Recombinant bacterium for producing alpha, omega-dicarboxylic acid and application thereof

Abstract

The invention discloses a recombinant bacterium for producing alpha, omega-dicarboxylic acid and application of the recombinant bacterium, and belongs to the technical field of biological catalysis and conversion. According to the invention, escherichia coli is used as an original strain, and a lactonase Lactonase gene, an alcohol dehydrogenase ChnD gene and an aldehyde dehydrogenase ChnE gene are integrated on a genome of the original strain; and transferring into a recombinant vector containing an alcohol dehydrogenase ADH1 gene and a Flag-BVMO monooxygenase gene or a recombinant vector containing a P450CHX gene, a CamA gene, a CamB gene, an alcohol dehydrogenase ADH2 gene and a Flag-BVMO monooxygenase gene, so as to obtain the recombinant bacterium. The recombinant bacterium takes naphthenic alcohol, KA oil or cycloalkane as a substrate for reaction, and finally alpha, omega-dicarboxylic acid of which the yield is remarkably improved is obtained; therefore, the recombinant strain has a good application prospect in industrial production of alpha, omega-dicarboxylic acid.

Description

Technical Field

[0001] The invention belongs to the technical field of biocatalysis and conversion, and specifically relates to a recombinant bacterium for producing α,ω-dicarboxylic acids and an application thereof. Background Art

[0002] α,ω-dicarboxylic acid refers to an aliphatic dicarboxylic acid containing carboxyl groups at both ends of the carbon chain, and has the following general structure: HOOC-(CH2) n -COOH, where n≥4, represents the number of methylene groups in the carbon chain. α,ω-dicarboxylic acids include adipic acid (n=4), pimelic acid (n=5), suberic acid (n=6), etc., which are widely used in perfumes, polymers, adhesives, and macrolide antibiotics. As the most concerned adipic acid (AA), also known as fatty acid, is a dicarboxylic acid with a carboxyl group at each end of the C6 fatty chain. As an important intermediate, adipic acid is widely used in various industries such as chemicals, perfumes, pharmaceuticals, and food. It can also be used as a plasticizer, lubricant, adhesive, and the synthesis of resins with different properties, so it can be used in industries such as ships and automobiles. In addition, adipic acid can also be esterified with terephthalic acid (PTA) and butanediol (BDO) or with succinic acid (SA) and butanediol (BDO) to produce degradable plastics PBAT and PBSA. In a few cases, adipic acid is used as a substitute for acidulants such as citric acid as a food additive rated as safe by the Food and Drug Administration. However, the most important role of adipic acid is in the synthesis of nylon materials. More than 92% of adipic acid is polymerized with hexamethylenediamine to produce nylon 6,6 each year, which is used in major projects such as electrical engineering and aerospace due to its excellent strength and toughness. According to statistics, the global market size of nylon in 2021 is about US$31 billion, and it is expected to maintain an upward trend. Among them, nylon 6,6 and nylon 6 account for more than 95% of the global nylon production, which is a type of bulk platform compound with a broad market and wide application.

[0003] Adipic acid is a bulk chemical, and its synthesis mainly relies on traditional chemical methods. Specifically, adipic acid is prepared by oxidizing KA oil, a mixture of cyclohexanol and cyclohexanone, with concentrated nitric acid. There are many methods for preparing KA oil. The most commonly used method is to use benzene as a raw material and Ni-Al2O3 as a catalyst to completely hydrogenate cyclohexane at 2600-5500 kPa. Cyclohexane is oxidized with cobalt as a catalyst at 830-960 kPa and 150-160°C to produce KA oil. After obtaining KA oil, concentrated nitric acid is used as an oxidant for further oxidation reaction to obtain adipic acid. However, since the chemical synthesis of adipic acid generally requires the use of a large amount of concentrated nitric acid, it brings about problems such as pollutant emissions, equipment corrosion, low selectivity, and many by-products. On the other hand, a series of nitrogen oxides will be generated. In addition to harmful gases such as NO and NO2, super greenhouse gas "N2O" will also be generated, and its global warming potential (GWP) is 300 times that of CO2. The production of adipic acid is currently the most important source of N2O emissions, which will cause serious environmental problems and accelerate global warming and greenhouse effects. Therefore, more and more researchers have improved traditional chemical methods and developed emerging chemical synthesis methods such as electrocatalysis. However, after the improvement, the chemical method still has problems such as low conversion efficiency and high cost, and it cannot completely eliminate environmental pollution.

