACCCCGCTGATGAAAGAAGATAGCATCCTGGCGGTTCGTAAATACTTCCAGCGTATCACCCTGTACCTGAAAGAAAAGAAATACTCTCCGTGCGCGTGGGAAGTTGTTCGTGCGGAAATCATGCGTAGCTTCAGCCTGAGCACCAACCTGCAGGAATCTCTGCGTAGCAAAGAAGGTAACTCCGGTGGCGGCCTGGTTGCTGGCGGCTCTGGTGGCGGCTCCGGCACTAGCGCGGAATACTGCCTGTCTTACGAAACCGAAATCCTGACCGTGGAATACGGCCTGTTGCCGATCGGTAAAATCGTTGAAAAACGCATCGAATGCACCGTTTACAGCGTTGATAACAACGGCAACATCTACACCCAGCCGGTTGCGCAGTGGCACGACCGTGGTGAACAGGAAGTTTTCGAATACTGTCTGGAAGATGGTAGCCTGATCCGTGCGACCAAAGATCACAAATTCATGACCGTTGATGGTCAGATGCTGCCGATCGACGAAATCTTTGAACGTGAACTGGATCTGATGCGTGTTGATAACCTGCCGAAC (SEQ ID No.2).

[0046] The gene encoding protein SC-LinTT1 was constructed into the Escherichia coli expression plasmid pET-28a(+) by molecular cloning technology to obtain recombinant vector 3.

[0047] The nucleotide sequence of the protein SC-LinTT1-encoding gene is as follows:

[0048] ATGGTTGATACCCTGAGCGGCCTGAGCAGCGAACAGGGCCAGAGCGGCGATATGACCATCGAAGAAGATAGCGCGACCCACATCAAATTCAGCAAACGTGATGAAGATGGTAAAGAACTGGCGGGCGCGACCATGGAACTGCGTGATAGCAGCGGCAAAACCATCAGCACCTGGATCAGCGATGGCCAGGTTAAAGATTTCTACCTGTATCCGGGCAAATACACCTTCGTTGAAACCGCGGCGCCGGATGGCTACGAAGTTGCGACCGCGATCACCTTCACCGTTAACGAACAGGGCCAGGTTACCGTTAACGGCAAAGCGACCAAAGGCGATGCGCACATCGAATTCGCG (SEQ ID No.3).

[0049] (2) Transform recombinant vector 1 and recombinant vector 2 into Escherichia coli BL21(DE3). Take 10 μL of the bacterial solution and inoculate it into 6 ml of LB liquid medium containing ampicillin and kanamycin antibiotics (50 mg / ml), and culture it overnight at 37°C and 200 rpm. Take 5 ml of the overnight culture and transfer it into 3 L of LB liquid medium containing ampicillin and kanamycin antibiotics (50 mg / ml). When the OD value reaches between 0.4 and 0.6 at 37°C and 200 rpm, add isopropyl β-D-1-thiogalactopyranoside (IPTG) to make its final concentration 0.3 mM, and induce at 16°C and 160 rpm for 4 hours. Then add 0.1% arabinose and continue to induce for 16 hours under the above conditions. Centrifuge the cells at 8000 g for 20 minutes at 4°C to collect the cells. Lyse the cells with Lysis buffer and ultrasonically disrupt them. Centrifuge the disrupted bacterial solution at 8000 rpm for 100 min and collect the supernatant. Purify the protein in the cell lysate through an immobilized metal affinity chromatography Ni-NTA column. Wash buffer is used to elute non-specifically bound miscellaneous proteins, and finally, Elution buffer is used to elute the target protein.

[0050] Identify the size of the recombinant protein by Coomassie Brilliant Blue staining and Western blot of the purified protein through SDS-PAGE, as Figure 1 shown in D of C - The actual molecular weight of the Encap-ST protein is 55 kDa.N The molecular weight of the -IFN-α protein is actually 32 kDa, and the molecular weight of the assembled protein is actually 88 kDa.

