Bitoxin antibody drug conjugates and uses thereof

Abstract

The invention provides an antibody drug conjugate of double toxins and application of the antibody drug conjugate in preparation of drugs for treating cancers.

Description

[0001] Cross - reference to related applications

[0002] This application claims the priority and benefits of Chinese Patent Applications No. 202311543915.2 and No. 202410631122.4, the entire contents of which are incorporated herein by reference. Technical field

[0003] The present disclosure relates to the field of chemical medicine, and particularly to a dual - toxin antibody - drug conjugate and its uses. Background art

[0004] As a novel targeted therapeutic drug, the antibody - drug conjugate (ADC) utilizes the specificity of the antibody for binding to the surface antigens of normal and tumor cells and the high efficiency of the cytotoxin, and can effectively target and deliver the cytotoxin to the diseased site to exert its efficacy, while reducing the defect of excessive side effects of the cytotoxin in traditional drug forms, and is gradually playing an increasingly important role in the treatment of tumors and other fields.

[0005] The ADC drug consists of three parts: a monoclonal antibody, a linker, and a cytotoxic drug (cytotoxin). Most of the currently reported ADC drugs are antibody - drug conjugates containing one toxin, and relatively few reports are available on antibody - drug conjugates containing dual toxins. Summary of the invention

[0006] The first aspect of the present disclosure provides the use of the combination of triptolide and camptothecin drugs in the preparation of a drug for treating tumor diseases.

[0007] In some specific embodiments, triptolide and camptothecin drugs together serve as the toxins in the antibody - drug conjugate.

[0008] The second aspect of the present disclosure provides an antibody - drug conjugate containing dual toxins, which has the formula:

[0009]

[0010] Wherein, Ab is an antibody or its antigen - binding fragment;

[0011] D 1 and D 2 are selected from triptolide or camptothecin drugs, and D 1 and D 2 are not the same;

[0012] L 1 and L 2 are linking units;

[0013] x and y are from 0 to 8.

[0014] In some specific embodiments, L 1 is linked to Ab through a thiol or amide group. In some other specific embodiments, L 2 is linked to Ab through a glycosyl group.

[0015] In some specific embodiments, L 1 has the structure of [H 1 -L 1a -L 1b -L 1c -D 1 x shown. In some other specific embodiments, L 2 has the structure of [H 2 -L 2a- L 2b -L 2c -D 2 y shown. In some specific embodiments, H 1 and H 2 are the linker sites of Ab or groups capable of reacting with Ab. In some other specific embodiments, L 1a is the connecting unit between H 1 and L 1b , and L 2a is the connecting unit between H 2 and L 2b . In some specific embodiments, L 1b is the linker between L 1a and L 1c , and L 2b is the linker between L 2a and L 2c . In some specific embodiments, L 1c is the spacer between L 1b and D 1 , and L 2c is the spacer between L 2b and D 2 .

[0016] In some specific embodiments, H 1 and H 2 are selected from:

[0017] where represents the linking site.

[0018] In some other specific embodiments, H 1 is selected from:​​ In a preferred embodiment, H 1 is In some specific embodiments, H 2 is selected from:

[0019] In some specific embodiments, H 1 and H 2 are selected from:

[0020] wherein represents a linking site. In some other specific embodiments, H 2 is selected from:

[0021] In some specific embodiments, L 1a or L 2a contains -L d -C(O)-, wherein L d is selected from optionally substituted alkylene, optionally substituted polyethylene glycol group, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted alicyclic group, optionally substituted aliphatic heterocyclic group, optionally substituted arylene, optionally substituted heteroarylene or combinations thereof. In some other specific embodiments, L d is selected from optionally substituted C 1-30 alkylene, optionally substituted polyethylene glycol group, optionally substituted C 2-30 alkenylene, optionally substituted C 2-30 alkynylene, optionally substituted C 3-30 alicyclic group, optionally substituted C 1-30 aliphatic heterocyclic group, optionally substituted C 6-30 arylene, optionally substituted C 5-30 heteroarylene or combinations thereof. In some specific embodiments, L d is selected from -(CH 2 )m-, -(PEG)n- or -(CH 2 ) m -(PEG) n -(CH 2 ) z -, wherein m, n, z are integers from 0 to 10, preferably, m, n, z are integers from 0 to 8.

[0022] In some specific embodiments, L 1b or L 2b is a cleavable linker or a non-cleavable linker. In some specific embodiments, L 1b or L2b is a peptide chain composed of 2 - 10 cleavable amino acids. In a preferred embodiment, L 1b or L 2b is selected from Gly - Gly - Phe - Gly, Val - Cit, Val - Ala, Val - Lys, Val - Arg, AcLys - Val - Cit, AcLys - Val - Ala, Phe - Cit, Phe - Ala, Phe - Lys, Phe - Arg, Glu - Val - Ala, Glu - Val - Cit, Ala - Lys, Leu - Cit, lle - Cit, Trp - Cit, Ala - Ala - Asn, Ala - Ala - Ala, Ala - Asn, Lys. In a further preferred embodiment, L 1b or L 2b is selected from Gly - Gly - Phe - Gly, Val - Cit, Val - Ala, Val - Lys, Phe - Cit, Phe - Ala, Phe - Lys, Ala - Ala - Asn.

[0023] In some specific embodiments, L 1c or L 2c is selected from:

[0024] where represents the linking site. In a preferred embodiment, L 1c is selected from

[0025] In some specific embodiments, L 1 -D 1 is where L 1a is -(CH 2 ) m1 -C(O)- or -(PEG) n1 -(CH 2 ) z1 -C(O)-, where m 1 , n 1 , z 1 are integers from 2 - 8; L 1b is Gly - Gly - Phe - Gly, Val - Cit or Val - Ala; L 1c is D 1 is triptolide or a camptothecin drug.

[0026] In some specific embodiments, L 2 -D2 is wherein: L 2a is -(PEG) n2 -(CH 2 ) z2 -C(O)-, wherein n 2 , z 2 is an integer from 2 to 8; L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 2c is D 2 is triptolide or a camptothecin drug.

[0027] In some specific embodiments, L 2 -D 2 is wherein: L 2a is -(PEG) n2 -(CH 2 ) z2 -C(O)-, wherein n 2 , z 2 is an integer from 2 to 8; L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 2c is D 2 is triptolide or a camptothecin drug.

[0028] In some specific embodiments, L 1a is -(CH 2 ) m1 -C(O)-, wherein m 1 is an integer from 2 to 6, preferably 5. In some other specific embodiments, L 1a is -(PEG) n1 -(CH 2 ) z1 -C(O)-, wherein n 1 , z 1 is an integer from 2 to 6, preferably n 1 , z 1 is 2.

[0029] In some specific embodiments, L 2a is -(PEG) n2 -(CH 2 ) z2 -C(O)-, wherein n 2 , z 2 is an integer from 2 to 6. In some other specific embodiments, L 1a is -(PEG)n1 -(CH 2 ) z1 -C(O)-, where n 1 , z 1 is an integer from 2 to 6; preferably n 2 is an integer from 4 to 6, and z 2 is 2.

[0030] In some specific embodiments, D 1 is triptolide, and D 2 is a camptothecin drug. In some other specific embodiments, D 1 is a camptothecin drug, and D 2 is triptolide. In some specific embodiments, the camptothecin drugs are camptothecin, irinotecan, topotecan, SN38, or their derivatives. In some other specific embodiments, the camptothecin drug is irinotecan.

[0031] In some specific embodiments, x is selected from 2 - 8, preferably 3 - 5; y is selected from 3 - 4.

[0032] In some specific embodiments, x + y ≥ 4, preferably 4 ≤ x + y ≤ 9, more preferably 7 ≤ x + y ≤ 8.

[0033] In some specific embodiments, L 1 -D 1 is selected from:

[0034]

[0035] In some more specific embodiments, L 1 -D 1 is selected from:

[0036]

[0037]

[0038] In some specific embodiments, L 2 -D 2 is selected from:

[0039]

[0040]

[0041] In some more specific embodiments, L 2 -D 2 is selected from:

[0042]

[0043]

[0044] In some specific embodiments, L 1 -D 1 is:

[0045]

[0046] L 2 -D 2 is:

[0047]

[0048] In some specific embodiments, L 1 -D 1 is:

[0049]

[0050] L 2 -D 2 is:

[0051]

[0052] In some specific embodiments, L 1 -D 1 is:

[0053]

[0054] L 2 -D 2 is:

[0055]

[0056] In some specific embodiments, L 1 -D 1 is:

[0057]

[0058] L 2 -D 2 is:

[0059]

[0060] In some specific embodiments, L 1 -D 1 is:

[0061]

[0062] L 2 -D 2 is:

[0063]

[0064] In some specific embodiments, L 1 -D 1 is:

[0065]

[0066] L 2 -D 2 is:

[0067]

[0068] In some specific embodiments, L 1 -D 1 is:

[0069]

[0070] L 2 -D 2 is:

[0071]

[0072] In some specific embodiments, L 1 -D 1 is:

[0073]

[0074] L 2 -D 2 is:

[0075]

[0076] In some embodiments, the L 2 is linked to the antibody through an oligosaccharide, and the oligosaccharide is located in the Fc fragment of the antibody and is specifically linked to the asparagine residue of the Fc fragment. In some embodiments, the glycan types that can be conjugated include G0-GN, G0F-GN, G0, G0F, G1, G1F, etc. In some preferred embodiments, the glycan type of the oligosaccharide is G0, G0F, and / or G1F. In some embodiments, the oligosaccharide on the antibody is modified by azide. In some preferred embodiments, the azide modification includes: contacting the antibody with UDP-GalNAz and GalT1 for reaction. In some other embodiments, the azide-modified antibody is linked to the DBCO on the L 2 through a coupling reaction. In some other preferred embodiments, the coupling reaction includes: reacting the azide-modified antibody with the DBCO on the L 2 through a click chemical reaction to complete the L 2Conjugated to the glycosyl of an antibody.

[0077] In some specific embodiments, the antibody or antigen-binding fragment binds to one or more selected from the following: carbonic anhydrase IX, alpha-fetoprotein, alpha-actinin, A3, A33, ART4, B7, B7H3, B7H4, BAGE, BrE3 antigen, CA125, CAMEL, CAP", CASP-8 / m, CCL19, CCL21, CD1, CD1a, CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD44, CD45, CD46, CD52, CD54, CD55, CD59, CD64, CD66a-e, CD67, CD70, CD70L, CD74, CD79a, CD80, CD83, CD95, CD126, CD132, CD133, CD138, CD147, CD154, CDC27, CDK-4, CDKN2A, HIF-Iα, colon-specific antigen p (CSAp), CEA, CEACAM5, CEACAM6, oMet, DAM, EGFR, EGFRvIII, cMet, EGP-1 (Trop-2), EGP-2, ELF2-M, Ep-CAM, Her2, Her3, Claudin 18.2, ROR1, ROR2, dll3, marcl7, fibroblast growth factor (FGF), Flt-1, Flt-3, folate receptor, G250 antigen, GAGE, gp100, GRO-β, HLA-DR, HML24, HMGB-1, HSP70-2M., IGF-1R, IGR1R, MAGE, MAGE-3, MART-1, MART-2, NY-ESO-1, TRAG3, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC4, MUC5ac, MUC13, MUC16, MUM-1 / 2, MUM-3, NCA66, NCA95, NCA90, pancreatic mucin, PD-1 receptor, PD-L1 receptor, placental growth factor, PLAGL2, prostate acid phosphatase, PSA, PRAME, PSMA, P1GF, ILGF, ILGF-1R, RS5, RANTES, T101, SAGE, S100, survivin, survivin-2B, TAG, TAG-72, tenascin, TRAIL receptor, Tn antigen, ED-B, WT-1, 17-1A antigen.In some other specific embodiments, the antibody or antigen-binding fragment binds to one or more selected from the following: Her2, Her3, B7H3, Claudin 18.2, DLL-3, EGP-1 (Trop-2).

[0078] In some specific embodiments, the antibody or antigen-binding fragment is selected from epratuzumab, veltuzumab, sacituzumab, patritumab, trastuzumab, pertuzumab, abciximab, alemtuzumab, cetuximab, gemtuzumab, ibritumomab, panitumumab, rituximab, tositumomab, abagovomab, atlizumab, benralizumab, obinutuzumab, basiliximab, dadizumab, efalizumab, muromomab, natlizumab, omalizumab, gaiitenemmab, solanezumab, tisotumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, enfortumab, belantamab, cetuximab, loncastuximab, daratumumab, nimotuzumab, zolbetuximab, omburtamab, rovalpituzumab. In some other specific embodiments, the antibody or antigen-binding fragment is selected from sacituzumab, daratumumab, zolbetuximab, omburtamab, patritumab, rovalpituzumab.

[0079] In some specific embodiments, the antibody or antigen-binding fragment comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises three complementary determining regions HCDR1-3, which respectively comprise the amino acid sequences set forth in SEQ ID NOs: 1-3; wherein the light-chain variable region comprises three complementary determining regions LCDR1-3, which respectively comprise the amino acid sequences set forth in SEQ ID NOs: 4-6; preferably, the heavy-chain variable region of the antibody or its antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO: 7, and the light-chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 8. In some other specific embodiments, the heavy chain of the antibody or its antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO: 9, and the light chain comprises the amino acid sequence set forth in SEQ ID NO: 10.

[0080] In some specific embodiments, the antibody or antigen-binding fragment comprises a heavy-chain variable region and a light-chain variable region. The heavy-chain variable region includes three complementarity-determining regions HCDR1-3, which respectively comprise the amino acid sequences set forth in SEQ ID NO: 11-13; wherein the light-chain variable region includes three complementarity-determining regions LCDR1-3, which respectively comprise the amino acid sequences set forth in SEQ ID NO: 14-16. In some other specific embodiments, the heavy-chain variable region of the antibody or its antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO: 17, and the light-chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 18; more preferably, the heavy chain of the antibody or its antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO: 19, and the light chain comprises the amino acid sequence set forth in SEQ ID NO: 20.

[0081] The third aspect of the present disclosure provides a pharmaceutical composition comprising the antibody-drug conjugate described herein. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, excipient or diluent.

[0082] The fourth aspect of the present disclosure provides the use of the antibody-drug conjugate described herein in the preparation of a drug for treating and / or preventing tumors.

[0083] In some specific embodiments, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In some other specific embodiments, the tumor comprises a solid tumor or a hematological tumor. In some specific embodiments, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.

[0084] The fifth aspect of the present disclosure provides the antibody-drug conjugate described herein for treating tumor diseases.

[0085] In some specific embodiments, triptolide and camptothecin drugs are jointly used as the toxin in the antibody-drug conjugate.

[0086] In some specific embodiments, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In some other specific embodiments, the tumor comprises a solid tumor or a hematological tumor. In some specific embodiments, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.

[0087] The sixth aspect of the present disclosure provides a method for treating and / or preventing a tumor, the method comprising administering a therapeutically effective amount of the antibody-drug conjugate described herein to an individual in need thereof.

