Recombinant streptomyces nodosus for producing amphotericin B as well as construction method and application of recombinant streptomyces nodosus

Abstract

The invention provides recombinant streptomyces nodosus for producing amphotericin B as well as a construction method and application of the recombinant streptomyces nodosus. The recombinant streptomyces nodosus comprises an erythromycin strong promoter ermEp * and a fibrous protein homologous protein gene Ftsz. The genetically engineered bacterium has the beneficial effects that an original strain is transformed through technical means of genetic engineering and metabolic engineering, the genetically engineered bacterium for producing amphotericin B is constructed through overexpression of a streptomyces nodosus cell morphology related gene Ftsz, the mycelium morphology of the genetically engineered bacterium mutates in the fermentation process, and the genetically engineered bacterium has more single and dispersed mycelia, and has the characteristics of high yield, high yield and the like. The mutant strain hyphae grow dispersedly, coagulation and clustering in the streptomyces fermentation process are inhibited, the viscosity of fermentation liquor is reduced conveniently in industrial production, the AmB yield of the genetic engineering strain reaches the maximum value 9.31 g / L within 108 h, compared with a control strain, the AmB yield is improved by 9.1%, the fermentation period is shortened by 12 h, and the quality and production capacity of the strain are improved.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and fermentation engineering, and relates to a recombinant Streptomyces tuberosum producing amphotericin B, a construction method and an application thereof, in particular to a method for improving the production efficiency of amphotericin B by optimizing the cell morphology of the recombinant Streptomyces tuberosum. Background Art

[0002] Amphotericin B (AmB) is an important antifungal antibiotic. Since it was launched in 1966, it has been the drug of choice for deep fungal infections. The color of pure AmB is yellow or orange. Due to the asymmetric distribution of hydrophilic and hydrophobic groups in its molecular structure and its acidic and alkaline characteristics, the solubility of AmB in aqueous phase and most organic phases is extremely low. AmB has a broad antifungal spectrum and strong activity. It has a strong antifungal effect on most deep fungi such as Candida, Cryptococcus, Mucor, Aspergillus, Histoplasma, Coccidioides, etc. It can also effectively inhibit Candida and is used to treat Leishmaniasis, etc. Therefore, the application of amphotericin B and its derivatives is still very extensive.

[0003] In terms of increasing the production of amphotericin B, the main focus is on overexpressing key metabolic genes. In 2016, Sweeney et al. expressed the regulatory gene amphRIV of the AmB biosynthesis gene cluster, and the total production of amphotericin A and amphotericin B increased by 3 times compared with the original strain. Zhang Bo et al. analyzed the effect of adding glass beads in the shake flask on the production of amphotericin B. The results showed that the addition of glass beads can significantly improve the aggregation of hyphae and significantly increase the production of AmB. The yield increased by 341.1% compared with the control group, reaching 4563.2 mg / L. In the same year, Duan Baoling et al. optimized the organic composite nitrogen source and fermentation conditions to reduce the impact of nitrogen sources between batches on fermentation metabolism, and further added precursor substances to promote the biosynthesis of amphotericin B. The final fermentation unit reached 14469 μg / mL, an increase of 103% before optimization, and the fermentation time was shortened by 14%. In 2020, Huang et al. overexpressed acetyl-CoA carboxylase, methylmalonyl mutase, and methylmalonyl isomerase genes in S. nodosus ZJB2016050 to increase the supply of precursors for AmB synthesis, and the AmB production eventually reached 15.60 g / L in a 5L fermenter. In the same year, Zhang et al. developed a combined feeding strategy, which achieved AmB production of 18.39 g / L by adding key precursors and differential metabolites and regulating fermentation in stages, which is the highest AmB production reported to date.

[0004] With the innovation of multi-omics analysis at the gene level and molecular biology technology, genetic engineering breeding based on the gene molecular level will be an accurate, fast and efficient breeding method. With the whole genome sequencing of S. nodosus strains, the key genes in the AmB synthesis process have been analyzed, and it is more reasonable to rationally construct an engineered strain with high AmB production through genetic engineering methods. In the study of constructing high-yield strains of Streptomyces secondary metabolites, strategies such as regulating the secondary metabolic network, overexpressing enzymes related to synthetic precursors, and overexpressing key enzymes in gene clusters are generally used to increase the production of secondary metabolites in Streptomyces. Members of the genus Streptomyces are famous for their complex morphology. Most members of the genus Streptomyces not only have the characteristics of filamentous fungi with polar growth of hyphae, but also have the characteristics of aerobic fungi. Their protein production process is closely related to the respiratory metabolism of mitochondria. A large number of laboratory studies and industrial production have proved that the morphology of mycelium in Streptomyces can significantly affect the secretion and production of AmB. Generally speaking, the multicellular growth of Streptomyces nodularis begins with the germination of a single spore, which grows into a vegetative mycelium through linear apical extension and hyphal branching, then forms an aerial mycelium, and finally differentiates into mononuclear cells, and further develops into spores. Therefore, the mycelium of Streptomyces nodularis is mainly in the form of microspheres or networks in liquid deep fermentation. Different mycelium morphologies will change the rheological properties of the fermentation liquid and the production efficiency of the product. By controlling the morphology of the mycelium, the production efficiency of different products required for production can be improved. The high viscosity of the mycelium seriously hinders stirring and oxygen transfer, resulting in culture heterogeneity, poor dissolved oxygen, and slowed cell growth and metabolic activities, which in turn makes the growth and development of Streptomyces slow or even apoptosis, increasing the difficulty of artificial control of the hyphal morphology and affecting the synthesis and secretion of AmB. Therefore, for the synthesis and secretion of AmB, making the mycelium in a clump or free and dispersed state, especially the free and dispersed state, is considered to be the ideal state for increasing AmB production. However, during the fermentation process of the current Streptomyces nodosa, the mycelium tends to entangle with each other and form lumps, which seriously inhibits the secretion of AmB and the growth of mycelium in the "nuclear" zone, thereby affecting the yield of fermentation products and severely limiting its industrial production. Morphological genetic modification will be widely used as a strategy to further increase the yield of secondary metabolites. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a recombinant Streptomyces nodularis producing amphotericin B, a construction method and an application thereof, and to obtain a genetically engineered strain with a mycelium morphology mutation by overexpressing the cell morphology-related gene Ftsz of Streptomyces nodularis, thereby alleviating the problems of high viscosity during the fermentation process, agglomeration during the fermentation process of Streptomyces, high energy consumption and low yield, thereby shortening the fermentation cycle and effectively improving the production efficiency of AmB.

