Primer combination and kit for detecting central nervous system infection pathogens

Abstract

The invention relates to the technical field of biology, in particular to a primer combination and a kit for detecting central nervous system infection pathogens. The invention discloses a primer combination for detecting central nervous system infection pathogens. The primer combination comprises 24 pairs of specific primers and 2 pairs of universal primers. In order to identify the variety of pathogens infected with CNS, the process of establishing the detection method comprises the following steps: firstly, designing a specific amplification primer combination for amplifying 20 common key pathogen marker genes infected with CNS and 4 exogenous quantitative endogenous reference genes; secondly, designing a universal amplification primer combination for amplifying a bacterium 16S rRNA (ribosomal Ribonucleic Acid) gene and a fungus ITS (internal transcribed spacer) gene; the kit disclosed by the invention can simultaneously finish amplification and detection of a plurality of genes under the same reaction condition, can identify the variety of CNS-infected pathogens without culturing the pathogens, and has the characteristics of multiple indexes, rapidness, strong specificity, high sensitivity and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a primer combination and a kit for detecting pathogens causing central nervous system infections. Background Art

[0002] Central nervous system (CNS) infection refers to an acute or chronic inflammatory (or non-inflammatory) disease caused by pathogens invading the CNS, including meningitis and / or encephalitis. The pathogens causing CNS infections mainly include bacteria, viruses, fungi, parasites, and mycoplasmas. The invasion of pathogens into the CNS can cause infectious lesions, and in severe cases, it may endanger life and lead to serious sequelae (Le Govic et al., PLoS Pathog 2022, 18(2): e1010234; Horiba et al., Open Forum Infect Dis 2022, 9(10): ofac504).

[0003] Currently, the clinical diagnostic methods for CNS infections mainly include: microbial culture, polymerase chain reaction (PCR), metagenomic sequencing, etc. Quickly and timely identifying the pathogens causing CNS infections is crucial for the full diagnosis and treatment of CNS infections. However, the microbial culture method is time-consuming and has low detection sensitivity for patients who have received antibiotic treatment. The PCR technique relies on known pathogen information and can only specifically detect a single pathogen at a time. Unbiased metagenomic sequencing can cover almost all existing pathogens, but its sensitivity highly depends on the background level, and the sequencing data volume is too large and the analysis time is long (Fu et al., Microbiol Spectr 2022, 10(2): e0027022).

[0004] Nanopore sequencing technology is a newly developed single-molecule high-throughput sequencing method, which has the advantages of low cost, non-labeling, long base sequence reading, no base preference, and the ability to span repetitive genomic regions, and can obtain sequence information in real time (Deamer et al., Nat Biotechnol 2016, 34: 518-524; Wang et al., Nat Biotechnol 2021, 39: 1348–1365). In recent years, due to the upgrade of nanopore sequencing chips and algorithms, the overall sequencing yield and quality have been greatly improved, achieving an accuracy of >99%. If the DNA and RNA of the pathogen are co-extracted first, then the RNA is reverse-transcribed, and then the marker genes of key pathogens are amplified by multiplex PCR to rapidly target and enrich the target gene fragments, thereby greatly reducing the complexity of experimental operations, improving the timeliness of gene sequence analysis, and at the same time combining the portability characteristics of nanopore sequencing equipment, a new breakthrough and application will be brought to the analysis of central nervous system infections. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer combination and a kit for detecting pathogens causing CNS infections, so as to achieve the analysis of pathogens causing CNS infections.

[0006] To solve the above technical problem, the present invention provides a primer combination for detecting pathogens causing central nervous system infections, including 20 pairs of specific primers (sequence 1 to sequence number 20) as described in Table 1 below.

[0007] As an improvement to the primer combination for detecting pathogens causing central nervous system infections of the present invention: it further includes 4 pairs of specific primers (sequence 21 to sequence number 24) and 2 pairs of universal primers (sequence 25 to sequence number 26) as described in Table 1 below.