[0051] (3) Transform the recombinant vector 3 into Escherichia coli BL21(DE3). Take 10 μL of the bacterial solution and inoculate it into 6 ml of LB liquid medium containing kanamycin antibiotic (50 mg / ml), and culture it overnight at 37 °C and 200 rpm. Take 5 ml of the overnight culture and transfer it into 3 L of LB liquid medium containing kanamycin antibiotic (50 mg / ml), and culture it at 37 °C and 200 rpm until the OD value is between 0.4 - 0.6. Then add isopropyl β-d-1-thiogalactopyranoside (IPTG) to a final concentration of 0.3 mM, and induce protein expression at 16 °C and 160 rpm for 20 hours. Centrifuge the cells at 8000 g for 20 minutes at 4 °C to collect the cell pellet. Lyse the cell pellet with Lysis buffer, sonicate it, and centrifuge the lysed bacterial solution at 8000 rpm for 100 min to collect the supernatant. Purify the protein in the cell lysate through an immobilized metal affinity chromatography Ni-NTA column. Wash buffer is used to elute non-specifically bound miscellaneous proteins, and finally, Elution buffer is used to elute the target protein to obtain the expressed protein SC-LinTT1 (the actual molecular weight is 18 kDa).

[0052] (4) Concentrate the eluted self-assembled protein IFN-α@Encap-ST and protein SC-LinTT1 using an ultrafiltration tube (Millipore UFC910096, USA) at 3400 rpm and replace them with PBS, phosphate buffer (50 mM K2HPO4 and 100 mM NaCl, pH 7.4), and Tris-HCl to 1.5 mg / ml respectively. Mix IFN-α@Encap-ST and LinTT1-SC at different ratios of 2:8, 4:6, 5:5, 6:4, 1:10, 10:1, and 8:2 to prepare a series of mixtures. Then incubate these mixtures at 16 °C for 12 h, take samples for SDS-PAGE, and place the remaining samples at 4 °C. As Figure 1 shown in the SDS-PAGE gel diagrams of F and G in

[0053] After the protein delivery system reacts in these three solutions of PBS, phosphate buffer (50 mM K2HPO4 and 100 mM NaCl, pH 7.4), and Tris-HCl at the same ratio and reaction conditions, samples are taken for detection. SDS-PAGE and TEM images show that the buffer with the best effect of LinTT1-modified IFN-α@Encap is phosphate buffer, and the ratio is 1:10 ( Figure 1The coronavirus-like protein delivery system IFN-α@Encap-LinTT1 was obtained with F, G, H in (). There were few successfully modified samples in other ratios and buffers.

[0054] Example 2

[0055] This example provides the characterization of IFN-α@Encap-LinTT1:

[0056] Place 10 μL of the sample on a carbon-coated copper grid (Electron Microscopy Sciences), incubate for 1 min, and remove the residual solution with filter paper. Place 5 μL of uranyl acetate (1% w / v) on the grid and incubate for 1 min. Remove the excess uranyl acetate solution with filter paper and air-dry the sample overnight before imaging. The prepared grid was observed on an HT7800 transmission electron microscope (TEM) equipped with a 100 kV (FEI) cathode (LaB6, FEI), and electron microscope (TEM) images were recorded using an UltraScan 1000 charge-coupled device (CCD) camera (Gatan). The Zetasizer Nano-zs90 (Malvern) laser was operated at 25 °C, with a laser wavelength of 633 nm and a scattering angle of 90°. The sample was filtered (pore size 0.22 μm, MilliporeCorp.) before analysis. All data were analyzed using Zetasizer software 6.32.

[0057] The TEM and DLS characterizations of the obtained finished product IFN-α@Encap-LinTT1 are as Figure 1 shown in E, H, I in (). The peak particle size of IFN-α@Encap-LinTTI was 43.49 nm, and the overall particles were negatively charged.

[0058] Example 3

[0059] This example provides the blood-brain barrier penetration effect of eGFP@Encap-LinTT1. The construction method of eGFP@Encap-LinTT1 was the same as that in Example 1, except that eGFP was used to replace IFN-α.

[0060] Hecat and G261 cells were cultured in DMEM medium containing 10% FBS and 1% double antibody respectively. A Milli hanging culture insert was added to a 24-well plate (transwell). Hacat cells were seeded in the upper chamber at a density of 5×10 4 cells, and G261 cells were seeded in the lower chamber at a density of 5×10 4Cells were seeded at a density on round coverslips at the bottom of the lower chamber. eGFP@Encap-LinTT1 (2 μg / ml) was added to the upper chamber at 2.5%, 5%, and 10%. After treatment, the luminescence of the cells in the lower chamber was observed under a microscope. The results showed that the coronavirus-like protein delivery system without the therapeutic protein IFN-α of the present invention had good blood-brain barrier penetration effect as Figure 2 shown.

