Corynebacterium glutamicum capable of efficiently secreting recombinant protein as well as preparation method and application of corynebacterium glutamicum

Abstract

The invention provides corynebacterium glutamicum capable of efficiently secreting and expressing protein as well as a preparation method and application of the corynebacterium glutamicum. The corynebacterium glutamicum CSQ-CT3 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC NO: 30697, the preservation date is May 20, 2024, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the Omp7 secretion yield in the corynebacterium glutamicum CT3-28 strain is about 231.5 mg.L <-1 >, the Omp7 secretion yield in the WT strain is about 196.7 mg.L <-1 >, and compared with a wild type, the yield of Omp7 protein is increased by 84.9%.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to Corynebacterium glutamicum which efficiently secretes recombinant protein, and a preparation method and application thereof. Background Art

[0002] In the field of modern biological science and bioengineering, C. glutamicum is a microbial cell that has been widely studied and applied, mainly because it can serve as a platform for the sustainable production of various organic small molecules, polymer precursors, aromatic compounds and recombinant proteins. Many teams have significantly improved the production capacity and efficiency of C. glutamicum through a series of innovative methods. For example, Wang et al. successfully increased the production of hyaluronic acid to 74.1 g·L by enhancing the expression of a certain hyaluronan synthase and adjusting the related metabolic pathways. -1 Messerschmidt's team focused on improving C. glutamicum's ability to produce ketoisocaproic acid. They adjusted the metabolic pathway through gene editing technology and achieved 9.2 g·L -1 Sasaki and his team used genetic engineering methods to overexpress specific proteins and adjust metabolic pathways, significantly increasing the production of isopentenol, a compound that was originally difficult to detect in C. glutamicum, to 1.25 g·L-1; Zha et al. successfully produced special anthocyanins in C. glutamicum by using low-cost catechins as precursors, and increased the yield by more than 100 times to 40 mg·L-1 by optimizing the synthesis pathway. -1 These groundbreaking studies not only demonstrate the great potential of C. glutamicum in producing recombinant proteins and other useful compounds, but also provide valuable knowledge and technical foundation for the future use of this microbial chassis cell for wider applications. In addition, C. glutamicum has also been used to produce a variety of pharmaceutical proteins, such as human intrinsic factor, single-chain antibodies, etc., opening up the application prospects of C. glutamicum in the field of biomedicine.

[0003] The existing mutant library caused by ARTP mutagenesis is huge and the traditional screening methods are inefficient, such as direct plate plating, automatic colony picking instrument, flow sorting, etc., which have relatively small throughput and are time-consuming, require a large amount of expensive reagents to increase costs, and cannot eliminate the interference of many false positives during the screening process. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a Corynebacterium glutamicum that efficiently secretes recombinant proteins.

[0007] To solve the above technical problems, the present invention provides the following technical solution: a Corynebacterium glutamicum that efficiently secretes recombinant proteins, characterized in that: the Corynebacterium glutamicum CSQ-CT3 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC NO: 30697, a deposit date of May 20, 2024, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] As a preferred embodiment of the Corynebacterium glutamicum of the present invention, the Corynebacterium glutamicum mutagenesis strain is prepared into a competent state using Corynebacterium glutamicum with a preservation number of CGMCC1.15647 as a starting strain.

[0009] As a preferred embodiment of the Corynebacterium glutamicum of the present invention, the Corynebacterium glutamicum mutagenic strain is prepared by combining ARTP mutagenesis technology and fluorescence activated droplet sorting technology screening technology.

[0010] As a preferred embodiment of the Corynebacterium glutamicum of the present invention, the fluorescence-activated droplet sorting technology includes droplet generation, droplet culture, droplet fusion, picoliter syringe, droplet detection and sorting.

[0011] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for increasing the yield of recombinant protein.

[0012] As a preferred embodiment of the method of the present invention, it includes inoculating Corynebacterium glutamicum into LBB culture medium at an inoculation volume ratio of 1:10, fermenting at 30°C and pH 7, and collecting the bacteria.

[0013] As a preferred embodiment of the method of the present invention, the formula of the LBB medium is: weigh 10.0 g·L NaCl -1 , weigh 10.0 g·L brain heart extract -1, weigh 5.0 g·L yeast extract powder -1 , weigh 10.0 g·L peptone -1 .

[0014] As a preferred embodiment of the method of the present invention, the fermentation time is 60 to 80 hours.

[0015] Another object of the present invention is to overcome the deficiencies in the prior art and provide an application of Corynebacterium glutamicum in increasing the yield of recombinant proteins.

[0016] As a preferred embodiment of the application of the present invention, the recombinant proteins include but are not limited to Omp7, VHH, PINP, Rhv3 and ApxII.

[0017] Beneficial effects of the present invention:

[0018] 1. The secretion yield of Omp7 in the Corynebacterium glutamicum CT3-28 strain of the present invention is about 231.5 mg·L -1 The secretion yield of Omp7 in the WT strain was approximately 196.7 mg·L -1 , the production of Omp7 protein increased by 84.9% compared with the wild type.