[0008] Table 1 Primer Sequences

[0009] Serial Number Gene Name Gene ID Pathogen Type Forward Primer Sequence Reverse Primer Sequence 1 hly 987033 NC_003210.1 AAACTTCGGCGCAATCAGTG AGCAATGGGAACTCCTGGTG 2 ply 66806991 NZ_CP020549.1 CCCATTTCTGTCCCAAGCCT TCGAGTGTTGCTTATGGGCG 3 ctrA 61282337 NZ_CP021520.1 TTTCTGTGCCGTTTGTTGGC ACCGTTGGAATCTCTGCCTC 4 rpoB 888164 NC_000962.3 TCGGCCAGATTTTGGAGACC CCGTCACTCGATAGCACCTC 5 ppk 946971 NC_000913.3 CAATGAACGCGTGCTTCAGG CAGGCTGGCTTCCATCTCAT 6 fucP 72526018 NZ_CP007470.1 CCAGCGGCATTATTTGCCAG AGTCCCATAACTTCGCCTTGG 7 pepF 66885711 NZ_CP012480.1 TTTGGAGCAGCTGGTGAGAC GCGAAGCCGGTTGCATATTG 8 CNN02320 3255447 NC_006683.1 TCGTGCTTCTCGAATGTCCC AGGAGGAAAGATGCCACACG 9 ORF38 1487706 NC_001348.1 CCGTCCCCAAATGGTGTTTG GGGCTTTATTGGCACGTTGG 10 BFRF1 3783699 NC_007605.1 CCTCGCCCGTGTTTGTGATA ACGAGTTCCTTCTTCCACGG 11 Jvgp4 1489518 NC_001699.1 CTCATGTGGGAGGCTGTGAC ATGTCTGGGTCCCCTGGAAG 12 U36 3289494 NC_001716.2 ACGTAGACTGAGACGAGCATC ACGGTAGAATGTGTTTCAGCTT 13 L3 2652998 NC_001405.1 GGTGGTCAATCCGTTCTGGT GTCGTAGGTGTTGGGGTTGT 14 U90 1497087 NC_000898.1 CATTCACATGCGTGGGTGAT TAGCTCAGTCCGTTGGCAAT 15 UL39 1487325 NC_001798.2 GTATCGCATCCTGGGGGTTC AACTCCTCGCCGTGAAAGTC 16 US3 2703401 NC_001806.2 AAACCTTCCCACACCACACC TCTCGAAGATCACCAGACCG 17 UL97 3077517 NC_006273.2 ATCATCACCACGTCCATCCG ACAGACGCTCCACGTTCTTT 18 M 1489764 NC_002200.1 TGCCACTCCAGAAACATCCG TGGAACCACACGGATGCAAT 19 HEVAgp1 1461111 NC_001612.1 ACACAGGTGAGCAGTCATCG ATTGGAGCAGTTGTGGGACA 20 POLY 1489713 NC_001437.1 CAAGCACGGCATGGAGAAACA CCAGCACCTTTGAGTTGGAGC 21 dprA 83728099 NZ_CP030361.1 TCCAAAGAAGCATACGGCCC ATAGCTCTTCCGTCGGATCG 22 cel7a 18483782 NW_006711176.1 TGGACTCACGCTACGAACAG CAAGCCGCACCTTGAATTGG 23 CaMVgp5 1489541 NC_001497.2 ACGAGCAAGAGAAGGCCAAG GCCTTCAATGTTGCAGATCC 24 TMVgp6 1494080 NC_001367.1 ACTCCATCTCAGTTCGTGTTCT CAAGTTGCAGGACCAGAGGT 25 16S rRNA / / AGRGTTYGATYMTGGCTCAG RGYTACCTTGTTACGACTT 26 ITS / / TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC

[0010] The present invention also simultaneously provides a kit for detecting pathogens causing central nervous system infections, including the primer combination as described above.

[0011] As an improvement to the kit for detecting pathogens causing central nervous system infections of the present invention:

[0012] (1) Reverse transcription system:

[0013] It includes a reverse transcription primer mixture composed of reverse transcription primers for M, HEVAgp1, and POLY, reverse transcriptase, RNase inhibitor, 5× reverse transcription buffer, and dNTPs;

[0014] (2) Multiplex PCR amplification system:

[0015] A multiplex PCR amplification primer mixture composed of 24 pairs of specific primers and 2 pairs of universal primers, multiplex PCR polymerase, 5× PCR amplification buffer, 5× high GC enhancer (used to ensure the amplification performance of DNA templates with high GC content), and dNTPs.