[0061] Example 4

[0062] This example provides an in vitro anti-tumor detection protocol for IFN-α@Encap-LinTT1:

[0063] GL261 cells were cultured in DMEM medium containing 10% FBS and 1% double antibody. Nano-drugs (IFN-α@Encap-LinTT1 of Example 1) at 2.5%, 5%, 10%, and 20% and IFN-α were added respectively. The cytotoxic effect of the nano-drug on the cells was detected by live / dead staining. The results showed that both IFN-α@Encap-LinTTI and IFN-α had a killing effect on GL261 cancer cells, and IFN-α@Encap-LinTT1 had an obvious effect on killing GL261 cells at a concentration of 5% as Figure 3 shown in B of. In addition, the CCK8 experiment was used to detect the effect of nano-drugs (IFN-α@Encap-LinTT1 of Example 1) at different concentrations of 2.5%, 5%, 10%, and 20% and IFN-α on the viability of GL261 cells, and it was normalized to the medium control. All tests were repeated three times. The results showed that the nano-drug IFN-α@Encap-LinTT1 enhanced the cytotoxicity of IFN-α as Figure 3 shown in A of. Cells were seeded in six-well plates and scratch experiments were performed to detect the effect of the nano-drug IFN-α@Encap-LinTT1 on cell migration. The results showed that 20% of IFN-α@Encap-LinTT1 significantly inhibited the migration of GL261 cells as Figure 3 shown in C and D of. GL261 cells were cultured in small dishes, and then GL261 cells were treated with 10% nano-drug IFN-α@Encap-LinTTI and IFN-α respectively. 7-AAD staining working solution was added and resuspended into a single-cell suspension. The cells were incubated at 37 °C for 10 min, and then screened by a flow cytometer (BD, SORP ARIAIII). After evaluation, the cytotoxic effects of the nano-drug IFN-α@Encap-LinTT1 and IFN-α itself on GL261 cells were compared. The results showed that the nano-drug IFN-α@Encap-LinTT1 enhanced the cytotoxicity of IFN-α to GL261 cells as Figure 3In it, E, namely IFN-α@Encap-LinTT1, enhanced the anti-glioblastoma cell effect of IFN-α.

[0064] HeLa cells were cultured in DMEM medium containing 10% FBS and 1% penicillin-streptomycin. Nano-drugs (IFN-α@Encap-LinTT1 of Example 1) containing 2.5%, 5%, 10%, and 20% and IFN-α were added respectively. The effect of the nano-drug on cell toxicity was detected by live / dead staining. The results showed that both IFN-α@Encap-LinTT1 and IFN-α had a killing effect on HeLa cells, and IFN-α@Encap-LinTT1 had an obvious HeLa cell killing effect at a concentration of 5% as Figure 4 A and B in it. In addition, the effect of nano-drugs (IFN-α@Encap-LinTT1 of Example 1) with different concentrations of 2.5%, 5%, 10%, and 20% and IFN-α on the viability of G261 cells was detected by CCK8 assay and normalized to the medium control. All tests were repeated three times. The results showed that IFN-α@Encap-LinTT1 enhanced the cytotoxicity of IFN-α as Figure 4 C in it. Cells were seeded in six-well plates and scratch assays were performed to detect the effect of the nano-drug IFN-α@Encap-LinTT1 on cell migration. The results showed that 20% IFN-α@Encap-LinTT1 significantly inhibited the migration of HeLa cells as Figure 4 D and E in it. The above content indicates that IFN-α@Encap-LinTT1 enhanced the toxicity of IFN-α to HeLa cells, that is, IFN-α@Encap-LinTT1 enhanced the anti-cervical cancer cell effect of IFN-α.

[0065] Although the present invention has been described in detail above with general descriptions and specific examples, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

[0066] Sequence Listing

[0067] <110> Zhongke Zhicao (Zhejiang) Technology Co., Ltd.