[0006] In order to achieve the above-mentioned purpose and other related purposes, the technical solution adopted by the present invention is as follows:

[0007] The invention provides a recombinant Streptomyces tuberosum producing amphotericin B, characterized in that the recombinant Streptomyces tuberosum comprises an erythromycin strong promoter ermEp* and a fibrin homologous protein gene Ftsz.

[0008] As a preferred embodiment of the present application, the nucleotide sequence of the exogenous erythromycin strong promoter ermEp* is shown in SEQ ID NO.1.

[0009] As a preferred embodiment of the present application, the nucleotide sequence of the fibrin homologous protein gene Ftsz is shown as SEQ ID NO.2.

[0010] The present invention also provides a method for constructing the recombinant Streptomyces nodosa, characterized by comprising:

[0011] (1) Insert the erythromycin strong promoter ermEp* into the multiple cloning site of the pJTU1278 plasmid to obtain the recombinant plasmid pJTU1278-ermEp*;

[0012] (2) inserting the fibrin homologous protein gene Ftsz into the recombinant plasmid pJTU1278-ermEp* to obtain the recombinant expression plasmid pJTU1278-Ftsz*;

[0013] (3) Introducing the recombinant expression plasmid pJTU1278-Ftsz* into the donor strain Escherichia coli to obtain the donor strain Escherichia coli containing the recombinant expression plasmid;

[0014] (4) The donor strain Escherichia coli containing the recombinant plasmid constructed in step (3) is introduced into the chassis strain S. nodosus ZJB2016050 with a deposit number of CCTCCNO: M202301 by conjugation transfer method. D224A The genetically engineered bacteria S. nodosus ZJB2016050 was obtained. D224A -Ftsz*, which is a recombinant Streptomyces tuberosum that produces amphotericin B.

[0015] The present invention also provides the use of the recombinant Streptomyces tuberosum in preparing amphotericin B by microbial fermentation.

[0016] The present invention also provides a recombinant expression plasmid, which is characterized in that: the basic plasmid includes an erythromycin strong promoter ermEp* and a fibrin homologous protein gene Ftsz.

[0017] As the preferred embodiment of the present application, the nucleotide sequence of the exogenous erythromycin strong promoter ermEp* is shown in SEQ ID NO.1; the nucleotide sequence of the fibrin homologous protein gene Ftsz is shown in SEQ ID NO.2. The fibrin homologous protein gene Ftsz is a gene related to the cell morphology of Streptomyces nodosus. The gene can encode a cell division protein, which plays a vital role in the growth and division process of Streptomyces nodosus. The mutant strain overexpressing the cell morphology-related gene Ftsz of Streptomyces nodosus has a more single dispersed hyphae. The hyphae of the mutant strain grows dispersedly and is not easy to form granular flocs, thereby effectively inhibiting the coagulation of Streptomyces during fermentation, reducing the viscosity of the fermentation liquid and improving the utilization rate of the hyphae for oxygen and culture medium matrix, thereby increasing the yield of AmB. In addition, the engineered strain can shorten the fermentation process of AmB by 12 hours to reach the maximum yield under natural fermentation conditions, which is not possessed by the morphological engineering strain Streptomyces nodosusZJB2016050-SsgA* constructed in the early stage.

[0018] As a preferred embodiment of the present application, the basic plasmid is pJTU1278 plasmid.

[0019] The present invention also provides a method for constructing the recombinant expression plasmid, characterized in that the erythromycin strong promoter ermEp* and the fibrin homologous protein gene Ftsz are connected to the basic plasmid by enzyme cutting to obtain the recombinant expression plasmid.

[0020] The present invention also provides an application of the recombinant plasmid in fermentation preparation of amphotericin B and / or application of the recombinant Streptomyces tuberosum producing amphotericin B.

[0021] The present invention also provides a method for preparing amphotericin B, characterized in that the preparation method comprises: inoculating the seed liquid obtained after seed culture of the recombinant tubercular Streptomyces into a fermentation medium at an inoculation amount of 2-10% by volume concentration, culturing for 96-168 hours at 26-31°C and 400-500r / min, and after the fermentation is completed, separating and purifying the fermentation product to obtain amphotericin B.