[0004] Therefore, while the chemical method is constantly developing, a large number of researchers have invested in the research of biosynthesis. The biological method is mainly divided into semi-biological method and full biological method. The semi-biological method requires the synthesis of precursors by biological method first, and then combines with chemical method to realize the final production of α,ω-dicarboxylic acid (adipic acid); while the full biological method uses fermentation engineering, whole cell catalysis, in vitro enzyme catalysis and other methods to realize the conversion of different substrates to α,ω-dicarboxylic acid (adipic acid). The reaction conditions are mild, the energy consumption is low, and the environmental pollution problem of the chemical method is completely solved. However, the above methods all have the problem of low yield of synthesized α,ω-dicarboxylic acid (adipic acid). Summary of the invention

[0005] The object of the present invention is to provide a recombinant bacterium for producing α,ω-dicarboxylic acid and its application. In the present invention, Escherichia coli is used as a starting strain, a lactone hydrolase gene, an alcohol dehydrogenase ChnD gene and an aldehyde dehydrogenase ChnE gene are integrated into the genome of the starting strain, and then a recombinant vector containing an alcohol dehydrogenase ADH1 gene and a Flag-BVMO monooxygenase gene or a recombinant vector containing a P450CHX gene, a CamA gene, a CamB gene, an alcohol dehydrogenase ADH2 gene and a Flag-BVMO monooxygenase gene is transferred to obtain a recombinant bacterium; the recombinant bacterium reacts with cycloalkanol, KA oil or cycloalkane as a substrate, and finally obtains an α,ω-dicarboxylic acid with significantly increased yield.

[0006] In the first aspect, the present invention provides a recombinant bacterium for producing α,ω-dicarboxylic acids. Escherichia coli is used as a starting strain, and the lactone hydrolase Lactonase gene, alcohol dehydrogenase ChnD gene and aldehyde dehydrogenase ChnE gene are integrated into the genome of the starting strain, and then a recombinant vector containing the alcohol dehydrogenase ADH1 gene and the Flag-BVMO monooxygenase gene or a recombinant vector containing the P450CHX gene, the CamA gene, the CamB gene, the alcohol dehydrogenase ADH2 gene and the Flag-BVMO monooxygenase gene is transferred into the recombinant bacterium to obtain the recombinant bacterium.

[0007] In the present invention, the inventors have found that the functional genes related to the pathway of catalyzing lactones to produce α,ω-dicarboxylic acids (lactonase gene, alcohol dehydrogenase ChnD gene and aldehyde dehydrogenase ChnE gene) are integrated into the genome of the starting strain, and then transferred into a recombinant vector containing the functional genes related to the pathway of catalyzing cycloalkanols to produce lactones (alcohol dehydrogenase ADH1 gene and Flag-BVMO monooxygenase gene) or transferred into a recombinant vector containing the functional genes related to the pathway of catalyzing cycloalkanes to produce cycloalkanols (P450CHX gene, CamA gene, CamB gene) and the functional genes related to the pathway of catalyzing cycloalkanols to produce lactones (alcohol dehydrogenase ADH2 gene and Flag-BVMO monooxygenase gene), to obtain a recombinant bacterium; in the recombinant bacterium, various functional enzymes with significantly increased expression levels are obtained through the coordinated expression of the relevant functional genes on the genome of the starting strain and the relevant functional genes on the recombinant vector, and the various functional enzymes above, after reacting with cycloalkanols, KA oil or cycloalkanes as substrates, obtain α,ω-dicarboxylic acids with significantly increased yields.

[0008] In some embodiments, the nucleotide sequence of the lactone hydrolase Lactonase gene is shown as SEQ ID NO.1, the nucleotide sequence of the alcohol dehydrogenase ChnD gene is shown as SEQ ID NO.2, the nucleotide sequence of the aldehyde dehydrogenase ChnE gene is shown as SEQ ID NO.3, the nucleotide sequence of the alcohol dehydrogenase ADH1 gene is shown as SEQ ID NO.4, the nucleotide sequence of the Flag-BVMO monooxygenase gene is shown as SEQ ID NO.5, the nucleotide sequence of the P450CHX gene is shown as SEQ ID NO.6, the nucleotide sequence of the CamA gene is shown as SEQ ID NO.7, the nucleotide sequence of the CamB gene is shown as SEQ ID NO.8, and the nucleotide sequence of the alcohol dehydrogenase ADH2 gene is shown as SEQ ID NO.9.

[0009] In the present invention, the inventors further studied and found that by selecting specific functional genes, they are better expressed in recombinant bacteria, and ultimately catalyze the reaction of cycloalkanol, KA oil or cycloalkanes to obtain α,ω-dicarboxylic acids with further significantly increased yields.

[0010] In some embodiments, the E. coli includes E. coli BL21(DE3).

[0011] It is understandable that, in the present invention, the Escherichia coli can be routinely selected according to actual use needs, and the Escherichia coli in the present invention preferably includes Escherichia coli BL21 (DE3).

[0012] In some embodiments, the recombinant vector is obtained by using the pRSFDuet-1 vector as a starting vector and connecting it to the alcohol dehydrogenase ADH1 gene and the Flag-BVMO monooxygenase gene, or connecting it to the P450CHX gene, the CamA gene, the CamB gene, the alcohol dehydrogenase ADH2 gene and the Flag-BVMO monooxygenase gene.