[0016] As a further improvement to the kit for detecting pathogens causing central nervous system infections of the present invention:

[0017] In the reverse transcription system (RNA reverse transcription reaction system): the final concentration of each reverse transcription primer in the reverse transcription primer mixture is 100 nM to 1 μM (preferably 200 nM); the final concentration of reverse transcriptase is 0.5 to 15 U / 20 μL (preferably 10 U / 20 μL); the final concentration of dNTPs is 0.2 to 1 mM (preferably 0.5 mM); the final concentration of RNase inhibitor is 0.2 to 2 U / μL (preferably 0.4 U / μL); the 5× reverse transcription buffer is diluted to 1×;

[0018] In the multiplex PCR amplification system: the final concentration of each primer in the multiplex PCR amplification primer mixture is 100 nM to 1 μM (preferably 200 nM), the final concentration of the multiplex PCR polymerase is 0.5 to 3 U / 25 μL (preferably 1 U / 25 μL), and the 5×PCR amplification buffer is diluted to a final concentration of Mg 2+ of 0.5 mM to 3 mM (preferably diluted to 1×, at this time the final concentration of Mg 2+ is 2 mM); the 5× high GC enhancer is diluted to 1×, and the final concentration of dNTPs is 0.2 to 1 mM (preferably 0.2 mM).

[0019] As a further improvement of the kit for detecting pathogens causing central nervous system infections of the present invention:

[0020] The reverse transcription primers for M, HEVAgp1, and POLY are their corresponding specific primers.

[0021] As a further improvement of the kit for detecting pathogens causing central nervous system infections of the present invention:

[0022] The multiplex PCR polymerase (Taq polymerase) is one of Kapa DNA polymerase, Hieff DNA polymerase, EpiQuick DNA polymerase, HiPer plus DNA polymerase, PrimeStar DNA polymerase, Phanta DNA polymerase, and NEB Q5 DNA polymerase;

[0023] The reverse transcriptase is one of PrimeScript reverse transcriptase, MMLV reverse transcriptase, AMV reverse transcriptase, BcaBEST reverse transcriptase, and Induro reverse transcriptase.

[0024] The present invention adopts a multiplex PCR target capture method combined with nanopore sequencing technology, which can eliminate the interference of non-target gene sequences such as human genes and quickly and simply detect multiple pathogens infecting the CNS.

[0025] The multiplex PCR target capture sequencing adopted by the present invention contains a total of 26 amplicons. The lengths of these amplicon sequences are between 300 - 1600 bp and can accommodate the labeled gene fragments of the target pathogens. Nanopore sequencing can completely read these amplicon sequences and quickly decode them through simple data analysis. The long-read sequencing of nanopores can analyze the full-length genes, which was impossible with previous sequencing technologies. Due to the increased read length, the discrimination rate of taxonomic units has been improved compared to previous technologies. The multiplex PCR target capture method has the advantages of short library construction cycle, high gene sequence capture rate, good uniformity, high alignment rate, good repeatability, and simple operation.

[0026] In the present invention, in order to identify the types of pathogens infecting the CNS and establish a detection method, the process is as follows: First, a specific amplification primer combination is designed to amplify 20 marker genes of common key pathogens infecting the CNS and 4 exogenous quantitative internal standard genes; second, a general amplification primer combination is designed to amplify the bacterial 16S rRNA gene and the fungal ITS gene. After these primers are synthesized, they are dissolved and their concentrations are measured. After experimental screening and verification, the details are shown in Table 1 above.

[0027] The above-mentioned 20 marker genes of common key pathogens infecting the CNS are as follows:

[0028] Detection of the marker genes of 7 key bacteria, such as hly, ply, ctrA, rpoB, ppk, fucP, and pepF, can identify Listeria monocytogenes, Streptococcus pneumoniae, Neisseria meningitidis, Mycobacterium tuberculosis, Escherichia coli, Haemophilus influenzae, and Streptococcus agalactiae respectively; detection of the CNN02320 gene can identify Cryptococcus neoformans; detection of the marker genes of 9 key DNA viruses, such as ORF38, BFRF1, Jvgp4, U36, L3, U90, UL39, US3, and UL97, can identify varicella-zoster virus, Epstein-Barr virus, JC virus, human herpesvirus 7, adenovirus, human herpesvirus 6, herpes simplex virus 2, herpes simplex virus 1, and cytomegalovirus respectively; detection of the marker genes of 3 key RNA viruses, such as M, HEVAgp1, and POLY, can identify mumps virus, enterovirus, and Japanese encephalitis virus respectively.