[0022] As a preferred embodiment of the present invention, the seed culture process is as follows: the recombinant Streptomyces nodosa is inoculated on a GYM plate, grown at 25-28° C. for 3-7 days, and gray spores are collected to prepare a spore suspension; the spore suspension is inoculated into a seed culture medium and cultured at 25-28° C. for 24-48 hours to obtain a seed solution.

[0023] Specifically, the seed culture process is as follows: the recombinant nodular Streptomyces is inoculated on a GYM plate and grown at 26°C for 7 days to obtain gray spores, the surface spores are washed into sterile water using a cotton swab, the washed spore suspension is filtered with a syringe containing cotton, the filtered spores are centrifuged to remove the supernatant, and sterile water is added to resuspend to obtain a spore suspension; the spore suspension is inoculated into a seed culture medium and cultured at 26°C for 48 hours to obtain a seed solution.

[0024] As a preferred embodiment of the present invention, the composition of the GYM plate is as follows: 1-5 g / L glucose, 1-5 g / L yeast powder, 5-29 g / L malt extract, 1-3 g / L calcium carbonate, 15-20 g / L agar, the solvent is water, pH 7.0-7.5, and sterilization at 115°C for 30 min.

[0025] As a preferred embodiment of the present invention, the composition of the seed culture medium is as follows: peptone 10-20 g / L, NaCl 5-10 g / L, glucose 10-15 g / L, yeast powder 5-10 g / L, CaCO3 0.5-1 g / L, the solvent is water, pH 7.0-7.2, and sterilized at 115°C for 30 min.

[0026] As a preferred embodiment of the present invention, the fermentation medium is composed of: 60-80 g / L glucose, 5-10 g / L beef extract, 5-10 g / L soybean protein powder, 8-30 g / L cottonseed powder, 5-10 g / L CaCO3, 0.1-0.4 g / L KH2PO4, the solvent is water, pH 7.0, and sterilized at 115°C for 30 min.

[0027] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0028] 1. The starting strain was transformed through genetic engineering and metabolic engineering techniques. By overexpressing the cell morphology-related gene Ftsz of Streptomyces nodosa, a genetically engineered bacterium producing amphotericin B was constructed. The mycelium morphology of the engineered bacterium mutated during the fermentation process, and the mycelium had a more single and robust mycelium. The mycelium of the mutant strain grew dispersedly, which inhibited the agglomeration of Streptomyces during fermentation, making it easier to reduce the viscosity of the fermentation liquid in industrial production and improve the quality and production capacity of the strain.

[0029] 2. By enhancing the expression of the above genes, the engineered bacteria achieved a maximum AmB production of 9.31 g / L at 108 h, which was 9.1% higher than that of the control strain. At the same time, the fermentation cycle of the strain was shortened by 12 h, thus achieving the purpose of improving production efficiency.

[0030] 3. Amphotericin B is a microbial fermentation antibiotic drug, and the purity and quality of the drug are crucial in production; the present invention can not only increase the yield of the target product, but also shorten the fermentation time, effectively improving the overall efficiency of the enterprise in large-scale industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the construction spectrum of the recombinant plasmid pJTU1278-ermEp*;

[0032] Figure 2 This is the construction map of the recombinant expression plasmid pJTU1278-Ftsz*;

[0033] Figure 3 The genetically engineered strain Streptomyces nodosu ZJB2016050 D224A -Ftsz* and original strain Streptomyces nodosus ZJB2016050 D224A Comparison of AmB production in shake flask fermentation;

[0034] Figure 4 For genetically engineered bacteria ZJB2016050 D224A -Ftsz* and original strain Streptomyces nodosus ZJB2016050 D224A Comparison chart of viscosity of shake flask fermentation;

[0035] Figure 5 For genetically engineered bacteria ZJB2016050 D224A -Ftsz* and original strain Streptomyces nodosus ZJB2016050 D224A Electron microscopic image of hyphae morphology;

[0036] Figure 6 The original strain is Streptomyces nodosus ZJB2016050 D224A 5L fermentation tank natural fermentation result curve chart;

[0037] Figure 7 For genetically engineered bacteria ZJB2016050 D224A -Ftsz*5L fermentation tank natural fermentation result curve;

[0038] Figure 8 This is the standard curve for AmB high performance liquid chromatography (HPLC) detection. DETAILED DESCRIPTION

[0039] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0040] It should be noted that the process equipment or devices not specifically specified in the following embodiments are all conventional equipment or devices in the art.

[0041] In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before or after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise specified; it should also be understood that the combination connection relationship between one or more devices / apparatuses mentioned in the present invention does not exclude the existence of other devices / apparatuses before or after the combination device / apparatus or the insertion of other devices / apparatuses between these explicitly mentioned two devices / apparatuses, unless otherwise specified. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, and is not intended to limit the order of arrangement of each method step or the scope of the present invention. Changes or adjustments in their relative relationships should also be regarded as the scope of the present invention without substantially changing the technical content.