[0013] It can be understood that, in the present invention, the starting vector can be routinely selected according to actual use needs, and the starting vector in the present invention preferably includes pRSFDuet-1.

[0014] In some embodiments, integrating the lactone hydrolase Lactonase gene, the alcohol dehydrogenase ChnD gene and the aldehyde dehydrogenase ChnE gene into the genome of the starting strain specifically includes: replacing the ldhA gene on the genome of the starting strain with the lactone hydrolase Lactonase gene; connecting the alcohol dehydrogenase ChnD gene and the aldehyde dehydrogenase ChnE gene through an RBS sequence to replace the adhE gene on the genome of the starting strain, and replacing the promoter with the first promoter.

[0015] It is understandable that the above gene integration can be operated by the CRISPR-Cas9 system.

[0016] In some embodiments, the nucleotide sequence of the RBS sequence is as shown in SEQ ID NO.10, and the first promoter is selected from at least one of promoters Trc, J23105, J23107, J23101, PLTETo1, apFAB81, apFAB95, and T7.

[0017] It is understandable that the first promoter can be selected from conventional promoters in the prior art according to actual use needs. In the present invention, the first promoter is preferably selected from at least one of promoters Trc, J23105, J23107, J23101, PLTETo1, apFAB81, apFAB95, and T7.

[0018] In some preferred embodiments, the first promoter is promoter Trc, and its nucleotide sequence is shown as SEQ ID NO.11.

[0019] In the present invention, the inventors further studied and found that by using the promoter Trc, the expression levels of the ChnD and ChnE genes can be further regulated, so that the expression levels of various genes involved in the synthesis of α, ω-dicarboxylic acids in the strain remain relatively balanced, thereby obtaining α, ω-dicarboxylic acids with further significantly increased yield.

[0020] In some embodiments, after the recombinant vector containing the P450CHX gene, the CamA gene, the CamB gene, the alcohol dehydrogenase ADH2 gene and the Flag-BVMO monooxygenase gene is transferred, the step of continuing to modify the genome of the starting strain is also included; the modification specifically includes: overexpressing the acetyl-CoA synthetase acs gene on the genome of the starting strain, and knocking out the transhydrogenase isomer sthA gene on the genome of the starting strain.

[0021] In some preferred embodiments, overexpressing the acetyl-CoA synthetase acs gene on the genome of the starting strain specifically includes: replacing the promoter of the acetyl-CoA synthetase acs gene on the genome of the starting strain with promoter J23119; the nucleotide sequence of promoter J23119 is shown in SEQ ID NO.12.

[0022] In the present invention, the inventors further discovered that by overexpressing the acetyl-CoA synthetase acs gene on the genome of the starting strain and knocking out the transhydrogenase isomer sthA gene on the genome of the starting strain, the coenzyme system in the recombinant bacteria was regulated, and then after the recombinant bacteria carried out a catalytic reaction with cycloalkanol, KA oil or cycloalkane as a substrate, an α,ω-dicarboxylic acid with a further significantly increased yield was obtained.

[0023] It is understandable that the above-mentioned transformation can be performed by the CRISPR-Cas9 system.

[0024] In a second aspect, the present invention provides use of any of the above-mentioned recombinant bacteria in the production of α,ω-dicarboxylic acids.

[0025] In a third aspect, the present invention provides a method for producing an α,ω-dicarboxylic acid, comprising the steps of: Any of the above recombinant bacteria is fermented and cultured, and after induction of expression, a substrate cycloalkanol, KA oil or cycloalkane is added, and the catalytic reaction is continued, and α,ω-dicarboxylic acid is obtained after separation and purification.

[0026] In some embodiments, the cycloalkanol includes at least one of cyclohexanol, cyclopentanol, cycloheptanol, and cyclooctanol; the cycloalkane includes at least one of cyclohexane, cyclopentane, cycloheptane, and cyclooctane; and the α,ω-dicarboxylic acid includes at least one of adipic acid, glutaric acid, pimelic acid, and suberic acid.