[0029] Full-length sequencing of the entire 16S rRNA gene, including 9 hypervariable regions (V1-V9), with highly conserved regions on both sides, is used to assist in confirming the types of bacteria infecting the CNS and supplementing the report of other bacterial types (Calus et al., GigaScience 2018, 7(12): giy140). Sequencing of the entire ITS gene, including the ITS1, ITS2 fragments and the 5.8S rDNA fragment, is used to assist in confirming the types of fungi infecting the CNS and supplementing the report of other fungal types (Fujita et al., J Clin Microbiol 2001, 39: 3617-22).

[0030] The above-mentioned 4 exogenous quantitative internal standard genes are as follows:

[0031] Four genes, namely dprA, cel7a, CaMV gp5, and TMV gp6, can be detected to identify Halomonas ruber, Trichoderma reesei, Cauliflower mosaic virus, and Tobacco mosaic virus respectively. Halomonas ruber is an extreme halophilic bacterium found in high-salt environments; Trichoderma reesei is a Trichoderma growing on the surface of wood; Cauliflower mosaic virus is a plant double-stranded DNA virus; and Tobacco mosaic virus is a single-stranded positive-sense RNA virus in the genus Tobamovirus. These four microorganisms mainly present in the environment and plants are added into the experimental system as internal standards. By adding known amounts of internal standards to each sample, the abundances of various microbial communities in the sample can be quantitatively estimated, and the changes in microbial communities in different samples can be compared, so as to identify the microbial taxa truly related to the occurrence of diseases.

[0032] The present invention adopts a method for co-extracting DNA and RNA. During the process, no DNA enzyme or RNA enzyme is added, but inhibitors of DNA enzyme and RNA enzyme are added, and the water used is treated with diethyl pyrocarbonate (DEPC). To prevent RNA degradation, RNA is immediately reverse transcribed into cDNA after nucleic acid extraction and used as a PCR template together with the extracted DNA. In this way, bacteria, fungi, DNA viruses, and RNA viruses in the sample can be detected simultaneously, greatly improving the experimental efficiency.

[0033] After the multiplex PCR reaction, tag sequences are introduced through a ligation reaction. The number can be 6 to 384, and 6 to 384 samples are respectively labeled, that is, each sample corresponds to a unique tag sequence.

[0034] The multiplex PCR amplification products of each sample already labeled with tag sequences can be mixed together, and then a motor protein and a sequencing adapter are added through a ligation reaction to form a sequencing library. Finally, taking full advantage of the high-throughput of nanopore sequencing technology, the samples are sequenced on the machine, and during data analysis after sequencing, they can be split into individual samples according to the tags.

[0035] The present invention utilizes nanopore sequencing technology to develop a new type of molecular diagnostic kit. Without culturing pathogens, the nucleic acids in the sample are subjected to multiplex PCR amplification (RNA is first processed into cDNA), then the sequences are read by sequencing and data analysis is carried out, so as to quickly analyze the situation of infected pathogens. It can not only reduce the comprehensive detection cost of CNS infections, but also speed up the diagnosis, and has good clinical application potential.

[0036] It should be noted that: if the prior art involves both DNA and RNA at the same time, most of them still extract DNA and RNA separately, which is complex and time-consuming in operation. However, the present invention adopts a co-extraction method to improve the efficiency.

[0037] In summary, the present invention discloses a primer combination and a kit for detecting pathogens infecting the central nervous system (CNS). The kit is based on nanopore sequencing technology and contains 26 pairs of primers obtained through design, screening, and verification. During detection, these primer mixtures are used, and multiplex PCR is employed to amplify the nucleic acid of the sample to be tested. During the reaction process, each pair of primers amplifies a nucleotide sequence or the entire full-length gene sequence. Then, by utilizing the high-throughput and long-read characteristics of nanopore sequencing technology, these gene sequences are obtained. Finally, the sample to be tested is determined through bioinformatics analysis. The kit of the present invention can simultaneously complete the amplification and detection of multiple genes under the same reaction conditions, identify the types of pathogens infecting the CNS without culturing the pathogens, and has the characteristics of multiple indicators, rapidity, strong specificity, and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The following further elaborates on the specific implementation manners of the present invention with reference to the accompanying drawings.

[0039] Figure 1 It is the construction process of the multiplex PCR library for the kit of the present invention.

[0040] Figure 2 It is the overall detection process from sample processing to detection result analysis for the kit of the present invention. SPECIFIC IMPLEMENTATION MANNERS

[0041] The following further describes the present invention with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0042] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0043] Unless otherwise specified, the experimental materials, reagents, etc. used in the following examples can all be obtained through commercial channels.