[0042] Example 1 Genetically engineered bacteria S. nodosus ZJB2016050 D224A - Preparation of Ftsz*:

[0043] (1) Preparation of recombinant plasmid pJTU1278-ermEp*:

[0044] Using the strong erythromycin promoter as a template, primers ermEp*-F (with XbaI restriction site) and ermEp*-R (with HindⅢ, KpnI restriction sites) were designed. ermEp*-F was a forward primer for the ermEp* gene, and ermEp*-R was a reverse primer for the ermEp* gene. The fragment was cloned and amplified from the template. The fragment size was about 258 bp. Sequencing analysis confirmed that it was consistent with the target fragment. The nucleotide sequence was shown in SEQ ID NO.1. The fragment was recovered and purified by gel for use. The vector pJTU1278 was digested with XbaI and KpnI nucleases and recovered by gel. The recovered gene fragment was connected with the digested pJTU1278 plasmid to obtain the recombinant plasmid pJTU1278-ermEp*. The schematic diagram is shown in 1.

[0045] (2) Preparation of recombinant expression plasmid pJTU1278-Ftsz*:

[0046] The nodular Streptomyces S.nodosus N3 with the deposit number of CCTCCNO: M202301 D224 The genome was used as a template, and primers Ftsz-F (with HindⅢ restriction site) and Ftsz-R (with KpnI restriction site) were designed. Ftsz-F was a forward primer for the Ftsz gene, and Ftsz-R was a reverse primer for the Ftsz gene. The fragment was cloned and amplified from the template, and the fragment size was about 1208bp. Sequencing analysis confirmed that it was consistent with the target fragment, and the nucleotide sequence was shown in SEQ ID NO.2. The fragment was gel-recovered and purified for use. The vector pJTU1278 was digested with HindⅢ and KpnI nucleases and gel-recovered. The recovered gene fragment was ligated with the digested recombinant plasmid pJTU1278-ermEp* to obtain the recombinant expression plasmid pJTU1278-Ftsz*. The schematic diagram is shown in 2.

[0047] The cloning PCR system was as follows: 1 μL of the whole genome template of Streptomyces nodosa, 25 μL of 2×Phanta MaxBuffer, 5 μL of dNTP (2.5 mM), 1 μL of each forward and reverse primer, 1 μL of Phanta Max DNA polymerase, and the mixture was filled to 50 μL with deionized water.

[0048] The cloning PCR program was as follows: 98°C denaturation for 15s, 55-60°C annealing for 20s, 72°C extension for 2min, for a total of 30 cycles, and finally 72°C extension for 10min.

[0049] The connection process includes: obtaining the mutant gene fragment and connecting it to the linearized vector pJTU1278 through a one-step cloning method using the recombination cloning kit of Novazonics.

[0050] Add 4 μL of 5×CE II Buffer to a sterilized PCR tube, add 4 μL of recovered DNA fragments and 1 μL of vector DNA, add 2 μL of Exnase II ligase, add 9 μL of ddH2O, and react the system at 37°C for 1 hour. Transform the ligation product into DH5α competent Escherichia coli, screen for ampicillin resistance, select transformants for verification, and verify the successful transformants for subsequent conjugation transfer operations.

[0051] The primers used for constructing the above vector are as follows:

[0052] ermEp*-F CGGTGGCGGCCGCTCTAGAGACGTCCATGCGAGTGTCCG ermEp*-R ATAGGGCGAATTGGGTACCAAGCTTTTGGGGTCCTCCTGTG Ftsz-F CAGGAGGACCCCAAAGCTTGGCCTTCGACGTGGCAGC Ftsz-R ATAGGGCGAATTGGGTACCTCACTTGAGGAAGTCCGGCAC

[0053] (3) Preparation of E.coil ET12567 / pUZ8002 donor bacteria containing the recombinant expression plasmid pJTU1278-Ftsz*;

[0054] The process is prepared by grafting and transfer method, as shown in the following steps:

[0055] The constructed recombinant expression plasmid pJTU1278-Ftsz* was introduced into E. coli ET12567 / puz8002 (Shanghai Lianmai Biotechnology Co., Ltd.) and the expression was confirmed by ampicillin (Amp + , 50 μg / mL), chloramphenicol (Cm + , 50 μg / mL), kanamycin (Kan + , 50 μg / mL) resistance screening, picking positive transformants, and verifying by colony PCR with M13 upstream and downstream primers. The results showed that the recombinant vector pJTU1278-Ftsz* was successfully transformed into E.coil ET12567 / puz8002 to obtain the donor strain E. coli containing the recombinant expression plasmid.

[0056] The specific operations are as follows:

[0057] 1) The method for preparing competent E.coil ET12567 / puz8002 E. coli is as follows:

[0058] Take the E.coil ET12567 / puz8002 Escherichia coli culture from the glycerol cryopreservation tube of the strain and divide it into stripes on the LB plate, and culture at 37℃ until a single colony grows. Pick a single colony on the plate and transfer it to 2-5mL LB medium and culture it at 37℃, 200rpm overnight. Take 200μL of the overnight cultured culture and add it to 50mL LB medium and culture it at 37℃, 200rpm until OD600 is 0.4-0.7. Transfer the cultured culture to a pre-cooled 50mL centrifuge tube and let it stand on ice for 10min. Centrifuge at 4℃, 2500×g, 5min. Discard the supernatant, add 20mL 0.1mol / L CaCl2, resuspend on ice and let it stand for 10min. Centrifuge at 4℃, 2500×g, 5min. Discard the supernatant, add 2mL 0.1mol / L CaCl2 (the solution contains 15% glycerol at a final concentration), resuspend the precipitate, and place on ice for 30 minutes to obtain E.coil ET12567 / puz8002 competent cells. Dispense 100μL / tube and store at -80℃.