[0027] The beneficial effect of the present invention is that, different from the prior art, the present invention integrates functional genes related to the pathway of catalyzing lactone to produce α,ω-dicarboxylic acid (lactonase gene, alcohol dehydrogenase ChnD gene and aldehyde dehydrogenase ChnE gene) into the genome of the starting strain, and then transfers the recombinant vector containing functional genes related to the pathway of catalyzing cycloalkanol to produce lactone (alcohol dehydrogenase ADH1 gene and Flag-BVMO monooxygenase gene) or transfers the recombinant vector containing functional genes related to the pathway of catalyzing cycloalkanol to produce cycloalkanol (P45 0CHX gene, CamA gene, CamB gene) and functional genes related to the pathway of catalyzing cycloalkanol to produce lactone (alcohol dehydrogenase ADH2 gene and Flag-BVMO monooxygenase gene) are used to obtain a recombinant bacterium; in the recombinant bacterium, various functional enzymes with significantly increased expression levels are obtained through the coordinated expression of relevant functional genes on the genome of the starting strain and the relevant functional genes on the recombinant vector, and after the various functional enzymes react with cycloalkanol, KA oil or cycloalkane as substrates, α,ω-dicarboxylic acids with significantly increased yields are obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The map of the recombinant vector pRSFDuet-LB constructed in Example 1 of the present invention; Figure 2 This is a map of the recombinant vector pRSFDuet-CAB constructed in Example 2 of the present invention; Figure 3 The result diagram of adipic acid prepared at different time points using cyclohexanol and industrial-grade KA oil as substrates in Example 3 of the present invention, wherein (A) is a cyclohexanol substrate, and (B) is an industrial-grade KA oil substrate; Figure 4 This is a result diagram of adipic acid prepared at different time points using cyclohexane as a substrate in Example 4 of the present invention. DETAILED DESCRIPTION

[0029] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] The experimental methods without specific conditions in the examples are usually carried out according to conventional experimental methods in the field of molecular biology, including but not limited to the experimental methods described in Molecular Cloning: A Laboratory Manual by MR Green, Molecular Biology by Robert F. Weaver, etc., or according to the experimental methods recommended by the kit and instrument manufacturers. The reagents and biological materials used in the examples can be obtained from commercial channels unless otherwise specified.

[0031] In the present invention, the nucleotide sequence of the lactone hydrolase Lactonase gene in the functional genes related to the pathway of catalyzing lactone to produce α,ω-dicarboxylic acid is shown as SEQ ID NO.1, the nucleotide sequence of the alcohol dehydrogenase ChnD gene is shown as SEQ ID NO.2, and the nucleotide sequence of the aldehyde dehydrogenase ChnE gene is shown as SEQ ID NO.3; the nucleotide sequence of the alcohol dehydrogenase ADH1 gene in the functional genes related to the pathway of catalyzing cycloalkanol to produce lactone is shown as SEQ ID NO.4, the nucleotide sequence of the alcohol dehydrogenase ADH2 gene is shown as SEQ ID NO.9, and the nucleotide sequence of the Flag-BVMO monooxygenase gene is shown as SEQ ID NO.5; the nucleotide sequence of the P450CHX gene in the functional genes related to the pathway of catalyzing cycloalkanes to produce cycloalkanols is shown as SEQ ID NO.6, the nucleotide sequence of the CamA gene is shown as SEQ ID NO.7, and the nucleotide sequence of the CamB gene is shown as SEQ ID NO.8.

[0032] The nucleotide sequences of the above functional genes can all be artificially synthesized.

[0033] In the present invention, the method for preparing competent E. coli cells is as follows: BL21 (DE3) glycerol bacteria are streaked on LB medium, cultured in a 37°C incubator overnight, a single bacterium is picked and cultured in LB liquid medium at 37°C and 220 rpm for about 5 hours, 1 mL of the bacterial solution is transferred to 100 mL of LB medium and cultured at 37°C and 220 rpm until OD 600 The cell density was about 0.6, and it was allowed to stand in ice water for 30 minutes; the cells were collected by centrifugation at 4°C and 3500g for 10 minutes, and the cells were resuspended in 10% glycerol and centrifuged again at 4°C and 3500g for 10 minutes to collect the cells. Finally, the cells were resuspended in 2 mL of 10% glycerol and packaged, quickly frozen with liquid nitrogen, and stored in a -80°C refrigerator for later use.

[0034] In the present invention, the formula of the glucose culture medium is as follows: 1.1% glucose, 2% peptone, 1% yeast extract, 0.1% disodium hydrogen phosphate, 0.219% citric acid, 0.082% magnesium sulfate, 0.2% ammonium sulfate, 0.4% potassium dihydrogen phosphate, 1 mL / L TE solution, and a pH value of 7.0; Among them, the formula of TE solution is as follows: 0.3% copper sulfate pentahydrate, 1.71% manganese sulfate monohydrate, 0.3% zinc sulfate heptahydrate, 2.8% ferrous sulfate heptahydrate, 2% sodium molybdate dihydrate, 1% boric acid, 2.45% cobalt chloride hexahydrate, 1.13% anhydrous calcium chloride, and 27 mL / L sulfuric acid.

[0035] Example 1 Construction of recombinant engineered Escherichia coli M23-8T-L 1.1 Construction of the recombinant vector pRSFDuet-LB Primers were designed based on the sequences of the alcohol dehydrogenase ADH1 gene and the Flag-BVMO monooxygenase gene and the expression vector pRSFDuet-1 (as shown in Table 1 below), and the target fragment and vector fragment were obtained by PCR amplification (amplified with the pRSFDuet-1-F / R primer pair and the pRSF MCS2-F / R primer pair). After the PCR was completed, TE solution was used to prepare 0.8% agarose gel for electrophoresis to detect whether the PCR product band size was correct. The target gene and vector fragment were then recovered according to the instructions of the DNA recovery kit.