[0019] 2. The method of the present invention causes less biological damage and can cause a wide range of genetic variations, can induce a variety of DNA damage, obtain a large-capacity mutation library, and ensure the acquisition of positive mutant strains with stable traits, which not only improves the survival rate of cells and the accuracy of mutations, but also maintains genetic stability and is easy to operate. In addition, the ARTP mutagenizer does not emit any chemical pollutants or toxic substances during use, and the electromagnetic pollution is far below the international standard, which is safe for operators and does not require special protection.

[0020] 3. The method of the present invention can process multiple droplets at the same time, realize high-throughput processing and separation, and greatly improve the experimental efficiency; through electronic and machine program control, droplet microfluidics can reduce the interference of human factors and ensure the accuracy and precision of the experiment; droplet microfluidics can divide the sample into a large number of tiny droplets, minimize the waste of samples, and is particularly suitable for the processing of precious samples; the droplets are surrounded by immiscible oil, which inhibits the evaporation and diffusion of sample molecules and stabilizes the reaction conditions; each droplet is wrapped by an immiscible oil phase, avoiding the exchange of substances between adjacent droplets and eliminating the contamination between samples; the movement of droplets in the channel forms a circulation reflux, which accelerates the mixing speed; the discrete micro-droplet manipulation system reduces the requirements for chip production and simplifies the operation of the device; by dividing the continuous flow into dispersed flow (micro-droplets), reagent waste is avoided and the demand for samples and reagents is reduced; in addition, the volume of each micro-droplet is only in the picoliter order, which reduces the demand for reagents by a million times compared with the traditional microliter to milliliter system, providing significant economic benefits for analyzing expensive samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0022] Figure 1 The SDS-PAGE analysis of the secretion yield of Omp7 protein in the mutant strain in Example 1.

[0023] Figure 2 It is the SDS-PAGE gray value of the secretory expression of Omp7 protein in Example 1.

[0024] Figure 3 Schematic diagram of the color development principle of FlAsH-TC in Example 2.

[0025] Figure 4 is the fluorescence signal value of the Omp7-TC protein reaction in Example 2. SDS-PAGE was used to analyze the expression of the four recombinant proteins in the mutant strains.

[0026] Figure 5 This is the correlation analysis between the fluorescence value of the FlAsH-TC reaction in Example 2 and the gray value of the secretory expression of Omp7.

[0027] Figure 6 The mortality rate and positive mutation rate of the Cg-pXMJ-omp7-TC strain in Example 3 at different ARTP mutagenesis times.

[0028] Figure 7 is the classification threshold for the four rounds of fluorescence-activated droplet sorting in Example 4.

[0029] Figure 8 This is the SDS-PAGE analysis of the secretion yield of Omp7 protein in the mutant strain in Example 4.

[0030] Fig. 9 This is the fluorescence value determination of the mutant strain FlAsH-TC reaction in Example 4.

[0031] Fig.10 These are the fluorescence values ​​for the four rounds of FADS screening in Example 4.

[0032] Fig.11 The growth curve of the mutant strain in Example 5 and the fluorescence values ​​at different culture times.

[0033] Fig.12 OD600 values ​​and fluorescence values ​​of the WT strain and the CT3-28 mutant strain in Example 5 after 10 rounds of passage, respectively.

[0034] Fig.13 This is the verification result of the fluorescence values ​​of the mutant strain and mutant plasmid in Example 6.

[0035] Fig.14 This is the SDS-PAGE analysis of the expression of the four recombinant proteins in the mutant strain CT3 in Example 7.

[0036] Fig.15 The expression and growth of Omp7 protein in Example 8, wherein ab is the SDS-PAGE analysis of the expression and growth of Omp7 protein in the WT strain; cd is the SDS-PAGE analysis of the expression and growth of Omp7 protein in the CT3-28 mutant strain; ef is the SDS-PAGE analysis of the BSA standard sample protein and the BSA standard curve. DETAILED DESCRIPTION

[0037] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0038] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0039] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0040] Raw materials and reagents used in the present invention:

[0041] 1. PBS buffer: weigh 0.24 g·L KH2PO4 -1 , weigh 8.0 g·L NaCl -1 , weigh 1.44 g·L Na2HPO4 -1 , weigh 0.2g·L KCl -1 , weigh NaOH and adjust the pH to 7.4.

[0042] 2.5× protein electrophoresis buffer: weigh 5.0 g·L SDS -1 , weigh 94.0 g·L glycine -1 , weigh Tris 15.1 g·L -1 .

[0043] 3. Enzyme lysis buffer: weigh 1.2% Triton X -1 00; weigh 2mmol·L -1 Na2-EDTA; weigh 20mmol·L -1 Tris, pH 8.0; final concentration 20.0 mg mL -1 of lysozyme.

[0044] 4.LBB medium: weigh 10.0 g·L NaCl -1 , weigh 10.0 g·L brain heart extract -1 , weigh 5.0 g·L yeast extract powder -1 , weigh 10.0 g·L peptone -1 .

[0045] 5. BHI medium: weigh 37.5 g·L brain heart infusion -1 .

[0046] 6. EPO medium: weigh 5.0 g·L yeast extract -1 , weigh 1 mL of Tween 80, weigh 5.0 g·L of isoniazid -1 , weigh 10.0 g·L NaCl -1 , weigh 25.0 g·L glycine -1 , weigh 10.0 g·L peptone -1 , and adjust the pH to 6.8-7.0.