[0088] In some specific embodiments, triptolide and camptothecin drugs are jointly used as the toxin in the antibody-drug conjugate.

[0089] In some specific embodiments, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In some other specific embodiments, the tumor comprises a solid tumor or a hematological tumor. In some specific embodiments, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.

[0090] The seventh aspect of the present disclosure provides the use of the antibody-drug conjugate described herein in the treatment and / or prevention of a tumor.

[0091] In some specific embodiments, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR. In some other specific embodiments, the tumor comprises a solid tumor or a hematological tumor. In some specific embodiments, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 Schematic diagram showing the ADC structure containing dual toxins.

[0093] Figure 2A Showing the expression of HSP70 in HCT-15 (human colorectal cancer) cells used in Example 12.

[0094] Figure 2B Showing the expression of the efflux valve gene ABAC1 in HCT-15 (human colorectal cancer) cells used in Example 12.

[0095] Figure 3A Showing the change in mouse tumor volume in the human colorectal cancer mouse model (COLO205 cells) used in Example 13.

[0096] Figure 3B Showing the change in mouse tumor weight in the human colorectal cancer mouse model (COLO205 cells) used in Example 13.

[0097] Figure 4 Showing the change in mouse tumor volume in the human pancreatic cancer mouse model (Bxpc-3 cells) used in Example 14.

[0098] Figure 5 Showing the change in mouse tumor volume in the human colorectal cancer drug-resistant mouse model (HCT-15-TROP2 cells) used in Example 15.

[0099] Figure 6A Showing the effect of the small molecule toxin used in Example 16 on the confluence of MX-1 cells (human breast cancer cells).

[0100] Figure 6B Showing the effect of the small molecule toxin used in Example 16 on the confluence of WiDr cells (human colorectal cancer cells).

[0101] Figure 6C Showing the effect of the small molecule toxin used in Example 16 on the confluence of HeLa cells (human cervical cancer cells).

[0102] Figure 6D Showing the effect of the small molecule toxin used in Example 16 on the confluence of MFE-280 cells (human endometrial cancer cells).

[0103] Figure 7A Showing the effect of the small molecule toxin used in Example 16 on the viability of HuH-7 cells (human liver cancer cells).

[0104] Figure 7B Showing the effect of the small molecule toxin used in Example 16 on the viability of NUGC-4 cells (human gastric cancer cells).

[0105] Figure 7C Shows the effect of the small molecule toxin used in Example 16 on the viability of Calu-6 cells (human degenerative cancer cells).

[0106] Figure 8A Shows the change in tumor volume of mice in the human colorectal cancer drug-resistant model (HCT-15-TROP2 cells) used in Example 17.

[0107] Figure 8B Shows the change in tumor weight of mice in the human colorectal cancer drug-resistant model (HCT-15-TROP2 cells) used in Example 17.

[0108] Figure 9A Shows the change in tumor volume of mice in the human lung cancer model (NCI-H2170 cells) used in Example 18.

[0109] Figure 9B Shows the change in tumor weight of mice in the human lung cancer model (NCI-H2170 cells) used in Example 18.

[0110] Figure 10 Shows the change in tumor volume of mice in the human NCI-H292 CDX model used in Example 22.

[0111] Figure 11 Shows the change in tumor volume of mice in the subcutaneous tumor-bearing model of human gastric cancer (NUGC-4 cells) used in Example 27.

[0112] Figure 12A Shows the change in tumor volume of mice in the subcutaneous tumor-bearing model of human colon cancer (COLO205 cells) used in Example 28.

[0113] Figure 12B Shows the change in tumor volume of mice in the subcutaneous tumor-bearing model of human colon cancer (COLO205 cells) used in Example 28.

[0114] Figure 13A Shows the change in tumor volume of mice in the subcutaneous tumor-bearing model of human squamous cell lung cancer (NCI-H2170 cells) used in Example 29.

[0115] Figure 13B Shows the change in tumor volume of mice in the subcutaneous tumor-bearing model of human colon cancer (NCI-H2170 cells) used in Example 29. Detailed implementation manners

[0116] In the following description, certain specific details are included to provide a comprehensive understanding of each disclosed embodiment. However, those skilled in the relevant art will recognize that the embodiments can be implemented without one or more of these specific details, and other methods, components, materials, etc. can be used instead.

[0117] Unless otherwise required in this disclosure, throughout the specification and claims, the words "comprising" and "including" shall be construed in an open, inclusive sense, i.e., "including but not limited to".

[0118] References throughout this specification to "one embodiment" or "another embodiment" or "an embodiment" or "certain embodiments" mean that a particular reference element, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases "one embodiment" or "an embodiment" or "another embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Further, the particular elements, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0119] It should be understood that the singular forms of the articles "a" (corresponding to "a", "an", and "the" in English) used in the specification and claims of this disclosure include plural referents unless the context clearly dictates otherwise.

[0120] Term Definitions

[0121] Unless the context clearly indicates otherwise, the following terms used in the specification and claims have the following meanings:

[0122] The shorthand symbols prefixed to certain chemical groups named in this disclosure represent the total number of carbon atoms in the indicated chemical group. For example, C 1 -C 30 Alkyl is described as alkyl having a total of 1 to 30 carbon atoms as defined below, and C 3 -C 30 Cycloalkyl is described as cycloalkyl having a total of 3 to 30 carbon atoms as defined below. The total number of carbons in the shorthand symbol does not include the carbons in substituents that may be present in the group.

[0123] In this disclosure, the carbon number ranges before substituents are intended to include all sub-ranges within that range as well as individual values. For example, "C 1-30 " is considered to include "C 1-20 ", "C 1-10 ", "C 2-30 ", "C 2-20 ", "C 2-10 ", "C 3-30 ", "C 3-20 ", "C 3-10 ", etc. For example, "C 6-30 " is considered to include "C 6-24 ", "C 6-18 ", "C 6-15”, “C 6-12 ” etc. In addition, “C 2-30 ” and “C 5-30 ” are also correspondingly explained.

[0124] In the present disclosure, the term “halogen” refers to fluorine, chlorine, bromine or iodine.

[0125] In the present disclosure, the term “hydroxyl” refers to the -OH group.

[0126] In the present disclosure, the term “amino” refers to -NH 2 group.

[0127] In the present disclosure, the term “carboxyl” refers to the -COOH group.

[0128] In the present disclosure, the term “cyano” refers to the -CN group.

[0129] In the present disclosure, the term “nitro” refers to -NO 2 group.

[0130] In the present disclosure, the term “hydrocarbyl” refers to an aliphatic hydrocarbon group. The hydrocarbyl moiety can be a “saturated hydrocarbyl” group, i.e., an alkyl group, which does not contain any olefinic or acetylenic moiety. The hydrocarbyl moiety can also be an “unsaturated hydrocarbyl” moiety, i.e., an alkenyl group or an alkynyl group, which contains at least one olefinic or acetylenic moiety. “Alkyl” refers to a saturated hydrocarbon group composed of a specified number of carbon atoms. “Alkenyl” refers to a group composed of a specified number of carbon atoms and at least one carbon-carbon double bond, and a straight-chain or branched-chain hydrocarbon chain group connected to the rest of the molecule by a single bond, such as vinyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. “Alkynyl” refers to a group composed of a specified number of carbon atoms and at least one carbon-carbon triple bond, and a straight-chain or branched-chain hydrocarbon chain group connected to the rest of the molecule by a single bond. The hydrocarbyl moiety, whether saturated or unsaturated, can be branched or straight-chain. In the present disclosure, the term “hydrocarbylene”, such as “alkylene”, “alkenylene” and “alkynylene”, refers to the corresponding divalent hydrocarbyl group.

[0131] In the present disclosure, the term “hydrocarbyloxy” refers to the general formula -O-hydrocarbyl, where the hydrocarbyl is as defined in the present disclosure. Exemplary examples of hydrocarbyloxy include, but are not limited to, methoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy and tert-pentyloxy.

[0132] In the present disclosure, the term "aryl" refers to a carbocyclic (all-carbon) or two or more fused rings (rings sharing two adjacent carbon atoms) having a fully delocalized pi electron system. Aryl groups include, but are not limited to, fluorenyl, phenyl, biphenyl, and naphthyl. In the present disclosure, the term "arylene" refers to a divalent aryl group as described above.

[0133] In the present disclosure, the term "heteroaryl" refers to an aromatic ring group composed of a specified number of carbon atoms (e.g., 3 to 30 carbon atoms) and 1 to 5 heteroatoms selected from nitrogen, oxygen, and sulfur. Heteroaryl can be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which can include fused or bridged ring systems. Exemplary examples of heteroaryl include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepanyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyrone, benzofuranyl, benzofuranone, benzothienyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanone, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolinyl, indolizinyl, isoxazolyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, epoxyethyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thienyl. The term "heteroarylene" refers to a divalent heteroaryl group as described above.

[0134] In the present disclosure, the term "alicyclic group" refers to a stable non-aromatic monocyclic hydrocarbon group composed only of carbon and hydrogen atoms, saturated or unsaturated, and connected to the rest of the molecule by a single bond, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclodecyl, etc. The term "alicyclic hetero group" refers to a divalent alicyclic hetero group as described above.

[0135] In the present disclosure, "substituted" means substituted with one or more substituents selected from the following: deuterium, halogen, amino group, cyano group, nitro group, C 1 -C 10 alkyl group, C 1 -C 10 alkoxy group, C 1 -C 10 alkylamino group, C2 -C 10 alkenyl group, C 2 -C 10 alkynyl group, C 3 -C 10 cycloalkyl group, C 6 -C 20 aryl group and C 2 -C 20 heteroaryl group.

[0136] In the present disclosure, the terms "individual" and "patient" are used interchangeably and refer to animals (e.g., humans), companion animals (e.g., dogs, cats, or horses), and livestock (e.g., cows, pigs, and sheep). In certain embodiments, the individual is a mammal including both males and females. In certain embodiments, the individual is a human.

[0137] In the present disclosure, the term "mammal" refers to animals including, for example, dogs, cats, cows, sheep, horses, and humans. In certain embodiments, the mammal includes humans.

[0138] In the present disclosure, the term "pharmaceutically acceptable" refers to carriers, vehicles, diluents, excipients, and / or salts that must be compatible with the other components of the formulation and not harmful to its recipient.

[0139] In the present disclosure, the term "optional" or "optionally" means that the subsequent described event or condition may or may not occur, and the specification includes the cases where the event or condition occurs and the cases where it does not occur.

[0140] In the present disclosure, the term "pharmaceutically acceptable excipient" includes, but is not limited to, any auxiliary substances in various forms that have been approved by the US Food and Drug Administration for use in humans or animals and have no side effects on the composition of the pharmaceutical composition, such as carriers, glidants, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers, etc.

[0141] In the present disclosure, the term "carrier" is defined as a compound that facilitates the introduction of a compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) is commonly used as a carrier because it easily introduces certain organic compounds into the cells or tissues of an organism.

[0142] In the present disclosure, the term "diluent" is defined as a substance used to dilute the main drug component in a pharmaceutical preparation, and its main function is to uniformly mix a trace amount of the main drug component with other components, thereby improving the content uniformity of the drug in the preparation, or improving the formability of the preparation to meet the requirements of the preparation process.

[0143] In the present disclosure, the term "pharmaceutically acceptable salt" includes "acceptable acid addition salts" and "acceptable base addition salts".

[0144] In the present disclosure, the term "acceptable acid addition salt" refers to those salts that retain the biological effectiveness and properties of the free base, and the acid addition salts are biologically or otherwise suitable and are formed using inorganic acids or organic acids. Examples of the inorganic acids include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc. Examples of the organic acids include, but are not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclohexanesulfamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, mucic acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, etc.

[0145] In the present disclosure, the term "acceptable base addition salt" refers to those salts that retain the biological effectiveness and properties of the free acid, and the base addition salts are biologically or otherwise suitable. These salts are prepared by adding an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, etc. In certain embodiments, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and salts of basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benzylamine, phenethylenediamine, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. In certain embodiments, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0146] In the present disclosure, the term "solvent or solvent mixture" refers to any and all solvents. In certain embodiments, the solvent or solvent mixture is an organic solvent and water, including but not limited to methanol, ethanol, 2-propanol, n-butanol, isobutanol, acetone, methyl ethyl ketone, ethyl acetate, 1,4-dioxane, diethyl ether, methyl tert-butyl ether, tetrahydrofuran, acetonitrile, dichloromethane, chloroform, N,N-dimethylformamide, cyclohexane, cyclopentane, n-hexane, n-heptane, n-pentane, toluene, o-xylene, p-xylene, dimethyl sulfoxide (DMSO), pyridine, acetic acid, anisole, butyl acetate, cumene, ethyl formate, formic acid, isobutyl acetate, isopropyl acetate, methyl acetate, 3-methyl-1-butanol, methyl isobutyl ketone, 2-methyl-1-propanol, 1-pentanol, propyl acetate, ethylene glycol, and 1-methyl-2-pyrrolidone, and any and all mixtures of two or more such solvents. In certain embodiments, the solvent or solvent mixture is a single solvent and a binary mixture. In certain embodiments, the solvent or solvent mixture is a single solvent of water and an organic solvent and a binary mixture of water and an organic solvent.

[0147] In the present disclosure, the term "pharmaceutical composition" refers to a formulation formed by a compound described in the present disclosure and a medium that is commonly accepted in the art for delivering a bioactive compound to a mammal such as a human. Such a medium includes all pharmaceutically acceptable carriers, diluents, or excipients.

[0148] In the present disclosure, the terms "therapeutically effective amount" and "effective amount" are used interchangeably and refer to the amount of a compound or combination of compounds that improves, attenuates, or eliminates a particular disease or condition and the symptoms of a particular disease or condition, or prevents or delays the onset of a particular disease or condition or the symptoms of a particular disease or condition. Depending on the compound, the disease state and its severity, and the age, weight, etc. of the mammal to be treated, the amount of the compound described in the present disclosure that constitutes a "therapeutically effective amount" will vary, but those skilled in the art can routinely determine the amount of the compound described in the present disclosure based on their own knowledge and the present disclosure.

[0149] "Treatment" as used in the present disclosure encompasses treating a relevant disease or disease state in a mammal such as a human suffering from the relevant disease or disorder, and includes:

[0150] (i) preventing the occurrence of a disease or disease state in a mammal, particularly when the mammal is susceptible to the disease state but has not been diagnosed with such a disease state;

[0151] (ii) inhibiting a disease or disease state, i.e., preventing its occurrence; or

[0152] (iii) alleviating a disease or disease state, i.e., causing the disease or disease state to regress or not progress.

[0153] As used in the present disclosure, the terms "disease", "disorder" and "disease state" may be used interchangeably or may be different, because a particular disease or disease state may not have a known causative agent (and thus cannot be explained etiologically), and thus it is not recognized as a disease but is considered an undesirable disease state or disorder, in which a clinician has identified a more or less specific series of symptoms.

[0154] In the present disclosure, the term "physiologically acceptable" refers to a carrier or diluent that does not eliminate the biological activity and properties of a compound.