[0036] Table 1 Primer sequence list

[0037] The vector and target fragment were connected using T5 exonuclease (T5 EXO) from NEB. The specific method was as follows: the target gene fragment and the linearized vector fragment (50 ng) were mixed evenly at a molar ratio of 3:1 and placed on ice, a certain amount of H2O was added to make up to 4µL, and finally 1µL of a mixture of T5 EXO and 4.0 Buffer (purchased from NEB) was added and the timing was started. After 5 minutes, 50µL of E. coli DH5α competent cells were quickly added, placed on ice for 30 minutes, heat-shocked in a 42°C water bath for 45 seconds, and then placed on ice for 2 minutes, followed by the addition of 200µL of LB liquid culture medium, placed at 37°C, 220rpm for 1 hour for recovery, and then spread on an LB plate containing the corresponding antibiotics and cultured at 37°C overnight. The obtained single clone was cultured in liquid culture medium at 37°C and 220 rpm until turbidity, and then used as a template for PCR verification. The plasmid of the correct single clone was extracted using the All Assay Gold Plasmid Extraction Kit and sent for sequencing to obtain the recombinant vector pRSFDuet-LB with successful ligation and correct sequence (map as shown in Figure 1 as shown).

[0038] 1.2 E. coli genome editing The CRISPR-Cas9 system is used to transform the E. coli genome. The steps include: The pcas plasmid was transferred into BL21(DE3) and cultured at 30°C. Then, the BL21(DE3) into which pcas was transferred was picked to prepare electroporation competent cells (the culture medium used was LB medium with kanamycin and L-arabinose added, and the culture temperature was 30°C). After the competent cells were prepared, they were stored in a -80°C refrigerator for later use.

[0039] Prepare pTargetF plasmid and Donor DNA at the same time. The preparation of pTargetF plasmid requires the design of N20 sequence according to the sequence of the genome insertion site. The preparation of Donor DNA uses the overlapPCR method to connect three fragments in the order of the 500bp sequence before the insertion site, the target gene sequence, and the 500bp sequence after the insertion site to obtain Donor DNA.

[0040] Subsequently, the prepared pTargetF plasmid and Donor DNA fragment were simultaneously transferred into BL21 (DE3) cells containing pcas and cultured at 30°C. Single colonies were then picked for colony PCR verification. The strains with successful insertion of the target gene were selected and IPTG was added during the culture to eliminate the pTargetF plasmid. The culture temperature was then increased to 37°C to remove the pcas plasmid. Finally, the bacterial liquid PCR method was used for verification and sequencing to determine that the target gene fragment was successfully inserted into the E. coli genome.

[0041] Specifically, when the lactonase gene is used to replace the ldhA gene on the BL21 (DE3) genome, its N20 sequence is as follows: CGAGTCCTTTGGCTTTGAGC (SEQ ID NO. 21); the primer sequences used to construct the lactonase Donor DNA are shown in Table 2 below.

[0042] Table 2 Primer sequence list

[0043] Among them, the ldhA-AF / R primer pair is used to amplify the 500bp sequence before the insertion site, the Lactonase-F / R primer pair is used to amplify the target gene sequence, and the ldhA-BF / R primer pair is used to amplify the 500bp sequence after the insertion site.

[0044] Furthermore, when the alcohol dehydrogenase ChnD gene and the aldehyde dehydrogenase ChnE gene were connected by an RBS sequence (GGTACCTAAGGAGATATATC (SEQ ID NO.10)) (the sequence was artificially synthesized) to replace the adhE gene on the BL21 (DE3) genome, and the promoter was replaced by the promoter Trc (TTGACAATTAATCATCCGGCTCGTATAATG (SEQ ID NO.11), the sequence was artificially synthesized), the N20 sequence was as follows: AGCAGACTTCCTGGCGAACG (SEQ ID NO.28); the primer sequences used to construct the ChnD-ChnE Donor DNA are shown in Table 3 below.

[0045] Table 3 Primer sequence list

[0046] Among them, the adhE-AF / R primer pair is used to amplify the 500bp sequence before the insertion site, the ChnD / EF / R primer pair is used to amplify the target gene sequence, and the adhE-BF / R primer pair is used to amplify the 500bp sequence after the insertion site.

[0047] Finally, the genome-modified Escherichia coli M3-8T was successfully constructed.

[0048] 1.3 Construction of recombinant engineered Escherichia coli M23-8T-L The recombinant vector pRSFDuet-LB constructed in step 1.1 was transferred into the E. coli M3-8T prepared in step 1.2 to obtain recombinant engineered E. coli M23-8T-L.