[0047] 7.LBHIS medium: weigh 91.0 g·L sorbitol -1 , weigh 18.5 g·L brain heart extract -1 , weigh 5.0 g·L NaCl -1 , weigh 5.0 g·L peptone -1 , weigh 10.0 g·L yeast extract powder -1 .

[0048] 8.5L fermentation tank medium CGF: weigh 30.0g·L glucose -1 , weigh 30.0 g·L BHI -1 , weigh KH2PO41.0g·L -1 , weigh (NH4)2SO420.0g·L -1 , weigh MgSO41.0g·L -1 .

[0049] 9. Feed medium: weigh 300.0 g·L glucose -1 .

[0050] 10. Preparation of CGXII Medium

[0051] (1) Preparation of reagent stock solution

[0052] MgSO4 mother solution: 12.5 g of MgSO4·7H2O is dissolved in 50 mL of water (stored at room temperature).

[0053] CaCl2 mother solution: 500 mg of CaCl2 is dissolved in 50 mL of water (stored at room temperature).

[0054] Biotin stock solution: 10 mg of biotin is dissolved in 50 mL of water (needs to be stored at 4°C).

[0055] Trace element mother solution (1000 times concentration): 5g FeSO4·7H2O, 5g MnSO4·H2O, 0.5g ZnSO4·7H2O, 156.5mg CuSO4·5H2O, and 1mg NiCl2·6H2O are dissolved in 500mL water, the pH value is adjusted to 1.0 with hydrochloric acid, and after filtration and sterilization, it is divided into portions and stored at 4°C.

[0056] Protocatechuic acid stock solution: Dissolve 300 mg of protocatechuic acid in 1 mL of 1 M NaOH, add water to 10 mL, filter sterilize and store at -20°C.

[0057] Glucose solution: Dissolve 2 g of glucose in 5 mL of water, filter and sterilize, and store at 4°C.

[0058] (2) Prepare CGXII basic solution: 0.1 g K2HPO4, 2 g (NH4)2SO4, 0.5 g urea, 0.1 g K2HPO4, 4.2 g MOPS, add 100 μL CaCl2, MgSO4, and biotin stock solution respectively, adjust the pH to 7.0 with 4 M NaOH, adjust the volume of the solution to 95 mL, and sterilize by high pressure steam at 121 °C for 20 min.

[0059] (3) Preparation of CGXII medium: Take 4.75 mL of CGXII basic solution and place it in a 10 mL centrifuge tube, add 250 mL of glucose solution, 5 μL of trace element stock solution and 5 μL of protocatechuic acid stock solution. After adding protocatechuic acid and iron, the medium will appear pink or violet.

[0060] 11. CGXII-YT medium: Add 1.0 g·L of peptone to the original CGXII medium -1 , yeast extract powder 1.0g·L -1 .

[0061] 12. CGXII-YTOP medium: Add 10.0 g·L glucose to the original CGXII-YT medium -1 , soybean protein 18.0g·L -1 .

[0062] Unless otherwise specified, the raw materials and reagents used in the present invention are commercially available.

[0063] The methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0064] Example 1

[0065] 1. Construction of recombinant plasmids pXMJ19-omp7-TC and pXMJ19-omp7

[0066] (1) Primer design

[0067] With reference to the gene map sequence of Corynebacterium glutamicum / Escherichia coli shuttle plasmid pXMJ19 (GeneBank NO: AJ133195) in the GenBank database, specific upstream primers and downstream primers were designed using SnapGene. The primer names and sequences are shown in Table 1. Primer synthesis and sequencing were completed by Suzhou GeneWeichi Company.

[0068] Table 1 PCR primers

[0069]

[0070] Note: The bold part in 1 is the TC tag sequence

[0071] (2) PCR reaction system

[0072] Take a 0.2mL PCR reaction tube and add each reagent in sequence using a pipette of appropriate range (note that the pipette tip must be changed after each reagent is added) (Table 2).

[0073] Table 2 PCR amplification system

[0074]

[0075] (3) PCR amplification

[0076] Place the PCR tube in the PCR instrument and perform amplification according to the following procedure:

[0077] 95℃ 5min; 95℃ 30s; 58℃ 30s; 72℃ 40s / 210s; cycle 28 times: 72℃ 10min.

[0078] (4) Electrophoresis detection of PCR products

[0079] Gel preparation: Weigh 0.2 g of agarose into a 100 mL beaker, add 20 mL of TAE and heat to melt until there is no agarose granules, cool to about 60 °C, add Glodview (final concentration 0.5 g / mL), shake well, and immediately pour into the pre-combed gel mold and solidify for 30 minutes.

[0080] Sample addition: Take 5 μL of PCR product and add sample buffer for electrophoresis detection. Add the sample and 5 μL of DNA molecular weight standard sample to the comb hole respectively.

[0081] Electrophoresis: Constant voltage 200-220V, electrophoresis for about 20-40 minutes; after electrophoresis, turn off the power and take out the gel; use a gel imager to take pictures and record.