[0068] <120> A Coronavirus-like Protein Delivery System and Its Preparation Method and Application

[0069] <130> GG241434164A

[0070] <160> 3

[0071] <170> PatentIn version 3.5

[0072] <210> 1

[0073] <211> 1113

[0074] <212> DNA

[0075] <213> Artificial series

[0076] <400> 1

[0077] atgattaaaa tcgcgacccg taaatacctg ggtaaacaga acgtttatga tatcggcgtt 60

[0078] gaacgtgatc acaacttcgc gctgaaaaac ggttttatcg cgtctaactg cttcaacggc 120

[0079] ggtggtggta gcggtggtgg tggttccggt ggcggtggct ctggcaccgg tggtagcgaa 180

[0080] tttctgaaac gttccttcgc gccgctgacc gaaaaacagt ggcaggaaat tgataaccgt 240

[0081] gcgcgtgaaa tcttcaaaac ccagctgtac ggtcgtaaat tcgttgatgt tgaaggtccg 300

[0082] ggcggcggtg gcggtcacca ccaccatcac cacgcttccg gtggtggtgg tggctacggc 360

[0083] tgggaatacg cagcgcaccc gctgggtgaa gttgaagttc tgtccgacga aaacgaagtt 420

[0084] gttaaatggg gcctgcgtaa aagcctgccg ctgatcgaac tgcgcgctac cttcaccctg 480

[0085] gacctgtggg aactggacaa cctggaacgt ggtaaaccga acgttgatct gagctctctg 540

[0086] gaagaaaccg ttcgtaaagt tgccgaattt gaagatgaag tgatcttccg tggttgtgaa 600

[0087] aaatccggtg ttaaaggtct gctgagcttc gaagaacgta aaatcgaatc tggctccacc 660

[0088] ccgaaagatc tgctggaagc gattgtgcgc gcgctgagca tcttctctaa agatggcatc 720

[0089] gaaggcccgt acaccctggt tatcaacacc gaccgttgga tcaacttcct gaaagaagaa 780

[0090] gcaggtcact acccgctgga aaaacgtgtt gaagaaagcc tgcgcggcgg caaaattatc 840

[0091] accactccgc gtattgaaga tgccctggtt gtgtctgaac gtggtggcga cttcaaactg 900

[0092] atcctgggcc aggatctgag catcggttac gaagatcgtg aaaaagatgc ggttcgtctg 960

[0093] ttcatcaccg aaaccttcac cttccaggtt gtgaacccgg aagcgctgat cctgctgaaa1020

[0094] ttcgaaccgc cgccgccgct gccaccgccg ccggaaccgc cgccgccggg tagcgcgcac1080

[0095] atcgttatgg ttgatgcgta caaaccgacc aaa 1113

[0096] <210> 2

[0097] <211> 867

[0098] <212> DNA

[0099] <213> Artificial sequence

[0100] <400> 2

[0101] tgcgatctgc cgcagaccca ctctctgggc agccgtcgta ccctgatgct gctggcgcag 60

[0102] atgcgtcgta tctctctgtt ctcttgcctg aaagatcgtc acgatttcgg tttcccgcag 120

[0103] gaagaatttg gtaaccagtt ccagaaagcg gaaaccatcc cggttctgca cgaaatgatc 180

[0104] cagcagatct tcaacctgtt cagcaccaaa gatagctctg cggcgtggga tgaaaccctg 240

[0105] ctggataaat tctacaccga actgtaccag cagctgaacg atctggaagc gtgcgttatc 300

[0106] cagggcgttg gtgttaccga aaccccgctg atgaaagaag atagcatcct ggcggttcgt 360

[0107] aaatacttcc agcgtatcac cctgtacctg aaagaaaaga aatactctcc gtgcgcgtgg 420

[0108] gaagttgttc gtgcggaaat catgcgtagc ttcagcctga gcaccaacct gcaggaatct 480

[0109] ctgcgtagca aagaaggtaa ctccggtggc ggcctggttg ctggcggctc tggtggcggc 540

[0110] tccggcacta gcgcggaata ctgcctgtct tacgaaaccg aaatcctgac cgtggaatac 600

[0111] ggcctgttgc cgatcggtaa aatcgttgaa aaacgcatcg aatgcaccgt ttacagcgtt 660

[0112] gataacaacg gcaacatcta cacccagccg gttgcgcagt ggcacgaccg tggtgaacag 720

[0113] gaagttttcg aatactgtct ggaagatggt agcctgatcc gtgcgaccaa agatcacaaa 780

[0114] ttcatgaccg ttgatggtca gatgctgccg atcgacgaaa tctttgaacg tgaactggat 840

[0115] ctgatgcgtg ttgataacct gccgaac 867

[0116] <210> 3

[0117] <211> 351

[0118] <212> DNA

[0119] <213> Artificial sequence

[0120] <400> 3

[0121] atggttgata ccctgagcgg cctgagcagc gaacagggcc agagcggcga tatgaccatc 60

[0122] gaagaagata gcgcgaccca catcaaattc agcaaacgtg atgaagatgg taaagaactg 120

[0123] gcgggcgcga ccatggaact gcgtgatagc agcggcaaaa ccatcagcac ctggatcagc 180

[0124] gatggccagg ttaaagattt ctacctgtat ccgggcaaat acaccttcgt tgaaaccgcg 240

[0125] gcgccggatg gctacgaagt tgcgaccgcg atcaccttca ccgttaacga acagggccag 300