[0049] Example 2 Construction of recombinant engineered Escherichia coli M123-2-A 2.1 Construction of the recombinant vector pRSFDuet-CAB Primers were designed based on the sequences of P450CHX gene, CamA gene, CamB gene, alcohol dehydrogenase ADH2 gene and Flag-BVMO monooxygenase gene and the sequence of expression vector pRSFDuet-1 (as shown in Table 4 below), and the target fragment and vector fragment were obtained by PCR amplification (amplified with pRSFDuet-1-F / R primer pair and pRSF MCS2-F / R primer pair, the sequence is shown in Table 1 above). After the PCR was completed, TE solution was used to prepare 0.8% agarose gel for electrophoresis to detect whether the PCR product band size was correct. Subsequently, the target gene and vector fragment were recovered according to the instructions of the DNA recovery kit.

[0050] Table 4 Primer sequence list

[0051] The connection method in step 1.1 of Example 1 was used to obtain a recombinant vector pRSFDuet-CAB (map as shown in FIG. Figure 2 as shown).

[0052] 2.2 E. coli genome editing The E. coli M3-8T genome obtained in step 1.2 of Example 1 was further modified using the CRISPR-Cas9 system using the method in step 1.2 of Example 1.

[0053] When the promoter of the acetyl-CoA synthetase acs gene on the Escherichia coli M3-8T genome is replaced with the promoter J23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC (SEQ ID NO.12), the sequence is artificially synthesized), its N20 sequence is as follows: CATATTATTAACATCCTACA (SEQ ID NO.43); the primer sequences used to construct the J23119 Donor DNA are shown in Table 5 below.

[0054] Table 5 Primer sequence list

[0055] The acs-AF / R primer pair was used to amplify the 500 bp sequence before the insertion site, and the acs-BF / R primer pair was used to amplify the 500 bp sequence after the insertion site.

[0056] When the transhydrogenase isomer sthA gene on the Escherichia coli M3-8T genome is knocked out, its N20 sequence is as follows: GAGTCGCTGTCGTAAATGCG (SEQ ID NO.48); the primer sequences used to construct the Donor DNA with sthA knocked out are shown in Table 6 below.

[0057] Table 6 Primer sequence list

[0058] The sthA-AF / R primer pair was used to amplify the 500 bp sequence before the insertion site, and the sthA-BF / R primer pair was used to amplify the 500 bp sequence after the insertion site.

[0059] Finally, the genome-modified Escherichia coli M3-8T-2 was successfully constructed.

[0060] 2.3 Construction of recombinant engineered Escherichia coli M123-2-A The recombinant vector pRSFDuet-CAB constructed in step 2.1 was transferred into the Escherichia coli M3-8T-2 prepared in step 2.2 to obtain recombinant engineered Escherichia coli M123-2-A.

[0061] Example 3 Fermentation production of α,ω-dicarboxylic acids using recombinant engineered Escherichia coli M23-8T-L In this example, recombinant engineered Escherichia coli M23-8T-L was used to ferment and produce α,ω-dicarboxylic acids.

[0062] First, adipic acid is produced using cyclohexanol or industrial-grade KA oil as a substrate, comprising the following steps: 1) Before fermentation: Check whether the equipment can operate normally, add about 1L of pure water to the 5L fermenter and sterilize at 121℃, 101kPa for 30min. At the same time, calibrate the pH electrode, dissolved oxygen electrode, peristaltic pump, etc. After the first sterilization, wash the fermenter and prepare the fermentation medium in the fermenter and sterilize it at 121℃, 101kPa for 30min. After the second sterilization, assemble the fermenter, set the control temperature to 37℃, pH to 6.7, initial speed to 300rpm, and ventilation volume to 2NL / min for use. The culture medium used is glucose culture medium.

[0063] 2) Preparation of seed solution: The recombinant engineered E. coli M23-8T-L constructed in Example 1 was streaked and activated on LB solid medium containing kanamycin, and the cells were picked and transferred to liquid LB medium and cultured at 37°C until OD 600 Take 2 mL of bacterial solution and transfer it to 100 mL of liquid culture medium until the OD 600 About 1.5.

[0064] 3) Fermentation: Inoculate the seed solution in step 2) into the fermentation tank in step 1) that has been running stably, calibrate the dissolved oxygen electrode to 100%, and start fermentation. During the fermentation process, control the ventilation volume to 2NL / min and the initial speed to 300rpm. As the dissolved oxygen continues to decrease, the speed is continuously increased. During this period, the residual glucose is detected. When the residual glucose is lower than 5g / L, feed is started, and the cell OD is regularly detected. 600 At about 25 o'clock, IPTG with a final concentration of 0.2mM was added to induce expression, and the culture temperature was lowered to 25°C. During this period, the dissolved oxygen was not controlled at around 30% by adjusting the feeding rate and the rotation speed, and the induction was carried out overnight.