[0155] Exemplary Embodiments

[0156] The present disclosure unexpectedly finds that triptolide combined with camptothecin drugs has a synergistic effect, can significantly improve the killing effect on tumor cells, and is expected to provide a new treatment strategy for tumor diseases.

[0157] Therefore, the present disclosure provides the use of triptolide combined with camptothecin drugs in the preparation of a drug for treating tumor diseases.

[0158] In some specific embodiments, the present disclosure finds that triptolide and camptothecin drugs can jointly serve as toxins in antibody-drug conjugates for the preparation of drugs for treating tumor diseases.

[0159] In some specific embodiments, the camptothecin drugs are exemplarily camptothecin (CPT), irinotecan, exatecan, topotecan, SN38 or derivatives thereof. In some preferred embodiments, the camptothecin drug is exatecan.

[0160] In some specific embodiments, the molar ratio of triptolide to camptothecin drugs is 0.1 to 10:1. In some other preferred embodiments, the molar ratio of triptolide to camptothecin drugs is 1:0.5 to 1:2. In some other preferred embodiments, the molar ratio of triptolide to camptothecin drugs is about 1:1.

[0161] In some more specific embodiments, the present disclosure provides an antibody-drug conjugate comprising a dual toxin, which has the formula:

[0162]

[0163] wherein Ab is an antibody or an antigen-binding fragment thereof;

[0164] D 1 and D 2 are toxins with antitumor activity, and D 1 、D 2Selected from triptolide or camptothecin drugs, D 1 、D 2 are not the same;

[0165] L 1 and L 2 are linking units connecting the toxin and the antibody;

[0166] x, y are 0 - 8, and x, y are integers or non-integers.

[0167] In some more specific embodiments, x, y can be 0, 1, 2, 3, 4, 5, 6, 7 or 8, and other values between these values. In some more specific embodiments, the sum of x and y is greater than or equal to 4.

[0168] In some more specific embodiments, the present disclosure provides an antibody-drug conjugate comprising a dual toxin, which has the formula:

[0169] Ab-(L 1 -D 1 -L 2 -D 2 ) x

[0170] wherein, Ab is an antibody or an antigen-binding fragment thereof;

[0171] D 1 and D 2 are toxins with anti-tumor activity, and D 1 、D 2 are selected from triptolide or camptothecin drugs, D 1 、D 2 are not the same;

[0172] L 1 and L 2 are linking units connecting the toxin and the antibody;

[0173] x is 2 - 8, and x, y are integers or non-integers.

[0174] In some more specific embodiments, x, y can be 2, 3, 4, 5, 6, 7 or 8, and other values between these values.

[0175] In some embodiments, the L 1 is linked to Ab through a thiol group or an amide group. In some preferred embodiments, the L 1 is linked to the Fab fragment of Ab. One of the most common methods for conjugating an antibody with a toxin is to utilize the lysine residues of the antibody, the amino acid nucleophilic NH 2The group reacts with the electrophilic N-hydroxysuccinimide (NHS) group on the payload. In addition, through the disulfide re-bridging strategy, the four inter-chain disulfide bonds contained in the IgG antibody can be reduced to generate eight thiol groups, which react with the maleimide linker. In addition, the coupling of toxins and antibodies can also be carried out using divinylpyrimidine re-bridging technology, dibromopyridinedione bridging technology, disulfone re-bridging coupling technology, engineered unnatural amino acid bioconjugation, etc.

[0176] In some embodiments, the L 2 is linked to Ab through a glycosyl group. In some preferred embodiments, the L 2 is linked to the Fc fragment of Ab. Since IgG is a glycoprotein, it contains N-glycans at the asparagine residue positions of the CH 2 domains of each heavy chain in the Fc fragment, and this glycosylation can serve as an attachment point for linking the payload. In some embodiments, the L 2 is linked to the antibody through an oligosaccharide, and the oligosaccharide is located in the Fc fragment of the antibody and is specifically linked to the asparagine residue of the Fc fragment. In some embodiments, the glycan types that can be conjugated include G0-GN, G0F-GN, G0, G0F, G1, G1F, etc. In some preferred embodiments, the glycan type of the oligosaccharide is G0, G0F, and / or G1F. In some preferred embodiments, the oligosaccharide on the antibody is modified by azide. In some preferred embodiments, the azide modification includes: contacting the antibody with UDP-GalNAz and GalT1 for reaction. In some other embodiments, the azide-modified antibody is linked to the DBCO on the L 2 through a coupling reaction. The L 2 is linked to the asparagine (Asn residue) on the antibody through an oligosaccharide. More preferably, the L 2 is linked to the asparagine on the antibody through GlcNac on the oligosaccharide. In some specific embodiments, the oligosaccharide is linked to the Fc fragment of the antibody. In some specific embodiments, the oligosaccharide is linked to the CH 2 domain of the Fc fragment. In some more specific embodiments, the oligosaccharide is linked to the Asn of the Fc fragment. In some other preferred embodiments, the coupling reaction includes: reacting the azide-modified antibody with the DBCO on the L 2 through a click chemical reaction to complete the connection of the L 2Conjugated to the glycans of the antibody. For the glycan conjugation method, see the reference Chemoenzymatic Conjugation of Toxic Payloads to the Globally Conserved N-Glycan of Native mAbs Provides Homogeneous and Highly Efficacious Antibody-Drug Conjugate, RV Geel et al., Bioconjug Chem. 2015 Nov 18; 26(11):2233-42.

[0177] In some embodiments:

[0178] The L 1 has the structure of [H 1 -L 1a -L 1b -L 1c -D 1 x as shown;

[0179] The L 2 has the structure of [H 2 -L 2a- L 2b -L 2c -D 2 y as shown;

[0180] H 1 and H 2 are the linker sites of the antibody or its antigen-binding fragment or groups capable of reacting with Ab;

[0181] L 1a is the connecting unit between the linker site H 1 and L 1b ; L 2a is the connecting unit between the linker site H 2 and L 2b ;

[0182] L 1b is the linker between L 1a and L 1c ; L 2b is the linker between L 2a and L 2c ;

[0183] L 1c is the spacer between L 1b and D 1 ; L​​2c is the spacer between L 2b and D 2 In some embodiments, the spacer between H

[0184] In some embodiments, the H 1 and H 2 are selected from:

[0185]

[0186] In some embodiments, the H 1 are selected from:

[0187] Preferably, the H 1 is

[0188] In some embodiments, the H 2 are selected from:

[0189]

[0190] In some embodiments, the L 1a or L 2a contains -L d -C(O)-, wherein L d is selected from optionally substituted alkylene, optionally substituted polyethylene glycol group, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted alicyclic group, optionally substituted aliphatic heterocyclic group, optionally substituted arylene, optionally substituted heteroarylene or combinations thereof.

[0191] In some embodiments, the L d is selected from -(CH 2 )m-, -(PEG)n- or -(CH 2 ) m -(PEG) n -(CH 2 ) z -, where m, n, z are integers from 0 to 10, preferably, m, n, z are integers from 0 to 8. For example, m, n, z are 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or a range composed of any two of these values.

[0192] In some embodiments, the L 1b or L 2bis a cleavable linker or an uncleavable linker. ADCs based on non-cleavable linkers must be internalized, and the antibody part needs to be degraded by lysosomal proteases to release the active molecule. A representative non-cleavable linker is N-succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC). Cleavable linkers can be divided into enzyme-dependent and non-enzyme (chemical)-dependent linkers. A typical chemical-dependent linker is a linker containing a disulfide bond, which is subjected to a nucleophilic attack by thiol to release the active carrier. Enzyme linkers are currently the most promising type of linker, which can be enzymatically cleaved by enzymes such as cathepsin, phosphatase, pyrophosphatase, β-glucuronidase, β-galactosidase, sulfatase, etc.

[0193] In some embodiments, the L 1b or L 2b is a cleavable peptide chain composed of 2 to 10 amino acids; preferably, the L 2 or L 5 is selected from Gly-Gly-Phe-Gly (abbreviated as GGFG), Val-Cit (abbreviated as VC), Val-Ala (abbreviated as VA), Val-Lys, Val-Arg, AcLys-Val-Cit, AcLys-Val-Ala, Phe-Cit, Phe-Ala, Phe-Lys, Phe-Arg, Glu-Val-Ala, Glu-Val-Cit, Ala-Lys, Leu-Cit, lle-Cit, Trp-Cit, Ala-Ala-Asn, Ala-Ala-Ala, Ala-Asn, Lys; preferably, the L 1b or L 2b is selected from Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Phe-Cit, Phe-Ala, Phe-Lys, Ala-Ala-Asn.

[0194] In some embodiments, the L 1c or L 2c is selected from:

[0195]

[0196] In some preferred embodiments, the L 1c is selected from

[0197] In some specific embodiments, the L 1 -D 1 is:

[0198] Wherein:

[0199] L 1a is -(CH 2 ) m1 -C(O)- or -(PEG) n1 -(CH 2 ) z1 -C(O)-, where m 1 , n 1 , z 1 are integers from 2 to 8;

[0200] L 1b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala;

[0201] L 1c is D 1 is triptolide or a camptothecin drug.

[0202] In a more specific embodiment, m 1 , n 1 , z 1 are 2, 3, 4, 5, 6, 7, 8, or a range composed of any two of these values.

[0203] In some preferred embodiments, the L 1a is -(CH 2 ) m1 -C(O)-, where m 1 is an integer from 2 to 6, preferably 5; or L 1a is -(PEG) n1 -(CH 2 ) z1 -C(O)-, where n 1 , z 1 are integers from 2 to 6, preferably n 1 , z 1 is 2.

[0204] In some specific embodiments, the L 2 -D 2 is:

[0205] Where:

[0206] L 2a is -(PEG) n2 -(CH 2 ) z2 -C(O)-, where n 2 , z 2 are integers from 2 to 8;

[0207] L2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala;

[0208] L 2c is D 2 is triptolide or a camptothecin drug.

[0209] In a more specific embodiment, n 2 , z 2 is 2, 3, 4, 5, 6, 7, 8, or a range composed of any two of these values.

[0210] In some preferred embodiments, the L 2a is -(PEG) n2 -(CH 2 ) z2 -C(O)-, where n 2 , z 2 is an integer from 2 to 6; or L 1a is -(PEG) n1 -(CH 2 ) z1 -C(O)-, where n 1 , z 1 is an integer from 2 to 6, preferably n 2 is an integer from 4 to 6, and z 2 is 2.

[0211] In some embodiments, the D 1 is triptolide, and D 2 is a camptothecin drug.

[0212] In some preferred embodiments, the D 1 is a camptothecin drug, and D 2 is triptolide.

[0213] In some embodiments, the camptothecin drug is camptothecin (CPT), irinotecan, topotecan, SN38 or a derivative thereof; preferably, the camptothecin drug is irinotecan.

[0214] Exemplarily, the camptothecin drug or derivative has the following structure:

[0215]

[0216] In some preferred embodiments, the camptothecin drug is irinotecan.

[0217]

[0218] In some embodiments, x is selected from 2 - 8, preferably 3 - 5; y is selected from 3 - 4.

[0219] In some embodiments, the D 1 is

[0220] In some embodiments, the D 2 is In some embodiments, the D 1 is In some embodiments, the D 2 is In some embodiments, the L 1 -D 1 The structure is selected from:

[0221]

[0222] In some embodiments, the L 2 -D 2 The structure is selected from:

[0223]

[0224] In some specific embodiments, the L 1 -D 1 The structure is:

[0225]

[0226] L 2 -D 2 The structure is:

[0227]

[0228] In some other specific embodiments, the L 1 -D 1 The structure is:

[0229]

[0230] L 2 -D 2 The structure is:

[0231]

[0232] In some other specific embodiments, the L 1 -D 1 The structure is:

[0233]

[0234] L2 -D 2 The structure is:

[0235]

[0236] In some other specific embodiments, the L 1 -D 1 The structure is:

[0237] L 2 -D 2 The structure is:

[0238]

[0239] In some embodiments, the L 2 is linked to the antibody through an oligosaccharide, and the oligosaccharide is located in the Fc fragment of the antibody and is specifically linked to the asparagine residue of the Fc fragment. In some embodiments, the glycoforms that can be conjugated include G0 - GN, G0F - GN, G0, G0F, G1, G1F, etc. In some preferred embodiments, the glycoform of the oligosaccharide is G0, G0F, and / or G1F. In some embodiments, the oligosaccharide on the antibody is modified by azide. In some preferred embodiments, the azide modification includes: contacting the antibody with UDP - GalNAz and GalT1 for reaction. In some other embodiments, the azide - modified antibody is linked to the DBCO on L2 through a conjugation reaction. In some other preferred embodiments, the conjugation reaction includes: coupling the azide - modified antibody with the DBCO on L2 through a click chemical reaction to complete the glycosyl conjugation of L2 and the antibody.

[0240] In some embodiments, the antibody or antigen-binding fragment binds to one or more selected from the following: carbonic anhydrase IX, alpha-fetoprotein, alpha-actinin, A3, A33, ART4, B7, B7H3, B7H4, BAGE, BrE3 antigen, CA125, CAMEL, CAP", CASP-8 / m, CCL19, CCL21, CD1, CD1a, CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD44, CD45, CD46, CD52, CD54, CD55, CD59, CD64, CD66a-e, CD67, CD70, CD70L, CD74, CD79a, CD80, CD83, CD95, CD126, CD132, CD133, CD138, CD147, CD154, CDC27, CDK-4, CDKN2A, HIF-Iα, colon-specific antigen p (CSAp), CEA, CEACAM5, CEACAM6, oMet, DAM, EGFR, EGFRvIII, cMet, EGP-1 (Trop-2), EGP-2, ELF2-M, Ep-CAM, Her2, Her3, Claudin 18.2, ROR1, ROR2, dll3, marcl7, fibroblast growth factor (FGF), Flt-1, Flt-3, folate receptor, G250 antigen, GAGE, gp100, GRO-β, HLA-DR, HML24, HMGB-1, HSP70-2M., IGF-1R, IGR1R, MAGE, MAGE-3, MART-1, MART-2, NY-ESO-1, TRAG3, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC4, MUC5ac, MUC13, MUC16, MUM-1 / 2, MUM-3, NCA66, NCA95, NCA90, pancreatic mucin, PD-1 receptor, PD-L1 receptor, placental growth factor, PLAGL2, prostate acid phosphatase, PSA, PRAME, PSMA, P1GF, ILGF, ILGF-1R, RS5, RANTES, T101, SAGE, S100, survivin, survivin-2B, TAG, TAG-72, tenascin, TRAIL receptor, Tn antigen, ED-B, WT-1, 17-1A antigen.In a preferred embodiment, the antibody or antigen-binding fragment binds to one or more selected from Her2, Her3, B7H3, Claudin 18.2, DLL-3 or EGP-1 (Trop-2).