[0044] The following examples are convenient for better understanding of the present invention, but do not limit the present invention.

[0045] Example 1. Composition of the Kit

[0046] (1) Reverse Transcription

[0047] RNA reverse transcription primer mixture: Custom synthesize the specific primers for the three genes M, HEVAgp1, and POLY as described in Table 1 (Sangon Biotech Co., Ltd.), and directly use them as the reverse transcription primers for M, HEVAgp1, and POLY; then prepare a reverse transcription primer mixture, and the final concentration of each reverse transcription primer in the reaction system is 200 nM;

[0048] Induro reverse transcriptase (New England Biolabs, USA): The final concentration in the reaction system is 10 U / 20 μL;

[0049] RNA enzyme inhibitor (New England Biolabs, Inc., USA): final concentration in the reaction system is 0.4 U / μL;

[0050] 5×Induro Reverse Transcription Buffer (New England Biolabs, Inc., USA): diluted to 1× in the reaction system;

[0051] dNTPs (Biolight Biotech Co., Ltd.): final concentration of each dNTP in the reaction system is 0.5 mM.

[0052] (2) Multiplex PCR amplification

[0053] Multiplex PCR amplification primer mixture: 26 pairs of primers described in Table 1 were commissioned for synthesis (Sangon Biotech Co., Ltd.), and then formulated into a multiplex amplification primer mixture. The final concentration of each primer in the reaction system is 200 nM;

[0054] NEB Q5 DNA Polymerase (New England Biolabs, Inc., USA): final concentration in the reaction system is 1 U / 25 μL;

[0055] 5×Q5 Buffer (New England Biolabs, Inc., USA): diluted to 1× in the reaction system, and at this time contains 2 mM of Mg 2+ ;

[0056] 5× High GC Enhancer (New England Biolabs, Inc., USA): diluted to 1× in the reaction system;

[0057] dNTPs (Biolight Biotech Co., Ltd.): final concentration of each dNTP in the reaction system is 0.2 mM;

[0058] Positive control: Escherichia coli DNA solution;

[0059] Negative control: TE buffer;

[0060] Exogenous quantitative internal standard genes: dprA gene of Halomonas rubra, cel7a gene of Trichoderma reesei, CaMVgp5 gene of Cauliflower mosaic virus, and TMVgp6 gene of Tobacco mosaic virus;

[0061] PCR product purification reagent: AMPure XP magnetic beads (Beckman Coulter, Inc., USA), which are mixed with the PCR product at a volume ratio of 1:1 when used.

[0062] In addition to this kit, supporting reagents and chips for library construction and nanopore sequencing are also required, which are purchased from Oxford Nanopore Technologies (ONT) in the UK: Tag sequence (molecular barcoding adapter) ligation reagent (Native Barcoding Kit96, SQK-NBD114.96); Motor protein and sequencing adapter ligation reagent (Ligation Sequencing Kit, SQK-LSK114); Nanopore sequencing chip (Flow Cell R10.4, FLO-MIN114).

[0063] Example 2: Application of the kit to known bacterial, fungal, and viral samples

[0064] The test samples include 20 pathogens, among which: There are 7 bacteria in total: Listeria monocytogenes, Streptococcus pneumoniae, Mycobacterium tuberculosis, Neisseria meningitidis, Streptococcus agalactiae, Escherichia coli, Haemophilus influenzae; There is 1 fungus in total: Cryptococcus neoformans; There are 9 DNA viruses in total: Herpes simplex virus type 1, Herpes simplex virus type 2, Varicella-zoster virus, Epstein-Barr virus, Cytomegalovirus, Human herpesvirus 6, Human herpesvirus 7, Adenovirus, JC virus; There are 3 RNA viruses in total: Enterovirus, Japanese encephalitis virus, Mumps virus. Each sample of the above 20 pathogens is diluted into 7 different concentrations of 10 1 、10 2 、10 3 、10 4 、10 5 、10 6 、10 7 copies / ml.

[0065] In addition, for Lactobacillus fermentum, Bacillus subtilis, and Saccharomyces cerevisiae, each sample has 2 different concentrations of 10 3 、10 4 copies / ml. Positive control: Escherichia coli DNA solution; Negative control: TE buffer; Exogenous quantitative internal standard genes: dprA gene of Halomonas rubra, cel7a gene of Trichoderma reesei, CaMVgp5 gene of Cauliflower mosaic virus, and TMVgp6 gene of Tobacco mosaic virus. The addition amount of the internal standard gene is 1000 copies per reaction and is added to each sample. The above strains and virus strains are obtained from existing research bases and cooperation units, and the types of strains and virus strains have been confirmed in advance.