[0065] 4) Biotransformation: About 12 hours after induction, start feeding the substrate cyclohexanol or industrial-grade KA oil, maintain the rotation speed at 600 rpm, and control the substrate flow acceleration at 5 mL / h at the beginning. Then, as the reaction proceeds, detect the accumulation of intermediates and adjust the feeding rate, and take samples for analysis at different time points.

[0066] 5) Product separation: First, the fermentation liquid is centrifuged to remove bacterial cells; flocculants are added to the upper liquid for flocculation and then centrifuged again to remove the precipitated paste (i.e., denatured protein); the upper liquid is passed through an ultrafiltration membrane system to remove impurities again and then hydrochloric acid is added for acidification, followed by recrystallization and finally drying to obtain white or light yellow solid adipic acid.

[0067] The results of adipic acid prepared at different time points using cyclohexanol and industrial grade KA oil as substrates are shown in Figure 2. Figure 3 shown.

[0068] from Figure 3 It can be seen that with cyclohexanol as the substrate, a yield of about 103 g / L of adipic acid (AA) was obtained after 80 hours of reaction, and no intermediates were detected. Similarly, when industrial-grade KA oil was used as the substrate, the AA concentration reached about 110 g / L, and there was no intermediate accumulation. The purity of the AA finally purified exceeded 98.6%, and the yield exceeded 75%. The results show that the recombinant engineered Escherichia coli M23-8T-L provided by the present invention can effectively convert cyclohexanol and industrial-grade KA oil into AA, eliminating the need for nitric acid and significantly reducing greenhouse gas emissions. The highest value of adipic acid biosynthesis reported has been reached, thus providing great potential for industrial applications.

[0069] Then, according to the above method, glutaric acid, pimelic acid and suberic acid were produced respectively using cyclopentanol, cycloheptanol and cyclooctanol with a concentration of 100 mM as substrates.

[0070] The results showed that cyclopentanol was completely converted into glutaric acid without accumulation of substrates and intermediates. The glutaric acid production was detected to be about 104mM (13.79g / L), and the conversion rate and yield both reached more than 99%. The conversion rates of cycloheptanol and cyclooctanol were reduced, and about 41mM (6.55g / L) of pimelic acid and 36mM (6.32g / L) of suberic acid were obtained, respectively. At the same time, the accumulation of the intermediate product hydroxy acid was detected.

[0071] The above results show that the recombinant engineered Escherichia coli M23-8T-L in the present invention has a catalytic effect on C5-C8 cycloalkanols and has good substrate universality.

[0072] Example 4 Fermentation production of α,ω-dicarboxylic acids using recombinant engineered Escherichia coli M123-2-A In this example, recombinant engineered Escherichia coli M123-2-A was used to ferment and produce α,ω-dicarboxylic acids.

[0073] First, adipic acid was produced using cyclohexane as a substrate. The method was basically the same as the steps in Example 3, except that in step 4), the substrate cyclohexane was introduced into the bottom of the reactor in the form of gas using a gas disperser and an air pump, and samples were taken and analyzed at different time points.

[0074] The results of adipic acid prepared at different time points using cyclohexane as substrate are shown in Figure 2. Figure 4 shown.

[0075] from Figure 4 It can be seen that during the culture process in the fermenter, the recombinant engineered E. coli M123-2-A grew slowly. At 22 h of culture, the cell OD 600 The temperature was about 20, at which time IPTG and ALA were added to lower the culture temperature to induce protein expression. After about 18 hours of induction, the substrate was added to enter the bioconversion process. Since cyclohexane is volatile and has strong hydrophobicity, the fermentation equipment was modified to introduce the substrate cyclohexane into the bottom of the reactor in the form of gas using a gas disperser and an air pump to extend the retention time of the substrate cyclohexane in the fermentation broth and increase the ability of the cells to capture cyclohexane and convert it. It was found that the bacteria could continue to grow for a certain period of time after the cyclohexane substrate was introduced. After the final reaction, the concentration of adipic acid reached about 155mM (22.6g / L), and there was no accumulation of any intermediates.

[0076] Then, according to the above method, glutaric acid, pimelic acid and suberic acid were produced respectively using cyclopentane, cycloheptane and cyclooctane with a concentration of 100 mM as substrates.

[0077] The results showed that cyclopentane, cycloheptane, and cyclooctane can generate about 24mM (3.22g / L) of glutaric acid, 62mM (9.88g / L) of pimelic acid, and 40mM (7.01g / L) of suberic acid, respectively, and there is no accumulation of intermediate products. The results show that the recombinant engineered Escherichia coli M123-2-A in the present invention has strong selectivity for C6 cyclohexane and C7 cycloheptane, but has a catalytic effect on C5-C8 cycloalkanes, and can achieve conversion to the corresponding diacids, which has a certain universality.

[0078] In summary, the recombinant engineered Escherichia coli M23-8T-L provided by the present invention can use cycloalkanol and KA oil as substrates, and the recombinant engineered Escherichia coli M123-2-A can use cycloalkanes as substrates to carry out catalytic reactions to obtain α,ω-dicarboxylic acids with significantly increased yields.