[0059] 2) The recombinant expression plasmid pJTU1278-Ftsz* was transformed into E.coil ET12567 / puz8002 to obtain genetically engineered bacteria S.nodosus ZJB2016050 D224A -Ftsz*:

[0060] Take one of the above-mentioned E.coil ET12567 / puz8002 competent cells, place on ice for 5 minutes, add 5 μL of the recombinant expression plasmid pJTU1278-Ftsz* at a concentration of 200 ng / μL, place on ice for 30 minutes, heat shock for 90 seconds in a 42°C water bath, return to ice bath for 1 minute, add 600 μL of LB liquid culture medium, culture at 37°C, 200 rpm, and culture for 1 hour. Pipette 200 μL and evenly spread it on Kan + (final concentration 50 μg / mL), Cm + (final concentration 50 μg / mL), Amp + (final concentration 50 μg / mL) resistant LB solid plate, incubate in 37°C incubator for 15 h until a single colony of E.coil ET12567 / puz8002 containing the recombinant vector pJTU1278-Ftsz* grows.

[0061] 3) Genetically engineered bacteria S. nodosus ZJB2016050 D224A -Ftsz* for verification;

[0062] M13 verification PCR system: pick a single colony, add 20μL sterile water, boil in water for 5-10min, centrifuge at 12000rpm for 1min. Take 1μL supernatant as template, add 5μL Genestar Taq Mix, 1μL M13 forward and reverse primers, and add deionized water to 10μL.

[0063] M13 validation PCR program: 98°C denaturation for 10 s, 55-60°C annealing for 15 s, 72°C extension for 8 min, a total of 30 cycles, and finally 72°C extension for 10 min.

[0064] The M13 primers are as follows:

[0065] M13F TGTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGAC

[0066] The ET12567 / puz8002 E. coli that had been introduced with the pJTU1278-Ftsz* plasmid was streaked to isolate a single colony, cultured at 37°C, and a single colony was placed in a test tube containing 5 mL of LB medium and Kan was added at the same time. + (final concentration 50 μg / mL), Cm + (final concentration 50 μg / mL), Amp + (final concentration 50 μg / mL) antibiotics, culture at 37°C for 14 h. Transfer 500 μL to a 50 mL LB shake flask and add Kan + (final concentration 50 μg / mL), Cm + (final concentration 50 μg / mL), Amp +(final concentration 50 μg / mL) resistance, culture at 37°C until OD600 is about 0.6. Centrifuge the donor bacteria in a 50mL centrifuge tube at 4000rpm for 5min, wash twice with 50mL LB medium, resuspend the bacteria in 5mL LB medium, and store at 4°C for later use.

[0067] The LB medium was prepared as follows: 10 g of peptone, 5 g of yeast powder, 5 g of sodium chloride, dilute to 1 L with tap water, set pH to natural, and sterilized at 121 degrees for 20 min.

[0068] (4) Construction of genetically engineered strains of Streptomyces nodosa carrying the ermEp*-Ftsz gene;

[0069] (i) Preparation of the receptor bacterium Streptomyces nodosus

[0070] Streptomyces nodosus ZJB2016050 D224A (Deposit number: CCTCCNO: M202301) was inoculated on a GYM plate or slant culture, grown at 26°C for 10 days, and gray-black spores were obtained. The surface spores were washed into 10 mL 2×YT medium using a cotton swab, and the washed spore suspension was filtered with a syringe containing cotton. The filtered spores were centrifuged at 12000rpm for 5 minutes, and the supernatant was removed. 10 mL 2×YT medium was added for re-suspending, and the spores were re-eluted once again by centrifugation at 12000rpm for 5 minutes, and finally re-suspended with 500 μL 2×YT medium. The re-suspended spores were heat-shocked at 50°C for 15-20 minutes and kept at room temperature for use.

[0071] The 2×YT medium was prepared by the following method: 16 g of peptone, 10 g of yeast powder, 5 g of sodium chloride, dilute to 1 L with tap water, natural pH, and sterilized at 121 degrees for 20 min.

[0072] Preparation method of GYM solid culture medium: 4g glucose, 4g yeast powder, 10g malt extract, 2g calcium carbonate, 20g agar, dilute to 1L with tap water, pH 7.2, sterilize at 121 degrees for 20min.

[0073] (ii) The conjugation process between donor and recipient bacteria:

[0074] 500 μL of the heat-shocked spore suspension in step (i) was mixed and resuspended with 500 μL of the donor E. coli suspension containing the recombinant expression plasmid in Example 1, and centrifuged at 6000 rpm for 2 min, 800 μL of the supernatant was removed, and the remaining supernatant was resuspended and coated on a MS solid culture medium plate containing 10 mM magnesium chloride. After culturing at 26°C for 20 h, 1 mL of an aqueous solution containing 0.5 mg of naphthoic acid and 0.5 mg of thiostrepton antibiotic was coated, and the culture was continued at 26°C for 10 days until transformants appeared.