[0082] (5) Purification of PCR products

[0083] Add an equal volume of solution I (an appropriate amount of anhydrous ethanol has been added before use) and mix well; add the sample mixed with an equal volume of solution I to the DNA purification column and place at room temperature for 1 minute; centrifuge at 12000rpm for 1 minute, and discard the liquid in the collection tube; add 700μL solution II to the DNA purification column and place at room temperature for 1 minute; centrifuge at 12000rpm for 1 minute to wash away impurities and discard the liquid in the collection tube; add 500μL solution II, centrifuge at 12000rpm for 1 minute, further wash away impurities, and discard the liquid in the collection tube; centrifuge at 12000rpm for 1 minute to remove the remaining liquid and allow the ethanol to fully evaporate; place the DNA purification column on a 1.5mL centrifuge tube, add 50mL solution III to the column surface in the tube, place for 1 minute; centrifuge at 12000rpm for 1 minute, and the resulting liquid is high-purity DNA

[0084] (6) Determination of product concentration after PCR purification

[0085] When measuring the concentration, first use 2 μL of sterile water to zero the machine, then use a pipette to draw 2 μL of the product for measurement, and obtain the concentration of the purified gene fragment and record it. Store in a 4°C refrigerator.

[0086] (7) Homologous recombination system

[0087] The PCR product was connected to the vector by adding the reaction system according to the data in Table 3 and placing it in a constant temperature water bath at 50°C for 1 h.

[0088] Table 3 Homologous recombination system

[0089]

[0090] 2. Electroporate the recombinant plasmids pXMJ19-omp7-TC and pXMJ19-omp7 into the Gubang

[0091] (1) Preparation of Corynebacterium glutamicum competent cells

[0092] 100 μL of Corynebacterium glutamicum culture was inoculated into 2 mL of LBB medium and cultured at 200 rpm and 30°C for 12 h. 10% was transferred into 30 mL of Epo culture medium (30 mL / 250 mL Erlenmeyer flask) and cultured at 200 rpm and 30°C for 3-5 h (to make OD 600Reach between 0.6-0.9). Place the bacterial solution in an ice bath for 15 minutes, centrifuge at 4000rpm, 4℃ for 10 minutes, and discard the supernatant. Take about 30ml of pre-cooled 10% glycerol, fully suspend the bacteria, and centrifuge at 4000rpm, 4℃ for 10 minutes. Take pre-cooled 10% glycerol and repeat the wash twice. Resuspend the cells with 400μL of pre-cooled 10% glycerol, and dispense into 1.5mL centrifuge tubes, 80μL per tube, and store at -70℃ or directly electro-transform.

[0093] (2) Electrotransformation of Corynebacterium glutamicum

[0094] Place freshly prepared competent cells (or taken out of a -70℃ refrigerator and cooled to 0℃) on ice and flick the tube wall to mix. Pipette 5μL of pre-cooled plasmid on ice (the plasmid that was sequenced correctly in Experiment 3) and add it to the centrifuge tube of competent cells; flick the tube wall to mix the cells and plasmid, and place on ice for 5-10 minutes. Add to the pre-cooled 0.1cm electric shock cup, and shock twice at 1.8kv, 5ms. Add 1mL of recovery medium (liquid LBHIS) and mix. Incubate in a 46℃ water bath for 6min. Incubate at 30℃, 200rpm for 1h. Centrifuge at 10000rpm for 2min and discard the supernatant. When there is 100-200μL of bacterial solution left, mix and spread on the LBHIS plate containing kanamycin and incubate at 30℃ for 24h. Observe the growth of the colonies, pick a single colony to LBB (chloramphenicol) liquid culture medium, and incubate at 30℃ for 36h.

[0095] (3) SDS-PAGE electrophoresis verification

[0096] Preparation of protein samples: Place the above-mentioned bacterial liquid cultured for 4, 8, 12, 16, 20, 24, 28, 32, and 36 hours in 9 centrifuge tubes, centrifuge at 5000rpm, 4℃ for 2min, take 80μL of supernatant to a new EP tube, add 20μL of loading buffer, put the sample in a water bath, and boil it in water for 10min. Preparation of SDS gel: Install the gel plate, add clean water, wait for 3 to 5min, if the liquid level does not drop, the installation seal is intact, if the liquid level drops, repeat the experimental steps until the seal is intact. Add 4mL 12.5% ​​separation gel solution, 4mL 12.5% ​​separation gel buffer solution, and 70μL modified ammonium sulfate solution to the beaker, shake well after adding, and slowly pour into the installed gel plate. Take another beaker and add 1mL 12.5% ​​concentrated gel solution, 1mL 12.5% ​​colored concentrated gel buffer solution, and 14μL modified ammonium sulfate solution. Shake well and add to the above gel plate, and quickly add the gel comb in the electrophoresis tank to avoid bubbles. After standing for 30 minutes, the gel preparation is completed.

[0097] Gel plate installation and spotting: After taking out the prepared gel plate and installing the gel comb into the electrophoresis tank, add the protein gel buffer solution from the middle, and overflow to both sides after filling, until the liquid level in the gel plate in the electrophoresis tank is slightly higher than the external liquid level. Add 5μL of three-color pre-stained protein Maker to the first groove, then use a pipette to absorb the prepared protein sample, slowly add it to the groove in the gel plate, cover the gel electrophoresis tank cover, connect the positive pole to the positive pole, and the negative pole to the negative pole. Set the voltage to 110V and run the electrophoresis for about 1h.