[0079] It should be noted that the above embodiments all belong to the same inventive concept, and the description of each embodiment has its own focus. For matters that are not described in detail in some embodiments, reference may be made to the description in other embodiments.

[0080] The above-mentioned embodiments only express the implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A recombinant bacterium for producing α,ω-dicarboxylic acid, characterized in that: Using Escherichia coli as a starting strain, a lactone hydrolase Lactonase gene, an alcohol dehydrogenase ChnD gene and an aldehyde dehydrogenase ChnE gene are integrated into the genome of the starting strain, and then transferred into a recombinant vector containing an alcohol dehydrogenase ADH1 gene and a Flag-BVMO monooxygenase gene or a recombinant vector containing a P450CHX gene, a CamA gene, a CamB gene, an alcohol dehydrogenase ADH2 gene and a Flag-BVMO monooxygenase gene to obtain the recombinant bacteria.

2. The recombinant bacteria for producing α,ω-dicarboxylic acid according to claim 1, characterized in that: The nucleotide sequence of the lactone hydrolase Lactonase gene is shown in SEQ ID NO.1, the nucleotide sequence of the alcohol dehydrogenase ChnD gene is shown in SEQ ID NO.2, the nucleotide sequence of the aldehyde dehydrogenase ChnE gene is shown in SEQ ID NO.3, the nucleotide sequence of the alcohol dehydrogenase ADH1 gene is shown in SEQ ID NO.4, the nucleotide sequence of the Flag-BVMO monooxygenase gene is shown in SEQ ID NO.5, the nucleotide sequence of the P450CHX gene is shown in SEQ ID NO.6, the nucleotide sequence of the CamA gene is shown in SEQ ID NO.7, the nucleotide sequence of the CamB gene is shown in SEQ ID NO.8, and the nucleotide sequence of the alcohol dehydrogenase ADH2 gene is shown in SEQ ID NO.

9.

3. The recombinant bacteria for producing α,ω-dicarboxylic acid according to claim 1, characterized in that: The Escherichia coli includes Escherichia coli BL21 (DE3).

4. The recombinant bacteria for producing α,ω-dicarboxylic acid according to claim 1, characterized in that: The recombinant vector is obtained by using the pRSFDuet-1 vector as a starting vector and connecting it with the alcohol dehydrogenase ADH1 gene and the Flag-BVMO monooxygenase gene, or connecting it with the P450CHX gene, the CamA gene, the CamB gene, the alcohol dehydrogenase ADH2 gene and the Flag-BVMO monooxygenase gene.

5. The recombinant bacteria for producing α,ω-dicarboxylic acid according to claim 1, characterized in that: Integrating the lactone hydrolase Lactonase gene, the alcohol dehydrogenase ChnD gene and the aldehyde dehydrogenase ChnE gene into the genome of the starting strain specifically includes: replacing the ldhA gene on the genome of the starting strain with the lactone hydrolase Lactonase gene; connecting the alcohol dehydrogenase ChnD gene and the aldehyde dehydrogenase ChnE gene through an RBS sequence to replace the adhE gene on the genome of the starting strain, and replacing the promoter with the first promoter.

6. The recombinant bacteria for producing α,ω-dicarboxylic acid according to claim 5, characterized in that The nucleotide sequence of the RBS sequence is shown in SEQ ID NO.10, and the first promoter is selected from at least one of promoters Trc, J23105, J23107, J23101, PLTETo1, apFAB81, apFAB95, and T7.

7. The recombinant bacteria for producing α,ω-dicarboxylic acid according to claim 1, characterized in that: After the recombinant vector containing the P450CHX gene, the CamA gene, the CamB gene, the alcohol dehydrogenase ADH2 gene and the Flag-BVMO monooxygenase gene is transferred, the step of continuing to transform the genome of the starting strain is also included; The transformation specifically includes: overexpressing the acetyl-CoA synthetase acs gene on the genome of the starting strain, and knocking out the transhydrogenase isomer sthA gene on the genome of the starting strain.

8. Use of the recombinant bacterium according to any one of claims 1 to 7 in the production of α,ω-dicarboxylic acids.

9. A method for producing α,ω-dicarboxylic acid, characterized in that: The steps include: The recombinant bacteria according to any one of claims 1 to 7 are fermented and cultured, and after induction of expression, a substrate cycloalkanol, KA oil or cycloalkane is added, and the catalytic reaction is continued, and α,ω-dicarboxylic acid is obtained after separation and purification.

10. The method according to claim 9, characterized in that The cycloalkanol includes at least one of cyclohexanol, cyclopentanol, cycloheptanol, and cyclooctanol; The cycloalkane includes at least one of cyclohexane, cyclopentane, cycloheptane and cyclooctane; The α,ω-dicarboxylic acid includes at least one of adipic acid, glutaric acid, pimelic acid, and suberic acid.

Images