[0241] In some specific embodiments, the antibody or antigen-binding fragment is selected from epratuzumab, veltuzumab, sacituzumab, patritumab, trastuzumab, pertuzumab, abciximab, alemtuzumab, cetuximab, gemtuzumab, ibritumomab, panitumumab, rituximab, tositumomab, abagovomab, atlizumab, benralizumab, obinutuzumab, basiliximab, dadizumab, efalizumab, muromomab, natlizumab, omalizumab, gaiitenemmab, solanezumab, tisotumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, enfortumab, belantamab, cetuximab, loncastuximab, daratumumab, nimotuzumab, zolbetuximab, omburtamab, rovalpituzumab.

[0242] In some preferred embodiments, the antibody or antigen-binding fragment is selected from sacituzumab, daratumumab, zolbetuximab, omburtamab, patritumab, rovalpituzumab.

[0243] In some embodiments, the antibody or antigen-binding fragment is selected from the Sacituzumab antibody or its antigen-binding fragment, and the Sacituzumab antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementary determining regions HCDR1-3, which respectively comprise the amino acid sequences set forth in SEQ ID NO: 1-3; wherein the light chain variable region comprises three complementary determining regions LCDR1-3, which respectively comprise the amino acid sequences set forth in SEQ ID NO: 4-6.

[0244] In some specific embodiments, the amino acid sequences of HCDR1-3 of the antibody or antigen-binding fragment are shown as SEQ ID NO: 1-3 respectively. In some other specific embodiments, the amino acid sequences of LCDR1-3 of the antibody or antigen-binding fragment are shown as SEQ ID NO: 4-6 respectively.

[0245] In some more specific embodiments, the heavy chain variable region of the Sacituzumab antibody or its antigen-binding fragment comprises the amino acid sequence as set forth in SEQ ID NO: 7, and the light chain variable region comprises the amino acid sequence as set forth in SEQ ID NO: 8. For example, in some embodiments, the amino acid sequence of the heavy chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 7. In some other embodiments, the amino acid sequence of the light chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 8.

[0246] In some more specific embodiments, the heavy chain of the Sacituzumab antibody or its antigen-binding fragment comprises the amino acid sequence as set forth in SEQ ID NO: 9, and the light chain comprises the amino acid sequence as set forth in SEQ ID NO: 10. For example, in some embodiments, the amino acid sequence of the heavy chain of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 9. In some other embodiments, the amino acid sequence of the light chain of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 10.

[0247] In some embodiments, the antibody or antigen-binding fragment is selected from the Patritumab antibody or its antigen-binding fragment. The Patritumab antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region includes three complementary determining regions HCDR1-3, which respectively comprise the amino acid sequences as set forth in SEQ ID NO: 11-13; and the light chain variable region includes three complementary determining regions LCDR1-3, which respectively comprise the amino acid sequences as set forth in SEQ ID NO: 14-16.

[0248] In some specific embodiments, the amino acid sequences of HCDR1-3 of the antibody or antigen-binding fragment are shown as SEQ ID NO: 11-13 respectively. In some other specific embodiments, the amino acid sequences of LCDR1-3 of the antibody or antigen-binding fragment are shown as SEQ ID NO: 14-16 respectively.

[0249] In some more specific embodiments, the heavy chain variable region of the Patritumab antibody or its antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO: 17, and the light chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 18. For example, in some embodiments, the amino acid sequence of the heavy chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 17. In other embodiments, the amino acid sequence of the light chain variable region of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 18.

[0250] In some more specific embodiments, the heavy chain of the Patritumab antibody or its antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO: 19, and the light chain comprises the amino acid sequence set forth in SEQ ID NO: 20. For example, in some embodiments, the amino acid sequence of the heavy chain of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 19. In other embodiments, the amino acid sequence of the light chain of the antibody or antigen-binding fragment is as shown in SEQ ID NO: 20.

[0251] In some embodiments, the method for preparing the antibody-drug conjugate of the dual toxin described in the present disclosure includes: first, after subjecting the antibody to an azidation reaction, the toxin D 2 (or the [H 2 -L 2a- L 2b -L 2c -D 2 ) y structural unit) is glycosylated with the antibody; then the toxin D 1 (or the [H 1 -L 1a -L 1b -L 1c -D 1 ) x structural unit) is coupled to the antibody through a thiol group to prepare an antibody-drug conjugate containing the dual toxin, and its structural schematic diagram is as Figure 1 shown. Figure 1 In, toxin 1 is coupled to the antibody through a linking unit thiol group, and the four interchain disulfide bonds contained in the antibody are reduced to generate eight thiol groups. Therefore, 2-8 toxin 1 molecules can be loaded through the linking unit. Toxin 2 is coupled to the antibody through a linking unit glycosyl group, and 2-4 toxin 2 molecules can be loaded through the linking unit.

[0252] On the other hand, the present disclosure provides a pharmaceutical composition, which comprises the antibody-drug conjugate described in the present disclosure, and a pharmaceutically acceptable carrier, excipient or diluent.

[0253] On the other hand, the present disclosure provides the use of the antibody-drug conjugate described in the present disclosure in the preparation of a drug for treating and / or preventing tumors.

[0254] In some preferred embodiments, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70, and EGFR.

[0255] In some specific embodiments, the tumor includes a solid tumor or a hematological tumor.

[0256] In some more specific embodiments, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.

[0257] Examples

[0258] The present disclosure will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present disclosure and not to limit the scope of the present disclosure, and the following examples do not represent that the following experiments are all or the only experiments of the present disclosure.

[0259] The exemplary antibody used in the present disclosure is Sacituzumab (also known as sacituzumab govitecan / hRS7), which is described in detail in WO2014057687A. Specifically, the heavy chain variable region of the Sacituzumab antibody includes three complementary determining regions HCDR1-3, which respectively contain the amino acid sequences described in SEQ ID NO: 1-3; the light chain variable region includes three complementary determining regions LCDR1-3, which respectively contain the amino acid sequences described in SEQ ID NO: 4-6. More specifically, the heavy chain variable region of the Sacituzumab antibody contains the amino acid sequence described in SEQ ID NO: 7, and the light chain variable region contains the amino acid sequence described in SEQ ID NO: 8; more specifically, the heavy chain of the Sacituzumab antibody contains the amino acid sequence described in SEQ ID NO: 9, and the light chain contains the amino acid sequence described in SEQ ID NO: 10. The antibody can be constructed by conventional biological methods in the art or purchased commercially.

[0260] Another exemplary antibody used in the present disclosure is Patritumab (also known as pertuzumab), which is described in detail in WO2007077028A2. Specifically, the heavy chain variable region of the Patritumab antibody includes three complementarity determining regions HCDR1-3, which contain the amino acid sequences set forth in SEQ ID NO: 11-13, respectively; the light chain variable region includes three complementarity determining regions LCDR1-3, which contain the amino acid sequences set forth in SEQ ID NO: 14-16, respectively. More specifically, the heavy chain variable region of the Patritumab antibody contains the amino acid sequence set forth in SEQ ID NO: 17, and the light chain variable region contains the amino acid sequence set forth in SEQ ID NO: 18; more specifically, the heavy chain of the Patritumab antibody contains the amino acid sequence set forth in SEQ ID NO: 19, and the light chain contains the amino acid sequence set forth in SEQ ID NO: 20. The antibody can be constructed by conventional biological methods in the art or purchased commercially.

[0261] The reference drug (positive control drug) Dato-Dxd (datopotamab deruxtecan, DS-1062a) is an antibody-drug conjugate targeting the Trop-2 antibody (datopotamab) and topoisomerase inhibitor (Dxd) developed based on the Dxd-ADC platform of Daiichi Sankyo Co., Ltd. Its structure and preparation method are described in detail in WO2014057687A and can be prepared by the method of this patent or purchased commercially.

[0262] The reference drug (positive control drug) Trodelvy is an antibody-drug conjugate targeting the trop-2 antibody (Sacituzumab) and SN38 developed by Gilead, and the control drug analogue can be obtained by commercial purchase.

[0263] Other raw materials of the present disclosure are commercially available or prepared by methods known in the art. For example, the toxin used in the present disclosure is triptolide, which is purchased from the National Institutes for Food and Drug Control, CAT#111567-201404, ID: DP03-BYVB, M.wt: 360.4. Exatecan of the present disclosure is commercially available, CAS number: 171335-80-1. Exatecan mesylate is commercially available, CAS number: 169869-90-3.

[0264] Compound 7 (147270-MC-VA-PAB-Exatecan) is commercially available, and its CAS number is: 2680543-57-9. The structure is as follows:

[0265]

[0266] Compound 8 (HY-13631E) was commercially available, with a CAS number of: 1599440-13-7, and its structure was as follows:

[0267]

[0268] Example 1 Preparation of Compound 1 (DBCO-PEG6-VA-PAB-Exatecan)

[0269]

[0270] Dissolve Compound 1-a (150 mg, 0.37 mmol) and Compound 1-b (132 mg, 0.37 mmol) in 1.5 mL of DMF, then slowly add TEA (75 mg, 0.74 mmol). After addition, react at room temperature for 2 h. Post-treatment: Purify the reaction solution directly by a reverse-phase column, H 2 O:ACN = 60%:40%. After lyophilization, 300 mg of a yellow oil (Compound 1-c) was obtained, with a yield of 94%.

[0271] Dissolve Compound 1-c (135 mg, 0.21 mmol) and HATU (96 mg, 0.25 mmol) in 4 mL of DMF, then add DIEA (40 mg, 0.31 mol). Stir at room temperature for 15 minutes, then add Compound 1-d (162 mg, 0.21 mmol) and stir at room temperature for 1 h. Post-treatment: Send the reaction solution directly for preparative reverse-phase HPLC, and after lyophilization, 130 mg of an almost white solid was obtained, with a yield of 43%.

[0272]

[0273]

[0274] NMR: 11H NMR (400 MHz, DMSO) δ 9.92 (s, 1H), 8.17 (d, J = 6.7 Hz, 1H), 8.06 (d, J = 7.9 Hz, 1H), 7.87 (d, J = 8.6 Hz, 1H), 7.79 - 7.72 (m, 2H), 7.67 (d, J = 6.7 Hz, 1H), 7.60 (d, J = 8.5 Hz, 3H), 7.47 (dd, J = 15.6, 7.0 Hz, 3H), 7.36 (d, J = 7.8 Hz, 3H), 7.33 - 7.26 (m, 3H), 6.51 (s, 1H), 5.44 (s, 2H), 5.28 (s, 3H), 5.09 - 4.99 (m, 3H), 4.38 (t, J = 7.1 Hz, 1H), 4.23 - 4.17 (m, 1H), 3.61 - 3.55 (m, 3H), 3.49 - 3.43 (m, 22H), 3.28 (d, J = 5.8 Hz, 2H), 3.10 - 3.04 (m, 2H), 2.61 - 2.54 (m, 1H), 2.44 (d, J = 6.7 Hz, 1H), 2.37 (s, 3H), 2.27 - 1.70 (m, 9H), 1.30 (d, J = 7.1 Hz, 3H), 0.88 (t, J = 6.2 Hz, 6H), 0.83 (d, J = 6.7 Hz, 3H).

[0275] Example 2 Preparation of Compound 2 (MC-PEG2-GGFG-Triptolide)

[0276]

[0277] Dissolve Compound 2-a (10 g, 38.9 mmol) and HOSU (5.37 g, 46.7 mmol) in 100 mL of DCM, add EDCI (11.2 g, 58.5 mmol), and stir at room temperature for 1 h. Monitor the reaction by LCMS until no starting materials remain. Concentrate the reaction solution, mix the sample, and perform column chromatography (DCM:EA = 10:1) to obtain the product. Concentrate to obtain 12 g of a pale yellow oil (Compound 2-b), yield: 87%.

[0278]

[0279] Compound 2-b (8 g, 22.6 mmol) and compound 2-c (9.56 g, 22.6 mmol) were placed in a three-necked flask, dissolved in 90 mL (water:acetonitrile = 2:1), protected by nitrogen, and DIEA (2.33 g, 18 mmol) was added at 0-10 °C. After addition, the mixture was warmed to room temperature and reacted for 16 h. The reaction was monitored by LCMS until completion. The reaction solution was extracted once with EA, the aqueous phase was adjusted to pH 2 with 0.5 mol / L HCl, and then extracted four times with (DCM:IPA = 4:1). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated, and triturated with EA to obtain 10.5 g of a white solid, yield: 70%.

[0280]

[0281] Compound 2-d (1.62 g, 2.44 mmol) and triptolide (800 mg, 2.22 mmol) were placed in a three-necked flask, dissolved in 20 mL of Py (pyridine), protected by nitrogen, and POCl 3 (3.4 g, 22.2 mmol) was added at -10-5 °C, and the reaction was maintained at this temperature for 5 min. The reaction was monitored by LCMS until completion. The reaction solution was dropped into 400 mL of ice-cold 1 mol / L HCl, extracted three times with 200 mL of (DCM:IPA = 4:1), the organic phases were combined, dried over anhydrous sodium sulfate, concentrated, and sent for preparation. The preparation solution was lyophilized to obtain 1.1 g of a yellow solid, yield: 44%.

[0282] NMR: 11H NMR (400 MHz, DMSO) δ 8.61 (t, J = 6.7 Hz, 1H), 8.30 (t, J = 5.7 Hz, 1H), 8.18 - 8.05 (m, 2H), 7.99 (t, J = 5.7 Hz, 1H), 7.29 - 7.22 (m, 4H), 7.22 - 7.15 (m, 1H), 7.01 (s, 2H), 5.03 (s, 1H), 4.90 - 4.73 (m, 2H), 4.70 - 4.58 (m, 2H), 4.54 - 4.45 (m, 1H), 4.17 (s, 2H), 3.95 (d, J = 3.0 Hz, 1H), 3.80 - 3.66 (m, 6H), 3.63 - 3.48 (m, 8H), 3.47 - 3.43 (m, 2H), 3.43 - 3.39 (m, 2H), 3.06 (dd, J = 13.8, 4.4 Hz, 1H), 2.80 (dd, J = 13.9, 9.9 Hz, 1H), 2.68 - 2.58 (m, 1H), 2.36 (t, J = 6.5 Hz, 2H), 2.28 - 2.18 (m, 1H), 2.16 - 2.06 (m, 1H), 2.00 - 1.90 (m, 1H), 1.90 - 1.75 (m, 2H), 1.34 - 1.23 (m, 2H), 0.92 - 0.84 (m, 6H), 0.74 (d, J = 6.8 Hz, 3H).

[0283] Example 3 Preparation of Compound 3 (DBCO-PEG4-GGFG-Triptolide)

[0284]

[0285] Dissolve Compound 3-a (2 g, 3.62 mmol), NHS (624 mg, 5.42 mmol), and 2,6-dimethylpyridine in 80 mL of dimethylacetamide, then add EDCI (1.04 g, 5.43 mmol) at room temperature. After addition, react overnight at room temperature. Post-treatment: Pour the reaction solution into water, extract with EA, wash the organic phase with saturated brine, dry with anhydrous sodium sulfate, and rotary evaporate to obtain 2.4 g of a yellow oil (Compound 3-b).