[0098] Gel staining and destaining: Take the gel after electrophoresis, put it in a water tank, add gel staining solution until it covers the gel, stain for about 2 hours, then pour out the staining solution, add destaining solution, cover the gel again, destain for 4-6 hours, and replace the destaining solution in the middle to ensure the destaining effect. Record protein imaging information: Take the destaining gel and use the gel imaging system to record the protein band information, such as Figure 1 As shown, according to Figure 1 Draw a grayscale value map such as Figure 2 shown.

[0099] (4) Strain preservation: Pick a single colony of the correctly constructed Cg-pXMJ-omp7-TC and Cg-pXMJ-omp7 strains and place them in LBB (30 μg / mL chloramphenicol) liquid culture medium at 3000 rpm and 30°C for 3 h. Mix the sterilized 50% glycerol with the above bacterial solution in a 1:1 ratio and place in a bacterial preservation tube and store at -70°C.

[0100] Example 2 Reliability of FlAsH-TC in monitoring the secretion expression of Omp7 protein

[0101] 1. Preparation of fermentation products at different times

[0102] A single colony of the Cg-pXMJ-omp7-TC strain was picked and placed in LBB (chloramphenicol) liquid medium (50 mL / 250 mL conical flask), and 10 μL IPTG (concentration 24 mg mL -1 ), cultured for 36h.

[0103] 2. Detection of fluorescence value by ELISA

[0104] Collect the bacterial liquid at 4h, 8h, 12h, 16h, 20h, 24h, 28h, 32h, and 36h, take 1mL of each and add it to the EP tube, centrifuge at 5000rpm, 4℃ for 2min, and take 80μL of the supernatant for each portion. Prepare the colorimetric solution: 100μL each of DTT and EDT2, 800μL of ddH2O. Sample preparation: ① 80μL of fermentation supernatant, 20μL of colorimetric solution ② 4℃, avoid light and react for 1h. Detect the fluorescence value with an enzyme marker

[0105] The FlAsH-tetracysteine ​​assay is a fluorescent tracing method widely used for intracellular target proteins in eukaryotic organisms. The two As(III) substituents in the fluorescein derivative FlAsH-EDT2 can form a stable fluorescent chromophore in the form of two cysteine ​​thiol groups replacing one molecule of EDT with the tetracysteine ​​tag (-FLNCCPGCCMEP-, referred to as TC tag). When the tag is fused to the C-terminus of a specific protein, FlAsH-EDT2 can be used to achieve the intracellular localization tracing of the protein (such as Figure 3 The inducible Ptac promoter was used to express Omp7 protein (TC tag fused to the C-terminus) under gradient time, and the culture supernatant of each experimental group was subjected to FlAsH-TC reaction to measure fluorescence, as shown in FIG. Figure 4 The reliability of Flash-TC monitoring was confirmed by the fluorescence reading of Flash-TC reaction and the results of SDS-PAGE of fermentation supernatant. Figure 4 The results showed that the expression level of Omp7 protein and the intensity of FlAsH-TC fluorescence reaction induced by it increased with the extension of induction expression time before 20h of fermentation. The fluorescence value of FlAsH-TC reaction and protein grayscale analysis showed that the two had a good correlation, such as Figure 5 This finding confirms the effectiveness of FlAsH-EDT2 in monitoring the expression of secretory proteins in strains, laying the foundation for further development and optimization of high-throughput screening platforms.

[0106] Example 3 ARTP mutagenesis 1. Preparation of mutagenic strains

[0107] Corynebacterium glutamicum was prepared into competent state with Corynebacterium glutamicum with the deposit number of CGMCC1.15647 as the starting strain, and then the pXMJ19-Omp7 plasmid strain was introduced as the control group, and the pXMJ19-Omp7-TC plasmid strain was introduced as the experimental group. After recovery, it was plated on LBB solid plate containing 15 μg / mL chloramphenicol, cultured at 30°C for 18 hours, single colonies were selected in 30mL LBB liquid culture medium, cultured at 30°C for 10h, transferred to 10mL LBB liquid culture medium, the initial OD600 reached 0.2, cultured for about 2h, the OD600 reached 0.6, 10uL of bacterial solution was drawn onto the slide, and the positive mutation rate and lethality were determined at a power of 100W, an air flow of 10SLM, and different time t=0, 15, 30, 45, 60, 75, 90, 120, 150s, 180s.

[0108] The results of positive mutation rate and lethality are shown in Figure 6It can be seen that when the mutagenesis time is 120s, the positive mutation rate reaches a maximum of about 42%, and the lethality rate is about 95%. Therefore, 120s is selected as the optimal mutagenesis time for ARTP mutagenesis. After the mutagenesis is completed, it is placed in a 1.5mL centrifuge tube containing 1mL PBS, oscillated and eluted, and spread on LBB solid culture medium. (2) The colonies grown on the above plate are scraped and inoculated into a 50mL conical flask (10mL LBB liquid culture medium), and the flask is shaken at 30℃, 220rpm for 12h to prepare for the establishment of the sorting library

[0109] Example 4 Droplet microfluidic sorting

[0110] 1. Fluorescence-activated droplet sorting of high-yield Omp7 protein Cg-pXMJ-omp7-TC

[0111] (1) Water-in-oil (Cg-pXMJ-omp7-TC) microdroplet generation

[0112] ①Open the pump parameter adjustment software and image capture software, turn on the metal bath in the pump parameter software, and open the three-hole chip.