[0075] The transformants were purified three times on GYM solid plates containing a final concentration of 50 μg / mL naphthoic acid and a final concentration of 50 μg / mL thiostrepton resistance until a single colony was obtained. The transformant colony was verified by PCR using 16S RNA upstream and downstream primers (16S-8 and 16S-1541) and M13 upstream and downstream primers (M13(-21)F, M13R). Sequencing and comparative analysis confirmed that the recombinant expression plasmid pJTU1278-Ftsz* had been introduced into the recipient bacteria Streptomyces nodosus ZJB2016050 D224A Finally, the genetically engineered bacteria S. nodosus ZJB2016050 that can overexpress Ftsz was obtained. D224A -Ftsz*, i.e. recombinant Streptomyces nodosus ZJB2016050 D224A -Ftsz*.

[0076] The MS solid medium was prepared by the following method: 20 g soybean powder, 20 g mannitol, 20 g agar, dilute to 1 L with tap water, pH natural, sterilize at 121 degrees for 20 min. Sterile magnesium chloride was added to a final concentration of 10 mM before use.

[0077] The M13 verification PCR operation is as described in step (3) of Example 1.

[0078] The 16sRNA verification PCR system: pick a single colony, add 20μL sterile water, boil in a water bath for 30min, centrifuge at 12000rpm for 1min. Take 2μL supernatant as a template, add 2×Phanta Max Buffer 5μL, dNTP (2.5mM) 0.5μL, 16S forward and reverse primers 0.5μL each, Phanta Max DNA polymerase 1μL, and add deionized water to 10μL.

[0079] The PCR program for 16S RNA verification was as follows: denaturation at 98°C for 10 s, annealing at 55-60°C for 15 s, extension at 72°C for 1 min 30 s, for a total of 30 cycles, and finally extension at 72°C for 10 min.

[0080] The primers used are as follows:

[0081] 16S-8 AGAGTTTGATCCTGGCTCAG 16S-1541 AAGGAGGTGATCCAGCCGCA

[0082] Example 2: Genetically engineered bacteria S. nodosus ZJB20240615-Ftsz* shake flask fermentation test to compare the viscosity of the fermentation broth;

[0083] ① Preparation of seed solution:

[0084] The amphotericin B prepared in Example 1 is produced by the engineering strain Streptomyces nodosuZJB2016050 D224A -Ftsz* was streaked onto a GYM plate, cultured at 26°C for 4 days, a single colony was selected, inoculated into a seed culture medium, and cultured at 26°C and 220 rpm for 48 h to obtain a seed solution;

[0085] The seed culture medium was prepared as follows: 20 g peptone, 8 g NaCl, 15 g glucose, 10 g yeast powder, 1 g CaCO3, dilute to 1 L with water, pH 7.0, and sterilize at 115 °C for 30 min.

[0086] ② Fermentation culture:

[0087] The liquid volume of a 500 mL shake bottle is 10%. During fermentation, the seed liquid is inoculated at a volume concentration of 4%. The fermentation is cultured at 26° C. and 220 rpm for 132 hours to obtain amphotericin B fermentation liquid.

[0088] The fermentation medium composition: glucose 70g / L, cottonseed powder 25-30g / L, CaCO3 9g / L, KH2PO40.1g / L, solvent is distilled water, pH7.0, sterilized at 115℃ for 30min. After the fermentation, samples were taken to detect the AMB content. The original strain Streptomyces nodosus ZJB2016050 was used. D224A As a control, the AMB yield comparison chart is as follows Figure 3 shown.

[0089] ③Viscosity measurement:

[0090] Detect the viscosity of the shake flask fermentation liquid. The detection method is as follows: pour about 15mL of fermentation liquid into the DV2T viscometer sample tank, set the relevant parameters and select the appropriate rotor for installation, slowly lower the rotor into the sample, so that the middle position of the scale line on the rotor just reaches the sample surface, click the run button to start the measurement, and it will automatically stop when the set conditions are met. Record the readings. D224A As a comparison, the viscosity comparison chart of the two is as follows Figure 4 shown.

[0091] The results showed that the mycelium viscosity of the control group was 36.76667cP. The high mycelium viscosity seriously hindered stirring and oxygen transfer, resulting in culture heterogeneity, poor dissolved oxygen, slowed cell growth and metabolic activity, and thus slowed the growth and development of Streptomyces and even apoptosis, increasing the difficulty of artificial control of mycelium morphology and affecting the synthesis and secretion of AmB. The genetically engineered bacteria in the experimental group overexpressed the nodular Streptomyces cell morphology-related gene Ftsz. The mycelium viscosity of the modified genetically engineered bacteria was 31.43333cP, which was 14.5% lower than that of the control group. The reduced viscosity of the fermentation broth can improve the utilization of oxygen and culture medium by the mycelium, thereby increasing the AmB yield.

[0092] Example 3: Observation method based on the cell morphology of Streptomyces nodosa

[0093] a. The amphotericin B prepared in Example 1 is produced by the engineering strain Streptomyces nodosuZJB2016050 D224A -Ftsz* was streaked onto a GYM plate and cultured at 26°C for 4 days. A single colony was selected and inoculated into a seed culture medium. The culture was then carried out at 26°C and 220 rpm for 48 h to obtain a seed solution.

[0094] The seed culture medium was prepared as follows: 20 g peptone, 5 g NaCl, 10 g glucose, 10 g yeast powder, 1 g CaCO3, dilute to 1 L with water, pH 7.0, and sterilize at 115 °C for 30 min.