[0286]

[0287] Dissolve Compound 3-b (2.0 g, 3.07 mmol) and Compound 3-d (1.3 g, 3.07 mmol) in 10 mL of DMF, then add TEA (620 mg, 6.14 mol). Stir at room temperature for 1 h. Post-treatment: Purify the reaction solution directly by reverse-phase column, H 2O: CAN = 60%: 40%. It was freeze-dried to obtain 1.2 g of a slightly yellowish and moisture-absorbing solid (Compound 3-d), and the two-step yield was 50%.

[0288]

[0289] Dissolve Compound 3-d (1.2 g, 1.23 mmol) and triptolide (446 mg, 1.23 mmol) in 18 mL of pyridine. Under nitrogen protection, cool the mixture to -30 °C and slowly add POCl 3 (569 mg, 3.71 mmol). After the addition, maintain the temperature at -10 to -30 °C and react for 0.5 h. Work-up: Cool the reaction mixture to -30 °C and quickly load it onto a reverse-phase column for purification. H 2 O: ACN = 50%: 50%. After freeze-drying, 1.5 g of a white solid was obtained and needed to be sent for reverse-phase preparation. Finally, 1.1 g of a white solid was obtained, and the yield was 68%.

[0290] NMR: 11H NMR (400 MHz, DMSO) δ 8.61 (t, J = 6.8 Hz, 1H), 8.30 (t, J = 5.8 Hz, 1H), 8.18 - 8.08 (m, 2H), 7.99 (t, J = 5.7 Hz, 1H), 7.75 (t, J = 5.5 Hz, 1H), 7.70 - 7.65 (m, 1H), 7.62 (d, J = 7.0 Hz, 1H), 7.52 - 7.42 (m, 3H), 7.40 - 7.28 (m, 3H), 7.27 - 7.22 (m, 4H), 7.18 (td, J = 5.9, 2.5 Hz, 1H), 5.03 (t, J = 7.0 Hz, 2H), 4.89 - 4.72 (m, 2H), 4.69 - 4.58 (m, 2H), 4.50 (td, J = 9.1, 4.3 Hz, 1H), 4.17 (s, 2H), 3.95 (d, J = 3.1 Hz, 1H), 3.76 (dt, J = 17.3, 5.7 Hz, 3H), 3.71 - 3.67 (m, 3H), 3.60 (dd, J = 12.7, 6.2 Hz, 5H), 3.48 - 3.43 (m, 12H), 3.30 (s, 2H), 3.13 - 3.02 (m, 3H), 2.80 (dd, J = 13.8, 9.7 Hz, 1H), 2.58 (dd, J = 16.1, 7.9 Hz, 2H), 2.38 (t, J = 6.5 Hz, 2H), 2.23 (ddd, J = 15.4, 10.2, 5.5 Hz, 2H), 2.16 - 2.06 (m, 1H), 2.03 - 1.92 (m, 2H), 1.89 - 1.72 (m, 3H), 1.29 (d, J = 5.2 Hz, 2H), 0.91 - 0.85 (m, 6H), 0.74 (d, J = 6.8 Hz, 3H).

[0291] Example 4 Preparation of Compound 4 (MC - GGFG - Triptolide)

[0292]

[0293] Add triptolide (36 mg, 0.1 mmol) and compound 4 - a (62 mg, 0.1 mmol) to dry pyridine (1.5 mL), stir at - 10 °C under nitrogen protection, then add POCl 3 (46 mg, 0.3 mmol), and then stir the mixture at - 10 °C under N 2 atmosphere for 0.5 h. After purification of the mixture by HPLC, a white solid (20 mg, yield 21%) is obtained.

[0294]

[0295] Nuclear magnetic resonance:[[]]END]]1 1H NMR (400 MHz, DMSO) δ 8.62 (d, J = 6.8 Hz, 1H), 8.32 (t, J = 5.7 Hz, 1H), 8.18 - 8.05 (m, 2H), 8.01 (t, J = 5.6 Hz, 1H), 7.35 - 7.15 (m, 5H), 7.02 (s, 2H), 5.06 (s, 1H), 4.92 - 4.77 (m, 2H), 4.72 - 4.58 (m, 2H), 4.52 (td, J = 9.2, 4.6 Hz, 1H), 4.19 (s, 2H), 3.97 (d, J = 3.2 Hz, 1H), 3.83 - 3.53 (m, 8H), 3.40 (d, J = 7.0 Hz, 2H), 3.08 (dd, J = 13.8, 4.5 Hz, 1H), 2.82 (dd, J = 13.7, 9.8 Hz, 1H), 2.62 (s, 1H), 2.31 - 2.20 (m, 1H), 2.18 - 2.06 (m, 3H), 1.88 (ddd, J = 33.7, 27.6, 17.1 Hz, 3H), 1.50 (dq, J = 14.6, 7.3 Hz, 4H), 1.39 - 1.28 (m, 2H), 1.21 (dt, J = 15.1, 7.6 Hz, 2H), 0.94 - 0.85 (m, 6H), 0.77 (t, J = 5.9 Hz, 3H).

[0296] Example 5 Preparation of Compound 5 (DBCO-PEG4-VA-PAB-Exatecan)

[0297]

[0298] Dissolve Compound 5-a (1.8 g, 2.64 mmol) and irinotecan mesylate (1.54 g, 2.91 mmol) in 18 mL of DMSO, then slowly add DIEA (1 g, 7.92 mmol). After addition, react at room temperature for 4 h. Monitor the reaction until the raw materials are consumed, then add TEA (1.8 mL) and stir at room temperature for 3 h. Post-treatment: Purify the reaction solution directly by reverse-phase column, H 2 O:ACN = 65%:35%. After lyophilization, 1.98 g of yellow-green powder (Compound 5-c) is obtained, yield: 99%.

[0299]

[0300] Dissolve compound 5-c (409 mg, 0.21 mmol) and HATU (247 mg, 0.43 mmol) in 3 mL of DMF, then add DIEA (105 mg, 0.54 mmol), stir at room temperature for 15 minutes, add compound 5-d (300 mg, 0.36 mmol), and stir at room temperature for 2 h. Post-treatment: Directly send the reaction solution to preparative reverse-phase HPLC, and lyophilize to obtain 120 mg of a nearly white solid, yield: 17%.

[0301] NMR: 1 H NMR (400 MHz, DMSO) δ 9.93 (s, 1H), 8.17 (d, J = 6.9 Hz, 1H), 8.06 (d, J = 8.4 Hz, 1H), 7.87 (d, J = 8.6 Hz, 1H), 7.76 (t, J = 9.9 Hz, 2H), 7.66 (d, J = 6.3 Hz, 1H), 7.60 (d, J = 8.4 Hz, 3H), 7.50 - 7.43 (m, 3H), 7.36 (d, J = 8.7 Hz, 3H), 7.33 - 7.26 (m, 3H), 6.51 (s, 1H), 5.44 (s, 2H), 5.28 (d, J = 4.3 Hz, 3H), 5.10 - 4.98 (m, 3H), 4.38 (t, J = 7.1 Hz, 1H), 4.24 - 4.17 (m, 1H), 3.61 - 3.55 (m, 3H), 3.52 - 3.39 (m, 14H), 3.28 (d, J = 5.9 Hz, 2H), 3.08 (dd, J = 10.0, 5.3 Hz, 2H), 2.58 (dd, J = 16.1, 7.9 Hz, 1H), 2.44 (t, J = 6.7 Hz, 1H), 2.37 (s, 3H), 2.27 - 1.71 (m, 9H), 1.30 (d, J = 7.1 Hz, 3H), 0.88 (t, J = 6.2 Hz, 6H), 0.83 (d, J = 6.8 Hz, 3H).

[0302] Example 6 Preparation of Compound 6 (MC-PEG2-VA-PAB-Exatecan)

[0303]

[0304]

[0305] At room temperature, compound 6-a (480 mg, 0.64 mmol) was added to a 100 mL three-necked flask. After dissolving in DMF (20 mL), compound 6-b (237.2 mg, 0.67 mmol) was added. The reaction was cooled to 0 °C, and DIEA (237.2 mg, 1.28 mmol) was slowly added dropwise. The reaction was stirred at 0 °C for 2 h, and LC-MS showed that the reaction was complete. After adding acetic acid (0.5 mL) to the reaction solution, it was first separated by reverse phase (TFA / MeCN) and freeze-dried. Then it was separated by preparative separation and freeze-dried to obtain 127 mg of a yellow solid (compound 6), with a yield of 20%.

[0306] NMR: 1 H NMR (400 MHz, DMSO) δ 9.95 (s, 1H), 8.19 (d, J = 6.8 Hz, 1H), 8.08 (d, J = 8.8 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.79 (d, J = 10.8 Hz, 1H), 7.62 (d, J = 8.4 Hz, 2H), 7.39 (d, J = 8.4 Hz, 2H), 7.33 (s, 1H), 7.04 (s, 2H), 5.47 (s, 2H), 5.30 (d, J = 4.4 Hz, 3H), 5.10 (s, 2H), 4.44 - 4.36 (m, 1H), 4.25 - 4.19 (m, 1H), 3.58 (dd, J = 11.2, 5.6 Hz, 5H), 3.52 (d, J = 5.2 Hz, 3H), 3.36 - 3.07 (m, 3H), 2.49 - 2.36 (m, 5H), 2.20 (d, J = 13.2 Hz, 2H), 2.04 - 1.85 (m, 3H), 1.32 (d, J = 7.2 Hz, 3H), 0.92 - 0.84 (m, 9H).

[0307] Preparation of triptolide (compound 2) / irinotecan (compound 1) dual-toxin ADC (ADC-1) in Example 7

[0308] Samples were added to the following reaction system to make the final concentration of the antibody (Sacituzumab) 10 mg / ml, MnCl 2 The final concentration was 10 mmol / L, the final concentration of pH 7.5 Tris-HCl was 10 mmol / L, the final concentration of UDP-GalNAz was 5 mmol / L, and GalT1 was added in a ratio of 5 mg GalT1 / 1 g mAb - 50 mg GalT1 / 1 g mAb. The azidation reaction of the antibody was completed by shaking in a constant temperature shaker at 30 °C for ≥12 h. UDP-GalNAz, GalT1, and Mn introduced by the azidation reaction were removed by chromatography 2+Substances such as the following. Add Compound 1 to the following reaction system to make the final concentration of the azide-modified antibody 10 mg / ml, the final concentration of DMSO 10%, and the molar ratio of Compound 1 to the antibody 5 - 15. Shake on a constant temperature shaker at 30 °C for ≥12 h to complete the sugar conjugation of the antibody and the toxin. Add TCEP directly to the above reaction solution to reduce the antibody. The molar ratio of TCEP to the antibody is 5. Shake on a constant temperature shaker at 30 °C for 2 h to reduce the antibody. Add Compound 2 to complete the thiol conjugation. The molar ratio of Compound 2 to the antibody is 5. Stir at 2 - 8 °C for 2 h to complete the thiol conjugation. Remove substances such as TCEP, DMSO, Compound 1, and Compound 2 introduced during the process by concentration and buffer exchange. Replace the sample into a 4.29 g / L MES buffer at pH 6.5, and supplement trehalose and polysorbate 80 (II) to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. Take 100 μg of the sample, add 2 μl of 1 mol / L DTT, and supplement ultrapure water to a final volume of 100 μl. Reduce at room temperature for 30 min, and then directly detect by LC-MS. Calculate the average DAR value of the sample after normalization of the mass spectrometry signal intensity. The DAR value of triptolide is 3.7, and that of irinotecan is 3.6.

[0309] Example 8 Preparation of the dual-toxin ADC (ADC-2) of irinotecan (Compound 7) / triptolide (Compound 3)

[0310] Add the sample to the following reaction system to make the final concentration of the antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl 2 The final concentration is 10 mmol / L, the final concentration of Tris-HCl at pH 7.5 is 10 mmol / L, the final concentration of UDP-GalNAz is 5 mmol / L, and GalT1 is added in a ratio of 5 mg GalT1 / 1 g mAb - 50 mg GalT1 / 1 g mAb. Shake on a constant temperature shaker at 30 °C for ≥12 h to complete the azidation reaction of the antibody. Remove UDP-GalNAz, GalT1, and Mn introduced during the azidation reaction by chromatography 2+Substances such as. Add compound 3 to the following reaction system to make the final concentration of the azide antibody 10 mg / ml, the final concentration of DMSO 10%, and the molar ratio of compound 3 to the antibody 5 - 15. Shake on a constant temperature shaker at 30°C for ≥12 h to complete the sugar conjugation of the antibody and the toxin. Add TCEP directly to the above reaction solution to reduce the antibody. The molar ratio of TCEP to the antibody is 4.5. Shake on a constant temperature shaker at 30°C for 2 h to reduce the antibody. Add compound 7 to complete the thiol conjugation. The molar ratio of compound 7 to the antibody is 5. Stir at 2 - 8°C for 2 h to complete the thiol conjugation. Remove substances such as TCEP, DMSO, compound 3, and compound 7 introduced during the process by concentration and buffer exchange. Replace the sample into a 4.29 g / L MES buffer at pH 6.5, adjust the protein concentration to 20 mg / ml, and supplement trehalose and polysorbate 80 (II) to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. Take 100 μg of the sample, add 2 μl of 1 mol / L DTT, and supplement ultrapure water to a final volume of 100 μl. Reduce at room temperature for 30 min, and then directly detect by LC-MS. Calculate the average DAR value of the sample after normalization of the mass spectrometry signal intensity, which is 4.2 for irinotecan and 3.7 for triptolide.

[0311] Preparation of Triptolide (Compound 4) / Irinotecan (Compound 1) Dual-Toxin ADC (ADC-3) in Example 9

[0312] Add the sample to the following reaction system to make the final concentration of the antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl 2 The final concentration is 10 mmol / L, the final concentration of pH 7.5 Tris-HCl is 10 mmol / L, the final concentration of UDP-GalNAz is 5 mmol / L, and GalT1 is added in a ratio of 5 mg GalT1 / 1 g mAb - 50 mg GalT1 / 1 g mAb. Shake on a constant temperature shaker at 30°C for ≥12 h to complete the azidation reaction of the antibody. Remove UDP-GalNAz, GalT1, and Mn introduced during the azidation reaction by chromatography 2+Substances such as the following. Add compound 1 to the following reaction system to make the final concentration of the azide-modified antibody 10 mg / ml, the final concentration of DMSO 10%, and the molar ratio of compound 1 to the antibody 5 - 15. Shake on a constant temperature shaker at 30 °C for ≥ 12 h to complete the sugar conjugation of the antibody and the toxin. Add TCEP directly to the above reaction solution to reduce the antibody. The molar ratio of TCEP to the antibody is 5. Shake on a constant temperature shaker at 30 °C for 2 h to reduce the antibody. Compound 4 completes the thiol conjugation. The molar ratio of compound 4 to the antibody is 5. Stir at 2 - 8 °C for 2 h to complete the thiol conjugation. Remove substances such as TCEP, DMSO, compound 1, and compound 4 introduced during the process by concentration and buffer exchange. Replace the sample into a 4.29 g / L MES buffer solution with pH 6.5, and supplement trehalose and polysorbate 80 (II) to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. Take 100 μg of the sample, add 2 μl of 1 mol / L DTT, and supplement ultrapure water to a final volume of 100 μl. Reduce at room temperature for 30 min, and then directly detect by LC-MS. Calculate the average DAR value of the sample after normalization according to the mass spectrometry signal intensity. The DAR value of triptolide is 4.5, and that of irinotecan is 3.8.