[0113] ② Take 500 μL of the oil phase and 2 mL of the water phase (bacterial solution) and put them into 2 mL EP tubes respectively. Put the two EP tubes into the metal bath and connect the air pump and the chip.

[0114] ③ Open the image photo, find three passages inside the chip, adjust the pump parameters to start microdroplet generation (flow rate parameters: oil 400 drops / s; bacterial solution 450 drops / s). Set the cell density to OD 600 =0.05, adjust the flow rates of oil phase and water phase to ensure that the particle size of the micro droplets is 65mm.

[0115] ④ Wipe clean the excess liquid overflowing from the collection port, and use a collection tube to collect the microdroplets generated in 1 hour.

[0116] ⑤ The generated microdroplets were incubated offline in a constant temperature incubator at 30°C for 12 h.

[0117] (2) Injection of double arsenic substrate into microdroplets

[0118] ① The order of the four-hole chip from top to bottom is oil phase (sorting oil 800μL), water phase, regenerated microdroplets, and microdroplet collection port. The black pen points on the chip and the red pen points on the connection port (red below and black above).

[0119] ② Connect the air pumps of the water phase and oil phase to the chip, turn on the air pumps to allow the microdroplets to enter the pipeline (flow rate parameters: oil 400 drops / s; bacterial liquid 450 drops / s). Set the cell density to OD 600 =0.05, adjust the flow rates of oil phase and water phase to ensure that the particle size of the micro droplets is 65mm.

[0120] ③ Set three thrusts, the oil phase pressure is less than the liquid phase pressure, and adjust the double arsenic substrate injection pump (flow rate: 1000 times / s).

[0121] ④Turn on the micro-injection button and set the voltage to 10V.

[0122] ⑤ After collecting for 2 hours, cut off the collection tube, seal both ends of the collection tube with a needle, and turn off the air pump.

[0123] ⑥ The microdroplets injected with the double arsenic substrate were incubated offline in a constant temperature incubator at 4°C for 3 hours.

[0124] (3) Isolation of Cg-pXMJ-omp7-TC with high Omp7 protein production

[0125] ① Select a straight channel chip and use an ammeter to check the integrity of the chip. Take 800μL of sorting oil, and the order of the chip from left to right is: oil phase, water phase, micro droplet collection, and waste liquid.

[0126] ②Open the water phase to discharge the gas in the collection tube. Adjust the oil phase so that the water phase enters the waste liquid channel before starting the separation.

[0127] ③ Turn on the laser option and start debugging the voltage from 2V.

[0128] ④ Set the electric field strength to 40 V / m, start sorting, and collect data on the fluorescence values ​​of 10,000 microdroplets.

[0129] ⑤ According to the statistical results, select the appropriate fluorescence value as the sorting threshold (such as Figure 7 As shown, the sorting thresholds for four rounds of screening).

[0130] ⑥ Collect cells with high fluorescence intensity greater than the threshold.

[0131] ⑦ The cells with high fluorescence intensity were spread on LBHIS solid culture medium containing chloramphenicol and cultured in a constant temperature incubator at 30°C for 48 hours.

[0132] 2. Microplate reader rescreening

[0133] Single colonies were selected in a 96-well plate, and strains with high fluorescence values ​​were screened out again. The strains were transferred to a 100-mL shake flask containing 10 mL of LBB liquid for rescreening, and the strain with the highest fluorescence intensity was screened out. The obtained strain was used as the starting strain for the next mutagenesis, and mutagenesis and sorting were repeated to obtain the mutagenized strain with the largest increase in fluorescence intensity compared to the initial strain, and the strain was preserved accordingly.

[0134] The secretion expression of Omp7 protein was verified by WT and mutated strains without mutation ( Figure 8 ) and FlAsH-TC reaction fluorescence value determination ( Fig. 9), it can be observed that the fluorescence expression of the strains treated with three consecutive rounds of mutations gradually increased, and the CT3-28 strain showed the highest fluorescence expression after three rounds of mutation. However, after the fourth round of mutation, the fluorescence intensity decreased significantly, indicating that the mutagenesis reached saturation, such as Fig.10 Thus, four mutant strains with high secretion expression were successfully obtained through four rounds of ARTP mutagenesis and FADS screening, namely CT1-109, CT2-6, CT3-28 and CT4-42.