[0095] b. Fermentation culture

[0096] The liquid volume of a 500 mL shake bottle is 10%. During fermentation, the seed liquid is inoculated at a volume concentration of 4%. The fermentation is cultured at 26° C. and 220 rpm for 132 hours to obtain amphotericin B fermentation liquid.

[0097] The fermentation medium composition: glucose 70g / L, cottonseed powder 25g / L, CaCO3 9g / L, KH2PO40.1g / L, solvent is distilled water, pH7.0, sterilized at 115℃ for 30min. After the fermentation, samples were taken and sent for testing of the strain morphology under scanning electron microscope. The original strain Streptomyces nodosus ZJB2016050 was used. D224A As a control, the mycelial morphology was different as Figure 5 shown.

[0098] The results showed that the hyphae of the recombinant Streptomyces tuberosus grew more dispersedly than the control group and were not easy to form granular flocs, which would reduce the viscosity of the fermentation broth and improve the utilization rate of the hyphae to oxygen and the culture medium matrix, thereby increasing the yield of AmB. Because the strain has a more single and sturdy hyphae, and the hyphae of the mutant strain grow in a dispersed form that is ideal for increasing the yield of AmB, it is not easy to form granular flocs, which effectively inhibits the coagulation of Streptomyces during fermentation, thereby reducing the viscosity of the fermentation broth and improving the utilization rate of the hyphae to oxygen and the culture medium matrix, thereby increasing the yield of AmB.

[0099] Example 4: Production of AmB by fermentation in a 5L fermenter based on the cell morphology of Streptomyces nodosa;

[0100] The AmB-producing genetically engineered bacteria (recombinant Streptomyces nodosa ZJB2016050) prepared in Example 1 were D224A -Ftsz*) spore suspension or slant culture was inoculated into seed medium and cultured at 28°C, 220 rpm for 48 h to obtain seed solution.

[0101] Fermentation conditions: 2 L of fermentation liquid was placed in a 5 L fermenter, the inoculation amount was 5% seed liquid by volume, 28°C, pressure 0.05 MPa, ventilation ratio 1.2 vvm, rotation speed 500 rpm, fermentation culture for 168 h to obtain fermentation liquid.

[0102] The seed culture medium was prepared as follows: 15 g peptone, 5 g NaCl, 10 g glucose, 10 g yeast powder, 1 g CaCO3, dilute to 1 L with water, pH 7.0, and sterilize at 115 degrees for 30 min.

[0103] The fermentation medium composition of the 5L fermenter is: glucose 70g / L, cottonseed powder 25g / L, CaCO3 9g / L, KH2PO40.1g / L, the solvent is tap water, pH 7.0, and sterilized at 115 degrees for 30 minutes.

[0104] Under the same conditions, the recombinant Streptomyces nodosa ZJB2016050 D224A (i.e., CCTCCNO: M 202301) was used as a control for fermentation culture.

[0105] Comparative Example 1 prepared AmB-producing genetically engineered bacteria (recombinant Streptomyces nodosa ZJB2016050 D224A -Ftsz*) and control bacteria (Streptomyces nodosus ZJB2016050 D224A ) In the case of fermentation in a 5L tank, the fermentation process curve is as follows Figure 6 and Figure 7The above genetically engineered bacteria were produced by natural fermentation in a 5L tank. According to the method of Example 5, the AmB production of the genetically engineered bacteria reached a maximum of 9.31 g / L at 108 h, which was 9.1% higher than that of the control strain, and the time to reach the maximum AmB was shortened by 12 h. In addition, the AmB production of the control bacteria continued to decrease after 120 h of fermentation, while the recombinant Streptomyces nodosa ZJB2016050 prepared in Example 1 D224A After the AmB production of -Ftsz* reached the maximum at 108h, there was a slight downward trend, but the decline was not obvious, and the decline rate of AmB production was significantly slower than that of the control bacteria.

[0106] Example 5: HPLC Detection Method for AmB

[0107] The fermentation broth prepared by the method of Example 4 was mixed with DMSO at a volume ratio of 1:9, extracted at room temperature for 20 to 30 minutes, centrifuged at 12000 rpm for 5 minutes, and the supernatant was filtered through a 0.22 μm organic filter membrane and detected by high performance liquid chromatography (HPLC).

[0108] Detection method: The chromatographic column is a C18 column (150×4.6 mm), the column temperature is 25°C, the flow rate is 1 mL / min, the injection volume is 20 μL, the chromatographic retention time is 22 min, and the detection wavelength is 405 nm. The elution time of AmB is 16.2-16.4 min.

[0109] The mobile phase was prepared as follows: 1.1 g EDTA-Na2 and 4.1 g sodium acetate were diluted to 1 L with distilled water, 900 mL of the solution was mixed with 700 mL acetonitrile and 400 mL methanol, and the pH was adjusted to 5.0 with acetic acid.

[0110] The calculation method of AmB production is as follows: the AmB standard obtained from Zhejiang Tiantai Pharmaceutical Company was used to prepare AmB standard solutions of different concentrations (0 mg / L, 20 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, 250 mg / L) with DMSO, and the peak areas of the above standard solutions were detected by HPLC. The standard curve was calculated based on the peak area and the concentration of the AmB standard solution as Y=113.23X+433.47, R 2 =0.9995 (e.g. Figure 8 As shown in the figure, X is the concentration of AmB and Y is the peak area). The AmB sample of unknown concentration can be tested by HPLC to obtain a peak area, which can be substituted into the above standard curve formula to obtain the corresponding concentration.