[0313] Preparation of irinotecan (compound 6) / triptolide (compound 3) dual-toxin ADC (ADC-4) in Example 10

[0314] Add the sample to the following reaction system to make the final concentration of the antibody (Sacituzumab) 10 mg / ml, the final concentration of MnCl 2 10 mmol / L, the final concentration of pH 7.5 Tris-HCl 10 mmol / L, the final concentration of UDP-GalNAz 5 mmol / L. Add GalT1 in the ratio of 5 mg GalT1 / 1 g mAb - 50 mg GalT1 / 1 g mAb. Shake on a constant temperature shaker at 30 °C for ≥ 12 h to complete the azidation reaction of the antibody. Remove UDP-GalNAz, GalT1, and Mn introduced during the azidation reaction by chromatography 2+Substances such as. Add compound 3 to the following reaction system to make the final concentration of the azide antibody 10 mg / ml, the final concentration of DMSO 10%, and the molar ratio of compound 3 to the antibody 5 - 15. Shake on a constant temperature shaker at 30 °C for ≥12 h to complete the sugar conjugation of the antibody and the toxin. Add TCEP directly to the above reaction solution to reduce the antibody. The molar ratio of TCEP to the antibody is 4.5. Shake on a constant temperature shaker at 30 °C for 2 h to reduce the antibody. Add compound 6 to complete the thiol conjugation. The molar ratio of compound 6 to the antibody is 5. Stir at 2 - 8 °C for 2 h to complete the thiol conjugation. Remove substances such as TCEP, DMSO, compound 3, and compound 6 introduced during the process by concentration and buffer exchange. Replace the sample into a 4.29 g / L MES buffer solution with a pH of 6.5, adjust the protein concentration to 20 mg / ml, and supplement trehalose and polysorbate 80 (II) to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. Take 100 μg of the sample, add 2 μl of 1 mol / L DTT, and supplement ultrapure water to a final volume of 100 μl. Reduce at room temperature for 30 min, and then directly detect by LC-MS. Calculate the average DAR value of the sample after normalization of the mass spectrometry signal intensity. It is 3.7 for irinotecan and 3.6 for triptolide.

[0315] Preparation of Irinotecan (Compound 1) ADC (ADC-5) in Example 11

[0316] Add the sample to the following reaction system to make the final concentration of the antibody (Sacituzumab) 10 mg / ml, MnCl 2 The final concentration is 10 mmol / L, the final concentration of pH 7.5 Tris-HCl is 10 mmol / L, the final concentration of UDP-GalNAz is 5 mmol / L, and GalT1 is added at a ratio of 5 mg GalT1 / 1 g mAb - 50 mg GalT1 / 1 g mAb. Shake on a constant temperature shaker at 30 °C for ≥12 h to complete the azidation reaction of the antibody. Remove UDP-GalNAz, GalT1, Mn 2+Substances such as... Add compound 1 to the following reaction system to make the final concentration of the azide antibody 10 mg / ml, the final concentration of DMSO 10%, and the molar ratio of compound 1 to the antibody 5 - 15. Shake in a constant temperature shaker at 30°C for ≥12 h to complete the sugar conjugation of the antibody and the toxin. Remove substances such as DMSO and compound 1 introduced during the process by concentration and buffer exchange, replace the sample into a 4.29 g / L MES buffer at pH 6.5, adjust the protein concentration to 20 mg / ml, and supplement trehalose and polysorbate 80 (II) to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. Take 100 μg of the sample, supplement ultrapure water to a final volume of 100 μl, and then directly detect by LC-MS. Calculate the average DAR value of the sample after normalization of the mass spectrometry signal intensity, and the value for irinotecan is 3.7.

[0317] Example 12

[0318] HSP70 is upregulated in many tumors, which can cause tumor deterioration and chemotherapy resistance. The relative expression level of HSP70 was used to study the inhibitory function of triptolide on the mRNA transcription level.

[0319] Experimental method: After HCT-15 (human colorectal cancer) cells grew to 90% confluence in a T75 flask, they were digested with trypsin and passaged into 6-well plates. After overnight culture at 37°C, Dxd (100 nM), Exatecan (100 nM), Triptolide (100 nM), Triptolide + Dxd (100 nM + 100 nM), Triptolide + Exatecan (100 nM + 100 nM) were added respectively, and the non-drug group was CTRL. After 24 h, the culture medium was discarded, 500 μl / well of Trizol was added to extract RNA, and after reverse transcription, 18S was used as an internal reference for real-time quantitative PCR to detect the expression of HSP70 and ABAC1. The primer sequences are as follows: ABAC1 F: ATGGCTACATGAGAGCGGAG (SEQ ID NO: 21); ABAC1 R: CGTTGCACCTCTCTGG TCC (SEQ ID NO: 22); HSP70 F: ACCAAGCAGACGCAGATCTTC (SEQID NO: 23); HSP70 R: CGCCCTCGTA CACCTGGAT (SEQ ID NO: 24); 18S F: CTCGCTCCTCTCCCACTTG (SEQ ID NO: 25); 18SR: TGACCGGGTTGG TTTTGATC (SEQ ID NO: 26).

[0320] The results are as Figure 2A 、 2BAs shown Figure 2A In Figure 2A , the ordinate is HSP70. When HCT-15 cells were stimulated with 100 nM Dxd or Exatecan, the expression of HSP70 was significantly up-regulated. However, when treated with the same molar concentration of Triptolide, the HSP70 mRNA was significantly reduced, indicating that Triptolide can inhibit mRNA synthesis.

[0321] Figure 2B In

[0321] , the ordinate is the expression level of the efflux valve gene ABAC1. It can be seen from the figure that Triptolide significantly reduced the expression of the efflux valve gene ABAC1 in HCT-15 cells, leading to enhanced sensitivity of the cells to Dxd or Exatecan.

[0322] When Triptolide and Exatecan were used in combination, the expressions of HSP70 and ABAC1 were significantly up-regulated, demonstrating the synergy of the combination of Triptolide and Exatecan in protecting against apoptosis and drug resistance.

[0323] Pharmacodynamic experiment in human colorectal cancer model (COLO205 cells) of Example 13

[0324] Experimental animals

[0325] NCG mice were purchased from Chengdu Medicilon Inc.

[0326] Animal modeling

[0327] COLO205 cells were resuspended in 1640 medium or DMEM medium (total volume 0.1 mL / mouse). Before inoculation, the hair on the right front side of the back of the experimental NCG mice was removed, and then 6×10 6 -1×10 7 cells were subcutaneously inoculated.

[0328] Drug administration plan

[0329] Seven days after tumor inoculation, the test samples were intravenously injected into the mice (negative control: PBS solution; test drugs: ADC-1, ADC-2; positive control: Dato-Dxd, Trodelvy), with 6 animals in each group and the administration dose of 5 mg / kg. After starting the drug administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm3) = 1 / 2×(L×W2) (where L represents the long diameter and W represents the short diameter). The results of tumor volume changes are as Figure 3A shown. After the experiment, the mice were sacrificed and the tumors were dissected and weighed, and the results are as Figure 3B (* indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, **** indicates P<0.0001).

[0330] Antitumor effect in the human pancreatic cancer model (Bxpc-3 cells) of Example 14

[0331] Experimental animals

[0332] NCG mice were purchased from Chengdu Biocare Biotechnology Co., Ltd.

[0333] Animal modeling

[0334] Bxpc-3 cells were resuspended in RPMI 1640 medium or DMEM medium (total volume 0.1 mL / mouse). For the experimental NCG mice, the hair on the right front side of the back was removed before inoculation, and then 6×10 6 -1×10 7 cells were subcutaneously inoculated.

[0335] Drug administration regimen

[0336] On the 17th day after tumor inoculation, the test samples were intravenously injected into the mice (negative control: PBS solution; test drug: ADC-3; positive control: Dato-Dxd), with 6 animals in each group and the administration dose being 5 mg / kg. On the 28th day after inoculation, that is, on the 11th day after the first administration, a second administration was carried out with a dose of 10 mg / kg. After the start of drug administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 ) = 1 / 2×(L×W 2 ) (where L represents the long diameter and W represents the short diameter). The results of tumor volume changes are as Figure 4 shown.

[0337] Antitumor effect in the human colorectal cancer drug-resistant model (HCT-15-TROP2 cells) of Example 15

[0338] Experimental animals

[0339] NCG mice were purchased from Chengdu Biocare Biotechnology Co., Ltd.

[0340] Animal modeling

[0341] HCT-15-TROP2 cells were resuspended in RPMI 1640 medium or DMEM medium (total volume 0.1 mL / mouse). For the experimental NCG mice, the hair on the right front side of the back was removed before inoculation, and then 6×10 6 -1×10 7 cells were subcutaneously inoculated.

[0342] Drug administration regimen

[0343] Ten days after tumor inoculation, the test samples were administered to mice by intravenous injection (negative control: PBS solution; test drug: ADC-2; positive control: Dato-Dxd), with 6 animals in each group and the administration dose being 5 mg / kg. After the start of drug administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 ) = 1 / 2 × (L × W 2 ) (where L represents the long diameter and W represents the short diameter). The results of tumor volume changes are as shown in Figure 5 .

[0344] Example 16

[0345] This example was used to investigate whether the combination of Triptolide and Exatecan alone or in a 1:1 ratio of the two drugs has a significant killing effect on tumor cells.

[0346] Cell preparation

[0347] MX-1 cells (human breast cancer cells), WiDr cells (human colorectal cancer cells), MFE-280 cells (human endometrial cancer cells), HeLa cells (human cervical cancer cells), HuH-7 cells (human liver cancer cells), NUGC-4 cells (human gastric cancer cells), and Calu-6 cells (human degenerative cancer cells) in the logarithmic growth phase were digested with 0.25% Trypsin-EDTA, resuspended in 1640 medium containing 10% FBS, counted by trypan blue staining, and the cell density was adjusted to 1 × 10 6 cells / ml, inoculated into a 96-well cell culture plate, 100 μl per well, and incubated in a 37°C, 5% CO 2 incubator for 4 h to adhere to the wall.

[0348] Drug preparation:

[0349] Drug group 1: Dilution of the small molecule toxin Dxd: Dxd was diluted with 1640 medium containing 10% FBS starting from an initial concentration of 100 nM, with 4 two-fold serial dilutions, resulting in a total of 5 concentration gradients, with 6 being the blank, and the concentrations were: 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM.

[0350] Drug group 2: Dilution of the small molecule toxin Exatecan (abbreviated as EXA): Exatecan was diluted with 1640 medium containing 10% FBS starting from an initial concentration of 100 nM, with 4 two-fold serial dilutions, resulting in a total of 5 concentration gradients, with 6 being the blank, and the concentrations were: 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM.

[0351] Drug group 3: Dilution of small molecule toxin Triptolide (abbreviated as TRP): Use 1640 medium containing 10% FBS to dilute Triptolide with an initial concentration of 100 nM in a 2-fold serial dilution for 4 gradients, resulting in a total of 5 concentration gradients. 6 is the blank, and the concentrations are: 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM.

[0352] Drug group 4: Dilution of small molecule toxin Dxd + Triptolide (abbreviated as DXD+TRP): Use 1640 medium containing 10% FBS to dilute the equimolar mixed solution of 100 nM Dxd + 100 nM Triptolide (i.e., 2 ml of 100 nM Dxd + 2 ml of 100 nM Triptolide mixed solution) with an initial concentration of 50 nM in a 2-fold serial dilution for 4 gradients, resulting in a total of 5 concentration gradients. 6 is the blank, and the concentrations are: 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM.

[0353] Drug group 5: Dilution of small molecule toxin Exatecan + Triptolide (abbreviated as EXA+TRP): Use 1640 medium containing 10% FBS to dilute the equimolar mixed solution of 100 nM Exatecan + 100 nM Triptolide (i.e., 2 ml of 100 nM Exatecan + 2 ml of 100 nM Triptolide mixed solution) with an initial concentration of 50 nM in a 2-fold serial dilution for 4 gradients, resulting in a total of 5 concentration gradients. 6 is the blank, and the concentrations are: 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM.

[0354] Sample addition:

[0355] Transfer 100 μl of the diluted samples of Dxd, Exatecan, Triptolide, Dxd + Triptolide, and Exatecan + Triptolide at different concentration gradients into the culture plates seeded with MX-1, WiDr, MFE-280, HeLa, HuH-7, NUGC-4, and Calu-6 cells, with 2 replicates per group, for a total of 5 groups of samples, namely: the single Dxd group, the single Exatecan group, the single Triptolide group, the Dxd + Triptolide group, and the Exatecan + Triptolide group. Among them, the final concentrations of the single Dxd group are 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.125 nM; the final concentrations of the single Exatecan group are 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.125 nM; the final concentrations of the single Triptolide group are 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.125 nM; the final concentrations of the Dxd + Triptolide group and the Exatecan + Triptolide group are 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, and 1.562 nM.

[0356] Data collection

[0357] After adding the samples, place the cell plates in the Incucyte for continuous photographing, once every 2 h, collect data by continuous photographing, and analyze the cell confluence to reflect the killing ability of the drug on the cells.

[0358] Experimental results

[0359] The confluence (or fusion degree) of MX-1 cells, WIDR cells, HeLa cells, and MFE-280 cells are respectively as Figures 6A - 6D shown. The survival rates of HuH-7 cells, NUGC-4 cells, and Calu-6 cells are as Figures 7A - 7C shown. It can be seen from the results that the combined use groups of Dxd or Exatecan with Triptolide can achieve more significant cell killing compared to the single-drug groups of Dxd, Exatecan, or Triptolide.

[0360] Example 17 Antitumor effect in a human colorectal cancer drug-resistant model (HCT-15-TROP2 cells)

[0361] Experimental animals

[0362] NCG mice were purchased from Chengdu Medicilon Biotechnology Co., Ltd.

[0363] Animal modeling

[0364] HCT-15-Trop2 cells were resuspended in RPMI 1640 medium or DMEM medium (total volume 0.1 mL / mouse), and the NCG mice used in the experiment had the hair on the right front side of the back removed before inoculation, and then 1×10 7 cells were subcutaneously inoculated.

[0365] Drug administration plan

[0366] The test samples (negative control: PBS solution; test drugs: ADC-2, ADC-4, ADC-5; positive control: Dato-Dxd) were injected into the tail vein of the animals (7 animals per group) once every two weeks. The day of drug administration was recorded as D0, and a total of three doses were administered (Day0, Day14, and Day29), and the dosage was 5 mg / kg. After the start of drug administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 ) = 1 / 2 × (L × W 2 ) (where L represents the long diameter and W represents the short diameter). The results of tumor volume changes are as Figure 8A shown. After the experiment, the mice were sacrificed, and the tumors were dissected and weighed. The results are as Figure 8B shown (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001).