[0135] Example 5 Mutation strain stability experiment

[0136] 1. Growth stability verification

[0137] The WT strain was spread on LBB solid medium, and the CT1-109, CT2-6, CT3-28 and CT4-42 mutagenic strains were spread on LBB solid medium (chloramphenicol) and activated at 30°C for 24h. A single WT colony was picked out and placed in a 100mL shake flask containing 10mL LBB medium. Single colonies of CT1-109, CT2-6, CT3-28 and CT4-42 were picked out and placed in a 100mL shake flask containing 10mL LBB medium (chloramphenicol) and cultured for 12h at 30°C and 220rpm. The above five bacterial solutions were transferred to 250mL shake flasks containing 50mL LBB medium, and 500μL IPTG (final concentration 1mM) was added for culture. The initial optical density (OD 600 ) to 0.3, 30°C, 220rpm, collect the bacterial solution every 6h, and measure OD 600 The spectrophotometer measured the absorbance of the five bacterial solutions at a wavelength of 600 nm, and the microplate reader measured the fluorescence value of the Cg-pXMJ-omp7-TC mutant strain. Fig.11 As shown, although the growth rate of the mutagenic strains is roughly the same as that of the WT strain, the maximum growth density (OD600) they reach is different. Among them, the CT4-42 mutant strain showed a relatively higher biomass, followed by the CT3-28 mutant strain, while the WT strain had the lowest biomass. However, in terms of unit fluorescence expression level, CT3-28 performed the best. From the above results, it can be seen that ARTP mutagenesis did not have a significant effect on the overall growth of the strain.

[0138] 2. Genetic stability verification (subculture of WT strain and CT3-28 mutant strain)

[0139] Transfer the above two bacterial solutions into 10mL of LBB medium (containing 100μL IPTG, 100mL bottle) respectively and culture for 48h. Then, inoculate into new LBB medium (containing 100μL IPTG, 100mL shake flask) and continue to culture for 24h. Repeat the above steps 10 times and perform 10 rounds of subculture of the strains. After each subculture, measure the OD600 value and fluorescence value of the two bacterial solutions respectively. The spectrophotometer measures the absorbance of the two bacterial solutions at a wavelength of 600nm, and the microplate reader measures the fluorescence value of the WT strain and the CT3-28 mutant strain. Fig.12 As shown, the fluorescence value of each generation fluctuates within 10% and is basically stable.

[0140] Example 6 Exploring factors leading to enhanced secretion and expression of recombinant proteins in mutagenic strains

[0141] The pCT3-TC plasmid (CT3-28 plasmid) and pXMJ19-TC (WT plasmid) were respectively transferred into the WT strain CGMCC1.15647 of Corynebacterium glutamicum to obtain Cg-pCT3-TC and Cg-pXMJ19-TC strains. By comparing the fluorescence intensity of the two, it was determined whether the fluorescence enhancement was derived from the mutation of the plasmid. The results of fluorescence measurement are shown in Figure 2. Fig.13 As shown, the fluorescence values ​​of the WT recombinant strain containing pCT3-TC and the WT recombinant strain containing pXMJ19-TC are very close, so we speculate that the obvious enhancement of the fluorescence of the strain is not caused by plasmid mutation.

[0142] In addition, a plasmid-free strain CT3 was successfully obtained by transferring CT3-28 seventeen times. The pXMJ19-TC plasmid was then electroporated into the CT3 strain to form a new recombinant strain CT3-pXMJ19-TC, and the fluorescence value of the new recombinant strain CT3-pXMJ19-TC was compared with that of the Cg-pXMJ19-TC recombinant strain. Fig.13 The results showed that the fluorescence value of CT3-pXMJ19-TC was 68.9% higher than that of Cg-pXMJ19-TC, and there was no change in the fluorescence value compared with the original mutant CT3-28. This result showed that the gene mutation of the strain promoted the improvement of the fluorescence secretion ability of the recombinant protein. Therefore, the CT3 strain has genetic stability and the ability to improve the secretion of recombinant proteins.

[0143] Example 7 Effect of mutagenic strains on secretion expression of different recombinant proteins

[0144] Four proteins with potential application value were introduced into CT1, CT2, and CT3 (all of which had lost their plasmids after subculture): VHH, PINP, Rhv3, and ApxII, in order to test whether these mutagenic strains could effectively enhance the secretion of recombinant proteins.

[0145] The protein plasmids containing VHH, PINP, Rhv3 and ApxII were introduced into WT and mutagenized strains by electroporation. After obtaining the recombinant strains, fermentation was performed and the secretion supernatant was obtained to prepare protein samples.

[0146] The results of SDS-PAGE analysis were as follows Fig.14 The four recombinant proteins were successfully secreted and expressed in all strains, and the secretion expression level of recombinant proteins in the mutagenic strains was generally higher than that in the WT strain, indicating that the host cells treated with mutagenesis can effectively improve the secretion expression ability of recombinant proteins.

[0147] Example 8 Verification of the fermentation performance of the mutagenized strain to produce recombinant protein

[0148] In order to test whether the mutagenized strain is suitable for large-scale production efficiency, the secretion and expression of Omp7 protein by the CT3 strain was detected in a 5L fermenter, and the ability of WT and mutagenized strains CT3-28 to secrete and express Omp7 protein was compared.