[0111] In summary, the mutant strain mycelium obtained in the present invention grows dispersedly, which inhibits the agglomeration of Streptomyces during fermentation, facilitates the reduction of the viscosity of the fermentation liquid in industrial production, and shortens the fermentation cycle of the strain by 12 hours. The AmB production of the genetically engineered bacteria reaches a maximum value of 9.31 g / L at 108 hours, which is 9.1% higher than that of the control strain, thereby further improving the AmB production.

[0112] The nucleotide sequence of the exogenous erythromycin strong promoter ermEp* shown in SEQ ID NO.1:

[0113] GACGTCCATGCGAGTGTCCGTTCGAGTGGCGGCTTGCGCCCGATGCTAGTCGCGGTTGATCGGCGATCGCAGGTGCACGCGGTCCATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTGCTGTTGTGGGCCAATCGTGCCGGTTGGTAGGATACAGAACCACTCCACAGGAGGACCCCA.

[0114] The nucleotide sequence of the fibrin homologous protein gene Ftsz shown in SEQ ID NO.2:

[0115]

[0116] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A recombinant Streptomyces tuberosum producing amphotericin B, characterized in that: The recombinant Streptomyces tuberosum includes an exogenous erythromycin strong promoter ermEp* and a fibrin homologous protein gene Ftsz.

2. The recombinant Streptomyces tuberosum producing amphotericin B according to claim 1, characterized in that: The nucleotide sequence of the exogenous erythromycin strong promoter ermEp* is shown in SEQ ID NO.1; the nucleotide sequence of the fibrin homologous protein gene Ftsz is shown in SEQ ID NO.

2.

3. A method for constructing a recombinant Streptomyces nodosa according to claim 1 or 2, characterized in that: include: (1) Insert the exogenous erythromycin strong promoter ermEp* into the multiple cloning site of the pJTU1278 plasmid to obtain the recombinant plasmid pJTU1278-ermEp*; (2) inserting the fibrin homologous protein gene Ftsz into the recombinant plasmid pJTU1278-ermEp* to obtain the recombinant expression plasmid pJTU1278-Ftsz*; (3) Introducing the recombinant expression plasmid pJTU1278-Ftsz* into the donor strain Escherichia coli to obtain the donor strain Escherichia coli containing the recombinant expression plasmid; (4) The donor strain Escherichia coli containing the recombinant plasmid constructed in step (3) is introduced into the recipient bacteria S. nodosus ZJB2016050 with a deposit number of CCTCCNO: M202301 by conjugation transfer method. D224A The genetically engineered bacteria S. nodosus ZJB2016050 was obtained. D224A -Ftsz* is a recombinant Streptomyces tuberosum that produces amphotericin B.

4. A recombinant expression plasmid, characterized in that: The basic plasmid includes the exogenous erythromycin strong promoter ermEp* and the fibrin homologous protein gene Ftsz.

5. The recombinant expression plasmid according to claim 1, characterized in that: The basic plasmid is pJTU1278 plasmid.

6. A method for constructing the recombinant expression plasmid according to claim 4 or 5, characterized in that: The exogenous erythromycin strong promoter ermEp* and the fibrin homologous protein gene Ftsz are connected to the basic plasmid by enzyme cutting to obtain a recombinant expression plasmid.

7. Use of the recombinant plasmid according to claim 4 or 5 in the fermentation preparation of amphotericin B and / or in the preparation of amphotericin B-producing recombinant Streptomyces tuberosum.

8. A method for preparing amphotericin B, characterized in that: The preparation method comprises: inoculating the seed liquid obtained after seed culture of the recombinant tuberous streptomyces according to claim 1 or 2 into a fermentation medium at an inoculation amount of 2 to 10% by volume, culturing for 96 to 168 hours at 26 to 31° C. and 400 to 500 r / min, and after the fermentation is completed, separating and purifying the fermentation product to obtain amphotericin B.

9. The preparation method according to claim 8, characterized in that: The seed culture process is as follows: the recombinant tuberous Streptomyces is inoculated on a GYM plate, grown at 25-28°C for 3-7 days, and gray spores are collected to prepare a spore suspension; the spore suspension is inoculated into a seed culture medium and cultured at 25-28°C for 24-48 hours to obtain a seed solution; the final concentration composition of the GYM plate is: 1-5 g / L glucose, 1-5 g / L yeast powder, 5-29 g / L malt extract, 1-3 g / L calcium carbonate, 15-20 g / L agar, the solvent is water, pH 7.0-7.5, and sterilized at 115°C for 30 minutes; the final concentration composition of the seed solution culture medium is: 10-20 g / L peptone, 5-10 g / L NaCl, 10-15 g / L glucose, 5-10 g / L yeast powder, 0.5-1 g / L CaCO3, the solvent is water, pH 7.0-7.2, and sterilized at 115°C for 30 minutes.

10. The preparation method according to claim 8, characterized in that: The fermentation medium is composed of 60-80 g / L glucose, 5-10 g / L beef extract, 5-10 g / L soybean protein powder, 8-30 g / L cottonseed powder, 5-10 g / L CaCO3, 0.1-0.4 g / L KH2PO4, water as solvent, pH 7.0, and sterilization at 115°C for 30 min.

Images