[0367] Example 18 Antitumor effect in the human lung cancer NCI-H2170 cell model

[0368] Experimental animals

[0369] NCG mice were purchased from Chengdu Biocytogen Co., Ltd.

[0370] Animal modeling

[0371] NCI-H2170 cells were resuspended in RPMI 1640 medium or DMEM medium (total volume 0.1 mL / mouse), and the NCG mice used in the experiment had the hair on the right front side of the back removed before inoculation, and then 1×10 7 cells were subcutaneously inoculated.

[0372] Drug administration plan

[0373] The test samples (negative control: PBS solution; test drugs: ADC-2, ADC-4, ADC-5; positive control: Dato-Dxd) were injected into the tail vein of the animals (6 animals per group), the day of drug administration was recorded as D0, and a total of one dose was administered (Day0), and the dosage was 5 mg / kg. After the start of drug administration, the body weight and tumor size of the mice were measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 ) = 1 / 2 × (L × W 2)(where L represents the major axis and W represents the minor axis). The results of tumor volume changes are as follows Figure 9A . After the experiment, the mice were sacrificed, and the tumors were dissected and weighed. The results are as follows Figure 9B shown (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001).

[0374] Example 19 Preparation of Exatecan (Compound 6) ADC (ADC-6)

[0375] TCEP was directly added to the protein solution to reduce the antibody (Sacituzumab). The molar ratio of TCEP to the antibody was 4:1, and the antibody was reduced by shaking in a constant temperature shaker at 30 °C for 2 h. Compound 6 was added to complete the thiol coupling. The molar ratio of Compound 6 to the antibody was 5:1, and stirring was carried out at 2 - 8 °C for 2 h to complete the thiol-toxin coupling. DMSO, Compound 6 and other substances introduced during the process were removed by concentration and buffer exchange. The sample was replaced into a 4.29 g / L MES buffer solution with pH 6.5, the protein concentration was adjusted to 20 mg / ml, and trehalose and polysorbate 80 (II) were added to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. 100 μg of the sample was taken, ultrapure water was added to make up the final volume to 100 μl, and then direct LC-MS detection was carried out. The average DAR value of the sample was calculated according to the normalization of the mass spectrometry signal intensity, and the DAR value of exatecan was 3.9.

[0376] Example 20 Preparation of Exatecan (Compound 6) ADC (ADC-7)

[0377] TCEP was directly added to the protein solution to reduce the antibody (Sacituzumab). The molar ratio of TCEP to the antibody was 8:1, and the antibody was reduced by shaking in a constant temperature shaker at 30 °C for 2 h. Compound 6 was added to complete the thiol coupling. The molar ratio of Compound 6 to the antibody was 10:1, and stirring was carried out at 2 - 8 °C for 2 h to complete the thiol-toxin coupling. DMSO, Compound 6 and other substances introduced during the process were removed by concentration and buffer exchange. The sample was replaced into a 4.29 g / L MES buffer solution with pH 6.5, the protein concentration was adjusted to 20 mg / ml, and trehalose and polysorbate 80 (II) were added to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. 100 μg of the sample was taken, ultrapure water was added to make up the final volume to 100 μl, and then direct LC-MS detection was carried out. The average DAR value of the sample was calculated according to the normalization of the mass spectrometry signal intensity, and the DAR value of exatecan was 7.9.

[0378] Example 21 Preparation of Triptolide (Compound 3) ADC (ADC-8)

[0379] Add samples to the following reaction system to make the final concentration of the antibody (Sacituzumab) 10 mg / ml, MnCl 2 The final concentration is 10 mmol / L, the final concentration of pH 7.5 Tris-HCl is 10 mmol / L, the final concentration of UDP-GalNAz is 5 mmol / L, and GalT1 is added in a ratio of 5 mg GalT1 / 1 g mAb to 50 mg GalT1 / 1 g mAb. Shake in a constant temperature shaker at 30 °C for ≥12 h to complete the azidation reaction of the antibody. Remove UDP-GalNAz, GalT1, Mn 2+ and other substances introduced by the azidation reaction through chromatography. Add compound 3 to the following reaction system to make the final concentration of the azidated antibody 10 mg / ml, the final concentration of DMSO 10%, and the molar ratio of compound 3 to the antibody 5-15. Shake in a constant temperature shaker at 30 °C for ≥12 h to complete the sugar conjugation of the antibody and the toxin. Remove DMSO, compound 3 and other substances introduced during the process by concentration and buffer exchange, displace the sample into a 4.29 g / L MES buffer at pH 6.5, adjust the protein concentration to 20 mg / ml, and supplement trehalose and polysorbate 80 (II) to make the final concentration of trehalose 8.56 g / L and the final concentration of polysorbate 80 (II) 0.1 g / L to complete the preparation of the sample. Take 100 μg of the sample, supplement ultrapure water to a final volume of 100 μl, and then directly detect by LC-MS. Calculate the average DAR value of the sample according to the normalized mass spectrometry signal intensity, and the value of triptolide is 3.7.

[0380] Example 22 Pharmacodynamic Experiment on NCI-H292 CDX Model Animals

[0381] Experimental Animals

[0382] NKG mice were purchased from Cyagen Biosciences Inc.

[0383] Animal Modeling

[0384] Resuspend NCI-H292 cells in 1640 medium or DMEM medium at a density of 1×10 8 cells / mL. Before inoculation, shave the hair on the right front side of the back of the experimental mice, and then subcutaneously inoculate 0.1 mL of the cell suspension per mouse at an inoculation density of 1×10 7 NCI-H292 cells per mouse, with 8 animals in each group.

[0385] Drug Administration Plan

[0386] The test samples (negative control: PBS solution; test drugs: ADC8 group, ADC-7 group, ADC8+ADC6 group, ADC-4 group) were injected into the tail veins of animals. The day of administration was recorded as D0, and a total of three administrations were given (Day0, Day14, Day28). The administration doses were as follows: ADC8 group (5 mg / kg), ADC-7 group (5 mg / kg), ADC8+ADC6 group (2.5 mg / kg + 2.5 mg / kg), ADC-4 group (5 mg / kg). After the start of administration, the body weights and tumor sizes of the mice were measured twice a week. The formula for calculating the tumor volume: Tumor volume (mm 3 ) = 1 / 2×(L×W 2 ) (where L represents the long diameter and W represents the short diameter). The results of the tumor volume changes are as shown in Figure 10 . Observation was stopped and the experiment was terminated on D43. The death situations of the mice were counted. The results showed that in the ADC-4 group, 5 mice survived and 3 died; while in the ADC-7 group, 7 mice died, and in the PBS control group, 7 mice died. The results are shown in the following table.

[0387] It can be seen from the results that the pharmacodynamic effects of the combined administration group of ADC8+ADC6 (Tripterygium wilfordii-ADC and Irinotecan-ADC) were similar to those of the ADC-7 and ADC-4 groups after the first two administrations. After the third administration, the pharmacodynamic effect of the ADC-4 group was the best, and in terms of the statistical results of the death time and number of mice, its safety was the best.

[0388] Table 1

[0389]

[0390] Example 2 Preparation of Dxd-ADC (ADC-9)

[0391] This preparation process includes antibody reduction → thiol coupling → concentration and buffer exchange. The antibody (Patritumab) was reduced with TCEP. TCEP was added at a molar ratio of TCEP to antibody of 4:1. The reduction reaction was carried out under the condition of shaking in a constant temperature shaker at 22°C for 2 h. After the reduction reaction of the antibody was completed, a small molecule toxin (Compound 8) with a maleimide linker was added to perform thiol coupling on the antibody. The small molecule payload (Dxd) was added at a molar ratio of small molecule to antibody of 6:1. The thiol coupling reaction was carried out under the condition of shaking in a constant temperature shaker at 22°C for 2 h. Then, impurities introduced by processes such as DMSO, TCEP, and small molecule payload were removed by concentration and buffer exchange. The average DAR value of the sample was calculated after normalization of the mass spectrometry signal intensity, and Dxd was 5.63.

[0392] Example 24 Preparation of Dxd-ADC (ADC-10)

[0393] This preparation process includes antibody reduction → thiol coupling → concentration and buffer exchange. The antibody (Patritumab) is reduced with TCEP. TCEP is added at a molar ratio of TCEP to antibody of 20:1. The reduction reaction is carried out under the condition of shaking in a constant temperature shaker at 22 °C for 2 h. After the reduction reaction of the antibody is completed, a small molecule toxin compound 8) with a maleimide linker is added for thiol coupling of the antibody. The small molecule payload (Dxd) is added at a molar ratio of small molecule to antibody of 20:1. The thiol coupling reaction is carried out under the condition of shaking in a constant temperature shaker at 22 °C for 2 h. Then, DMSO, TCEP, impurities introduced by the small molecule payload, etc. are removed by concentration and buffer exchange. The average DAR value of the sample is calculated after normalization of the mass spectrometry signal intensity, and Dxd is 7.93.

[0394] Preparation of Exatecan (Compound 6) / Tripterygium wilfordii Hook. f. (Compound 3) Dual-Toxin ADC (ADC-11) in Example 25

[0395] This preparation process includes antibody azidation → Protein A affinity chromatography → sugar coupling → antibody reduction → thiol coupling → concentration and buffer exchange. Samples are added to the following reaction system to make the final concentration of the antibody (Patritumab) 10 mg / ml, the final concentration of pH 7.5 Tris-HCl 10 mmol / L, and the final concentration of UDP-GalNAz 5 mmol / L. GalT1 is added at a mass ratio of GalT1 to antibody (Patritumab) of 40:1. The antibody azidation reaction is carried out under the condition of shaking in a constant temperature shaker at 22 °C for 14 - 16 h. Then, GalT1, UDP-GalNAz, Mn added in the azidation reaction are removed by Protein A affinity chromatography. 2+Impurities such as... Then, the antibody with an azide group and the small molecule payload with a DBCO linker (Compound 3) were added according to the ratio of the molar ratio of the small molecule payload (Compound 3) to the antibody being 7.5:1 for click chemical reaction. The sugar conjugation reaction of the antibody was carried out under the oscillation condition of a constant temperature shaker at 22 °C for a reaction time of 14 - 16 h to complete the sugar conjugation of the antibody and the small molecule payload (Compound 3). The sugar-conjugated antibody was reduced with TCEP. TCEP was added according to the ratio of the molar ratio of TCEP to the antibody being 3.7:1, and the reduction reaction was carried out under the oscillation condition of a constant temperature shaker at 22 °C for a reaction time of 2 h. After the reduction reaction of the antibody was completed, the small molecule with a maleimide linker (Compound 6) was added for thiol conjugation of the antibody. The small molecule payload (Compound 6) was added according to the ratio of the molar ratio of the small molecule to the antibody being 6:1, and the thiol conjugation reaction was carried out under the oscillation condition of a constant temperature shaker at 22 °C for a reaction time of 2 h. Finally, DMSO, TCEP, small molecule payload and other impurities introduced by the process were removed by concentration and buffer exchange. The average DAR value of the sample was calculated after normalization of the mass spectrometry signal intensity, which was 3.89 for irinotecan and 3.78 for triptolide.

[0396] Preparation of Triptolide ADC (ADC - 12) in Example 26

[0397] This preparation process includes antibody azidation → protein A affinity chromatography → sugar conjugation → concentration and buffer exchange. Samples were added to the following reaction system to make the final concentration of the antibody (Patritumab) 10 mg / ml, the final concentration of pH 7.5 Tris - HCl 10 mmol / L, and the final concentration of UDP - GalNAz 5 mmol / L. GalT1 was added according to the ratio of the mass ratio of GalT1 to the antibody (Patritumab) being 40:1. The azidation reaction of the antibody was carried out under the oscillation condition of a constant temperature shaker at 22 °C for a reaction time of 14 - 16 h. Then, impurities such as GalT1, UDP - GalNAz, Mn2+ added in the azidation reaction were removed by protein A affinity chromatography. Then, the antibody with an azide group and the small molecule payload with a DBCO linker (Compound 3) were added according to the ratio of the molar ratio of the small molecule payload (Compound 3) to the antibody being 5:1 for click chemical reaction. The sugar conjugation reaction of the antibody was carried out under the oscillation condition of a constant temperature shaker at 22 °C for a reaction time of 14 - 16 h to complete the sugar conjugation of the antibody and the small molecule payload (Compound 3). Finally, DMSO, TCEP, small molecule payload and other impurities introduced by the process were removed by concentration and buffer exchange. The average DAR value of the sample was calculated after normalization of the mass spectrometry signal intensity, which was 3.9 for triptolide.

[0398] Pharmacodynamic Effect in the Subcutaneous Tumor - bearing Model of NUGC - 4 Human Gastric Cancer Cells in NCG Mice in Example 27

[0399] Experimental animals

[0400] NCG mice were purchased from Chengdu Biocytogen Co., Ltd.

[0401] Animal modeling

[0402] NUGC-4 cells were cultured in 1640 + 10% FBS + 1% P / S medium. NUGC-4 cells in the exponential growth phase were collected, resuspended with 1640 empty medium to adjust the cell density to 1×10 8 cells / ml, and 1 ml of the cells were aliquoted into 1.5 ml EP tubes and kept on ice for later use. The cells were resuspended in 1640 empty medium (total volume 0.1 mL / mouse). Before inoculation, the hair on the right front side of the back of the experimental mice was removed, and then 1×10 7 NUGC-4 cells were subcutaneously inoculated. There were 8 animals in each group.

[0403] Drug administration protocol

[0404] The test samples (negative control: PBS solution; test drugs: ADC-9 group or ADC-10, ADC-11 group) were injected into the tail vein of the animals. The day of drug administration was recorded as Day 0, and the drug was administered three times in total (for the ADC-9 / ADC-10 group, ADC-9 was administered on Day 0, and ADC-10 was administered on Day 21 and Day 28). The drug administration doses were: 5 mg / kg on Day 0, and 10 mg / kg on Day 21 and Day 28 respectively; after the start of drug administration, the tumor size of the mice was measured twice a week. The tumor volume calculation formula: tumor volume (mm 3 ) = 1 / 2×(L×W 2 )(where L represents the long diameter and W represents the short diameter). The results of the tumor volume change are as Figure 11 shown.

[0405] Pharmacodynamic effect in the subcutaneous tumor-bearing model of colon cancer COLO205 cells in Example 28

[0406] Experimental animals

[0407] C-NKG mice were purchased from Cyagen Biosciences Inc.

[0408] Animal modeling

[0409] COLO205 cells were cultured in 1640 + 10% FBS medium. COLO205 cells in the exponential growth phase were collected, resuspended with 1640 empty medium, and the cell density was adjusted to 1×10 8cells / ml. Aliquot 1 ml of the cells into 1.5 ml EP tubes and keep on ice for later use. Before inoculation, remove the hair on the right front side of the back of the experimental mice, and then subcutaneously inoculate 0.1 mL of the cell suspension per mouse at an inoculation density of 1×10 7 NCI-H2170 cells per mouse. There are 8 animals in each group.