[0149] The preserved WT strain and CT3-28 mutant strain were taken out of the -70℃ refrigerator and coated on LBB solid medium and LBB+CmR solid medium for overnight activation for 24h. Pick WT and CT3-28 single colonies to LBB liquid medium and LBB liquid medium (chloramphenicol) respectively, and culture for 12h at 30℃ and 220rpm. The above bacterial liquids were transferred to pre-sterilized fermenters containing 1.8L culture medium. During the entire fermentation process, the parameters were set: the dissolved oxygen content was maintained at 30%, the fermenter was thermostatically controlled at 30℃, and the pH value of the culture medium was kept stable at 7 by ammonia water and 10% concentration of phosphoric acid liquid. Samples were taken every 4h to check the optical density (OD600) at a wavelength of 600nm and protein samples were prepared from the supernatant for SDS-PAGE electrophoresis verification. In addition, in order to achieve adequate nutrient supply and increase protein expression, the fermenter was fed after 12h of culture to add glucose. The spectrophotometer measured the absorbance of the WT strain and the CT3-28 mutant strain at a wavelength of 600 nm at different culture times. SDS-PAGE electrophoresis verification. Preparation of a standard curve of bovine serum albumin (BSA) concentration and fluorescence value and calculation of Omp7 production: Prepare a BSA solution with a concentration of about 10 mg / mL, dilute it at a certain multiple and perform SDS-PAGE. By analyzing the grayscale of the protein bands on SDS-PAGE, the corresponding Fig.15 The formula Y=0.1164*X+15221 in (f) can be used to obtain the fluorescence value corresponding to the corresponding grayscale. Finally, data analysis is performed on each grayscale and the corresponding BSA concentration to obtain a standard curve between BSA concentration and fluorescence value.

[0150] By analyzing the grayscale of SDS-PAGE bands of protein samples at different fermentation times, Fig.15 (f) The corresponding fluorescence value can be obtained from the standard curve, and then the corresponding protein concentration can be obtained by substituting the fluorescence value into the BSA standard curve.

[0151] Depend on Fig.15 The OD600 increased significantly from 4h to 24h. In addition, SDS-PAGE analysis showed that the production of Omp7 protein began to become obvious 8h after the start of culture, and the intensity of these protein bands increased over time. Quantitative analysis showed that the secretion yield of Omp7 in the WT strain was about 196.7mg·L -1 , while the secretion yield of Omp7 in the CT3-28 strain was approximately 231.5 mg·L -1 , an increase of 84.9%. This comparison showed that the fermentation efficiency of strain CT3-28 was higher, proving that it has good prospects in practical applications as a potential host for secreted proteins.

[0152] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

[0153] synthetic construct

[0154] Sequence Listing

[0155] SEQ ID NO.1

[0156] Artificial sequence

[0157] TTCCAGCATTCGCTCAGGAAATGACCCCTAAGGTGGATATGTC

[0158] SEQ ID NO.2

[0159] ACAGCCAAGCTGAATTCTTATGGTTCCATGCAGCAGC

[0160] SEQ ID NO.3

[0161] CAAGCTGAATTCTTACTTGTCTTCCTTGGGTGGTTGC

[0162] SEQ ID NO.4

[0163] CTGGCTGCTGCATGGAACCATAAGAATTCAGCTTGGCTGTTTTGG

[0164] SEQ ID NO.5

[0165] ATATCCACCTTAGGGGTCATTTCCTGAGCGAATGCTGG

[0166] SEQ ID NO.6

[0167] ACCAAGGAAGACAAGTAAGAATTCAGCTTGGCTGTTTTGG

Claims

1. A Corynebacterium glutamicum that efficiently secretes recombinant proteins, characterized in that: The Corynebacterium glutamicum CSQ-CT3 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC NO: 30697, a deposit date of May 20, 2024, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The Corynebacterium glutamicum according to claim 1, characterized in that: The Corynebacterium glutamicum mutagenesis strain is prepared into a competent state using Corynebacterium glutamicum with the deposit number of CGMCC1.15647 as the starting strain.

3. The Corynebacterium glutamicum according to claim 1, characterized in that: The mutagenic strain of Corynebacterium glutamicum is prepared by combining ARTP mutagenesis technology and fluorescence activated droplet sorting technology screening technology.

4. The Corynebacterium glutamicum according to claim 3, characterized in that: The fluorescence activated droplet sorting technology includes droplet generation, droplet culture, droplet fusion, picoliter syringe, droplet detection and sorting.

5. A method for increasing the yield of a recombinant protein, characterized in that: The method comprises inoculating Corynebacterium glutamicum into LBB culture medium at an inoculation volume ratio of 1:10, fermenting at 30° C. and pH 7, and collecting bacterial cells.

6. The method according to claim 5, characterized in that: The formula of the LBB medium is: weigh 10.0 g·L NaCl -1 , weigh 10.0 g·L brain heart extract -1 , weigh 5.0 g·L yeast extract powder -1 , weigh 10.0 g·L peptone -1 .

7. The method according to claim 5, characterized in that: The fermentation time is 60 to 80 hours.

8. The method according to claim 5, characterized in that: After 12 hours of fermentation, the feeding operation was started to add glucose.

9. Use of the Corynebacterium glutamicum according to claim 1 in increasing the yield of recombinant proteins.

10. The use according to claim 9, characterized in that: The recombinant proteins include but are not limited to Omp7, VHH, PINP, Rhv3 and ApxII.

Images