[0126] gttaccgtta acggcaaagc gaccaaaggc gatgcgcaca tcgaattcgc g 351

Claims

1. A method for preparing a coronavirus-like protein delivery system, characterized in that, The method includes: (1) Constructing recombinant vector 1 carrying the nucleotide sequence shown in SEQ ID No.1, recombinant vector 2 carrying the nucleotide sequence shown in SEQ ID No.2, and recombinant vector 3 carrying the nucleotide sequence shown in SEQ ID No.3; (2) Co-expressing recombinant vector 1 and recombinant vector 2 to obtain the self-assembled protein IFN-α@Encap-ST; (3) Expressing recombinant vector 3 to obtain the protein SC-LinTT1; (4) Performing a chemical click reaction between IFN-α@Encap-ST and SC-LinTT1 to obtain the coronavirus-like protein delivery system; The mass ratio of IFN-α@Encap-ST to SC-LinTT1 is 1:10; The chemical click reaction is carried out in the presence of a phosphate buffer solution; The conditions for the chemical click reaction are: 16 °C, 200 rpm, 12 h.

2. The method for preparing the coronavirus-like protein delivery system according to claim 1, wherein The expression vector of recombinant vector 1 is pBAD, the expression vector of recombinant vector 2 is pET-28a(+), and the expression vector of recombinant vector 3 is pET-28a(+).

3. The preparation method of the coronavirus-like protein delivery system according to claim 1, characterized in that, The method for preparing the self-assembled protein IFN-α@Encap-ST is as follows: Transforming recombinant vector 1 and recombinant vector 2 into Escherichia coli BL21(DE3), inoculating into an LB liquid medium containing ampicillin and kanamycin antibiotics, culturing until the OD value reaches 0.4 - 0.6, adding IPTG with a final concentration of 0.3 mM, inducing at 16 °C and 200 rpm for 4 h, then adding arabinose with a final concentration of 0.1%, inducing at 16 °C and 200 rpm for 16 h, collecting the bacterial cells, lysing, ultrasonically disrupting, and purifying to obtain the self-assembled protein IFN-α@Encap-ST.

4. The preparation method of the coronavirus-like protein delivery system according to claim 1, characterized in that, The method for preparing the protein SC-LinTT1 is as follows: Transforming recombinant vector 3 into Escherichia coli BL21(DE3), inoculating into an LB liquid medium containing kanamycin antibiotic, culturing until the OD value reaches 0.4 - 0.6, adding IPTG with a final concentration of 0.3 mM, inducing at 16 °C and 160 rpm for 20 h, collecting the bacterial cells, lysing, ultrasonically disrupting, and purifying to obtain the protein SC-LinTT1.

5. A coronavirus-like protein delivery system, characterized in that, It is prepared by the method described in any one of claims 1 - 4.

6. The application of the coronavirus-like protein delivery system prepared by the preparation method described in any one of claims 1 - 4 in the preparation of a therapeutic protein delivery system.

7. Use of the coronavirus-like protein delivery system according to claim 5 in the preparation of an anti-cancer drug, characterized in that, The cancer is glioblastoma or cervical cancer.

Citation Information

Patent Citations

  • Application of targeting peptide in preparation of delivery carrier for delivering RNA (Ribonucleic Acid) medicine and RNA medicine for targeting cells

    CN117860906A

  • Recombinant protein cpE2 of repetitive structure unit as well as preparation method and application of recombinant protein cpE2

    CN119505021A