[0410] Drug administration regimen

[0411] Inject the test samples into the tail veins of the animals (negative control: PBS solution; test drugs: ADC9 group, ADC11 group). The day of drug administration is recorded as D0, and a total of four doses are administered (Day 0, Day 7, Day 14, Day 21). The drug administration doses are as follows: 10 mg / kg on Day 0, 5 mg / kg on Day 7 and Day 14 respectively, and 10 mg / kg on Day 21. After starting the drug administration, measure the tumor size of the mice twice a week. Tumor volume calculation formula: Tumor volume (mm 3 ) = 1 / 2 × (L × W 2 ) (where L represents the long diameter and W represents the short diameter). The results of the tumor volume changes are as Figure 12A shown.

[0412] On the 31st day after drug administration, divide the animals in the ADC 9 group into two equal groups and administer ADC-10 and ADC-11 respectively at a dose of 10 mg / kg. The changes in their tumor volumes are as Figure 12B shown. It can be seen from the figure that the tumor has developed drug resistance to ADC-9. After the grouped drug administration, the ADC-11 group can suppress the tumor growth, showing an obvious tumor growth inhibition effect, while the ADC-10 group still cannot suppress the tumor growth.

[0413] Example 29 Efficacy in a subcutaneous xenograft model of lung squamous cell carcinoma NCI-H2170 cells

[0414] Experimental animals

[0415] C-NKG mice were purchased from Cyagen Biosciences Inc.

[0416] Animal model establishment

[0417] Culture NCI-H2170 cells in a medium containing 1640 + 20% FBS. Collect the NCI-H2170 cells in the exponential growth phase, resuspend them in 1640 empty medium, and adjust the cell density to 1×10 8 cells / ml. Aliquot 1 ml of the cells into 1.5 ml EP tubes and keep on ice for later use. Before inoculation, remove the hair on the right front side of the back of the experimental mice, and then subcutaneously inoculate 0.1 mL of the cell suspension per mouse at an inoculation density of 1×10 7 NCI-H2170 cells per mouse. There are 8 animals in each group.

[0418] Dosing regimen

[0419] The test sample was injected into the tail vein of the animals (negative control: PBS solution; test drugs: ADC-9 group, ADC-11 group, ADC-12). The day of dosing was recorded as D0, and a total of 2 doses were administered (Day 0, Day 10). The dosing dose was: 5 mg / kg; after the start of dosing, the tumor size of the mice was measured twice a week. Tumor volume calculation formula: Tumor volume (mm 3 ) = 1 / 2 × (L × W 2 )(where L represents the long diameter and W represents the short diameter). The results of the tumor volume change are as Figure 13A shown.

[0420] Sixteen mice in the original ADC-9 group were evenly divided into two groups according to the tumor volume 21 days after the first dose, and were respectively given ADC-10 and ADC-11 at a frequency of once a week at a dose of 10 mg / kg. The PBS group and the original ADC-11 group were also continued to be dosed at a frequency of once a week at a dose of 10 mg / kg. The change in its tumor volume is as Figure 13B shown. It can be seen from the figure that under the condition of dosing once a week, ADC-10 has no significant inhibitory effect on tumor growth, and the ADC-11 group can significantly reduce the tumor.

Claims

1. Use of a combination of triptolide and camptothecin drugs in the preparation of drugs for treating tumor diseases.

2. The use according to claim 1, characterized in that: Triptolide and camptothecins act together as toxins in antibody-drug conjugates.

3. An antibody drug conjugate comprising a dual toxin having the formula: in, Ab is an antibody or its antigen-binding fragment; D1 and D2 are selected from triptolide or camptothecin drugs, and D1 and D2 are different; L1 and L2 are connection units; x,y is 0-8.

4. The antibody-drug conjugate according to claim 3, characterized in that: The L1 is connected to Ab via a thiol or amide group.

5. The antibody-drug conjugate according to claim 3 or 4, characterized in that: The L2 is linked to Ab via a sugar group.

6. The antibody-drug conjugate according to any one of claims 3 to 5, characterized in that: The L1 has [H1-L 1a -L 1b -L 1c -D1] x The structure shown; The L2 has [H2-L 2a- L 2b -L 2c -D2] y The structure shown; H1 and H2 are linker sites with Ab or groups that can react with Ab; L 1a It is connected between H1 and L 1b The connection unit between 2a It connects H2 and L 2b The connection unit between them; L 1b Is connected to L 1a and L 1c The linker between 2b Is connected to L 2a and L 2c The linker between L 1c YesL 1b and D1, L 2c YesL 2b and a spacer between D2.

7. The drug conjugate according to claim 6, characterized in that The H1 and H2 are selected from: in Indicates the connection site.

8. The drug conjugate according to claim 7, characterized in that The H1 is selected from: Preferably, H1 is 9. The drug conjugate according to claim 7, characterized in that: The H2 is selected from:

10. The antibody-drug conjugate according to any one of claims 6 to 9, characterized in that: The L 1a or L 2a Contains-L d -C(O)-, where L d is selected from an optionally substituted alkylene group, an optionally substituted polyethylene glycol group, an optionally substituted alkenylene group, an optionally substituted alkynylene group, an optionally substituted alicyclic group, an optionally substituted alicyclic heterocyclic group, an optionally substituted arylene group, an optionally substituted heteroarylene group or a combination thereof, preferably, L d Selected from optionally substituted C 1-30 an alkylene group, an optionally substituted polyethylene glycol group, an optionally substituted C 2-30 Alkenylene, optionally substituted C 2-30 Alkyne, optionally substituted C 3-30 Alicyclic group, optionally substituted C 1-30 Aliphatic heterocyclic group, optionally substituted C 6-30 Arylene, optionally substituted C 5-30 or a combination thereof.

11. The antibody-drug conjugate according to claim 10, characterized in that: The L d Selected from -(CH2)m-, -(PEG)n- or -(CH2) m -(PEG) n -(CH2) z -, wherein m, n, z are integers of 0-10, preferably, m, n, z are integers of 0-8.

12. The antibody-drug conjugate according to any one of claims 6 to 11, characterized in that: The L 1b or L 2b It is a cleavable linker or a non-cleavable linker.

13. The antibody-drug conjugate according to claim 12, characterized in that: The L 1b or L 2b is a cleavable peptide chain consisting of 2-10 amino acids; preferably, the L 1b or L 2b is selected from the group consisting of Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Val-Arg, AcLys-Val-Cit, AcLys-Val-Ala, Phe-Cit, Phe-Ala, Phe-Lys, Phe-Arg, Glu-Val-Ala, Glu-Val-Cit, Ala-Lys, Leu-Cit, lle-Cit, Trp-Cit, Ala-Ala-Asn, Ala-Ala-Ala, Ala-Asn, Lys; preferably, L 1b or L 2b Selected from Gly-Gly-Phe-Gly, Val-Cit, Val-Ala, Val-Lys, Phe-Cit, Phe-Ala, Phe-Lys, Ala-Ala-Asn.

14. The antibody-drug conjugate according to any one of claims 6 to 13, characterized in that: The L 1c or L 2c Selected from: Preferably, the L 1c Selected from in Indicates the connection site.

15. The antibody-drug conjugate according to any one of claims 3 to 14, characterized in that: The L1-D1 is in L 1a -(CH2) m1 -C(O)- or -(PEG) n1 -(CH2) z1 -C(O)-, wherein m1, n1, z1 are integers from 2 to 8; L 1b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 1c for D1 is triptolide or camptothecin drugs.

16. The antibody-drug conjugate according to any one of claims 3 to 15, characterized in that: The L2-D2 is in: L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2 to 8; L 2b is Gly-Gly-Phe-Gly, Val-Cit or Val-Ala; L 2c for D2 is triptolide or camptothecin drugs.

17. The antibody-drug conjugate according to claim 15, characterized in that: The L 1a -(CH2) m1 -C(O)-, wherein m1 is an integer of 2-6, preferably 5; or L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n1 and z1 are 2.

18. The antibody-drug conjugate according to claim 16, characterized in that: The L 2a -(PEG) n2 -(CH2) z2 -C(O)-, wherein n2 and z2 are integers of 2 to 6; or L 1a -(PEG) n1 -(CH2) z1 -C(O)-, wherein n1 and z1 are integers of 2-6, preferably n 2为 An integer from 4 to 6, where z2 is 2.

19. The antibody-drug conjugate according to claim 3, characterized in that: The D1 is triptolide, and D2 is a camptothecin drug.

20. The antibody-drug conjugate according to claim 3, characterized in that: The D1 is a camptothecin drug, and D2 is triptolide.

21. The antibody drug conjugate according to any one of claims 3 to 20, characterized in that: The camptothecin drug is camptothecin, exotecan, topotecan, SN38 or a derivative thereof; preferably, the camptothecin drug is exotecan.

22. The antibody-drug conjugate according to claim 3, characterized in that: The x is selected from 2-8, preferably 3-5; and y is selected from 3-4.

23. The antibody drug conjugate according to any one of claims 3 to 14, characterized in that: The L1-D1 is selected from:

24. The antibody drug conjugate according to any one of claims 3 to 14, characterized in that: The L2-D2 is selected from:

25. The antibody drug conjugate according to any one of claims 3 to 14, characterized in that: The L1-D1 is: L2-D2 is: Or the L1-D1 is: L2-D2 is: Or the L1-D1 is: L2-D2 is: Or the L1-D1 is: L2-D2 is:

26. The antibody drug conjugate according to any one of claims 3 to 25, characterized in that: The L2 is linked to the antibody via an oligosaccharide.

27. The antibody drug conjugate according to any one of claims 3 to 26, characterized in that: The antibody or antigen-binding fragment binds to one or more of the following: carbonic acid tincture enzyme IX, alpha-fetoprotein, alpha-actinin, A3, A33, ART 4, B7, B7H3, B7H4, BAGE, BrE3 antigen, CA125, CAMEL, CAP", CASP-8 / m, CCL19, CCL21, CD1, CD1a.CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD44, CD45, CD46, CD52, CD54, CD55, CD59 、CD64、CD66a-e、CD67、CD70、CD70L、CD74、CD79a、CD80、CD83、CD95、CD126、CD132、CD133、CD138、CD147、CD154、CDC27、CDK-4、CDKN2A、HIF-Ια、colon-specific antigen p(CSAp)、CEA、CEACAM5、CEACAM6、oMet、DAM、EGFR、EGFRvIII、cMet、EGP-1(Trop-2)、EGP-2、ELF2-M、Ep-CAM、Her2、Her3、Claudin 18.2, ROR1, ROR2, dll3, marcl7, fibroblast growth factor (FGF), Flt-1, Flt-3, folate receptor, G250 antigen, GAGE, gpl00, GRO-β, HLA-DR.HML24, HMGB-1, HSP70-2M., IGF-1R, IGR1R, MAGE, MAGE-3, MART-1, MART-2, NY-ESO-1, TRAG3, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC4, MUC5ac, MUC13, MUC16, MUM-1 / 2, MUM-3, NCA66, NCA95, NCA90, pancreatic cancer mucin, PD-1 receptor, PD-L1 receptor, placental growth factor, PLAGL2, prostatic acid phosphatase, PSA, PRAME, PSMA, P1GF, ILGF, ILGF-1R, RS5, RANTES, T101, SAGE, S100, survivin, survivin-2B, TAG, TAG-72, tenascin, TRAIL receptor, Tn antigen, ED-B, WT-1, 17-1A antigen; preferably, the antibody or antigen-binding fragment binds to an antigen selected from Her2, Her3, B7H3, Claudin 18.

2. One or more of DLL-3 or EGP-1 (Trop-2); and. Preferably, the antibody or antigen-binding fragment is selected from the group consisting of epratuzumab, veltuzumab, sacituzumab, patritumab, trastuzumab, pertuzumab, abciximab, alemtuzumab, cetuximab, gemtuzumab, ibritumomab, panitumumab, rituximab, tositumomab, abagovomab, atlizumab, benralizumab, obinutuzumab, basiliximab, dadizumab, efalizumab, muromomab, natlizumab, omalizumab, b, gaiitenemmab, solanezumab, tisotumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, enfortumab, belantamab, cetuximab, loncastuximab, daratumumab, nimotuzumab, zolbetuximab, omburtamab, and rvalpituzumab; more preferably, the antibody or antigen-binding fragment is selected from sacituzumab, daratumumab, zolbetuximab, omburtamab, patritumab, and rvalpituzumab.

28. The antibody drug conjugate according to any one of claims 3 to 27, characterized in that: The antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementary determining regions HCDR1-3, each comprising an amino acid sequence as described in SEQ ID NO: 1-3; The light chain variable region includes three complementarity determining regions LCDR1-3, which respectively contain the amino acid sequences described in SEQ ID NO: 4-6; preferably, the heavy chain variable region of the antibody or its antigen-binding fragment contains the amino acid sequence described in SEQ ID NO: 7, and the light chain variable region contains the amino acid sequence described in SEQ ID NO: 8; more preferably, the heavy chain of the antibody or its antigen-binding fragment contains the amino acid sequence described in SEQ ID NO: 9, and the light chain contains the amino acid sequence described in SEQ ID NO:

10.

29. The antibody drug conjugate according to any one of claims 3 to 27, characterized in that: The antibody or antigen-binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three complementarity determining regions HCDR1-3, respectively comprising the amino acid sequences described in SEQ ID NOs: 11-13; wherein the light chain variable region comprises three complementarity determining regions LCDR1-3, respectively comprising the amino acid sequences described in SEQ ID NOs: 14-16; preferably, the heavy chain variable region of the antibody or antigen-binding fragment thereof comprises the amino acid sequence described in SEQ ID NO: 17, and the light chain variable region comprises the amino acid sequence described in SEQ ID NO: 18; more preferably, the heavy chain of the antibody or antigen-binding fragment thereof comprises the amino acid sequence described in SEQ ID NO: 19, and the light chain comprises the amino acid sequence described in SEQ ID NO:

20.

30. The antibody drug conjugate according to any one of claims 3 to 29, characterized in that: x+y≥4, preferably 4≤x+y≤9, more preferably 7≤x+y≤8.

31. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the antibody-drug conjugate according to any one of claims 3 to 30, and a pharmaceutically acceptable carrier, excipient or diluent.

32. Use of the antibody drug conjugate of any one of claims 3 to 30 in the preparation of a medicament for treating and / or preventing a tumor; preferably, the tumor is selected from tumors associated with the expression of one or more of the following molecules: Trop-2, Her2, Her3, B7H3, Claudin 18.2, CD30, CD38, CD33, CD70 and EGFR; preferably, the tumor comprises a solid tumor or a blood tumor; more preferably, the tumor is selected from: lung cancer, kidney cancer, urethral cancer, colorectal cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, leukemia, malignant lymphoma, cervical cancer, squamous cell carcinoma, penile cancer, esophageal cancer, salivary gland cancer.

Images