[0066] Note: Positive and negative control products are used to confirm the validity of the experimental results and the presence or absence of contamination, etc. The exogenous quantitative internal standard gene is added to each sample at a fixed concentration, and relevant experimental treatments are carried out together with the pathogens in the sample. Finally, quantitative analysis of the microbial pathogens in the sample is performed using sequencing analysis.

[0067] The following operations were performed on each of the above samples: 800 μL was taken, and DNA and RNA in the samples were co-extracted according to the instructions of the extraction kit (QIAamp UCP Pathogen Mini Kit, Qiagen, Germany). Meanwhile, DNA enzyme inhibitor and RNA enzyme inhibitor were added to prevent DNA and RNA degradation. Finally, the nucleic acid was eluted into 50 μL of DEPC water. For the nucleic acid of the extracted samples, the following RNA reverse transcription and multiplex PCR amplification were performed.

[0068] Specifically as follows:

[0069] (1) First, according to the final concentration instructions of each component in the kit in Example 1, an RNA reverse transcription system (20 μL) was prepared:

[0070] Specifically: 4 μL of 5×Induro reverse transcription reaction buffer, 0.2 μL of RNA enzyme inhibitor, 1 μL of dNTPs, 2 μL of reverse transcription primer mixture, 1.8 μL of DEPC water, 1 μL of Induro reverse transcriptase, and finally 10 μL of sample nucleic acid was added as a template.

[0071] Reaction conditions: 55 °C, 10 min; 95 °C, 60 s. A template containing DNA and reverse transcribed cDNA was obtained.

[0072] (2) Then, according to the final concentration instructions of each component in the kit in Example 1, a PCR amplification system (25 μL) was prepared:

[0073] Specifically: 5 μL of 5×Q5 buffer, 5 μL of 5× high GC enhancer, 2 μL of dNTPs, 1.25 μL of multiplex amplification primer mixture (26 pairs of primers consisting of 24 pairs of specific primers and 2 pairs of universal primers as shown in Table 1), 1.5 μL of water, 0.25 μL of NEB Q5 Taq polymerase, and finally 10 μL of the template containing DNA and reverse transcribed cDNA was added.

[0074] Reaction conditions: 98 °C, 60 s; 98 °C, 20 s, 60 °C 30 s, 72 °C 120 s, cycled 35 times; 72 °C, 4 min.

[0075] The multiplex PCR amplification products of each sample were purified by mixing with AMPure XP magnetic beads in a 1:1 volume ratio and eluted into 24 μL of water.

[0076] According to the operation manual of ONT company, a molecular barcoding adapter ligation reagent (Native Barcoding Kit96) was used to introduce different tag sequences corresponding one by one according to the number of samples. This Native Barcoding Kit 96 can introduce at most 96 tags.

[0077] Continuing according to the operation manual of ONT Company, mix the labeled sample products, which is convenient for subsequent combined processing; use motor protein and sequencing adapter ligation reagent (Ligation Sequencing Kit) to obtain a sequencing library; add it to a nanopore sequencing chip (Flow Cell R10.4), load the chip onto a sequencer (ONT Company), and use the built-in MinKNOW software of the instrument to monitor the process for 1 hour.

[0078] The raw data of nanopore sequencing is in binary fast5 format containing all sequencing signals, and a single sequencing sequence (read) corresponds to a single fast5 file; base calling is performed using the Guppy software in the MinKNOW software package to convert the fast5 format data into fastq format, which contains the base information of numerous reads and their corresponding sequencing quality information. During bioinformatics analysis, it is necessary to split each sample according to the tag sequence and then remove the primer sequences for each sample separately to avoid affecting the accuracy of mutation identification; there is no need to remove duplicates here to avoid reducing the sequencing depth.

[0079] The present invention uses the open-source Centrifuge software for classification and microbial identification, with a quality threshold of 150, excluding low-quality sequences.

[0080] The software involved above are all existing known software, and during actual use, just operate according to the requirements of the software, so no further detailed description will be given.

[0081] The test results are as follows:

[0082] The initial concentrations are 10 2 、10 3 、10 4 、10 5 、10 6 、10 7 copies / ml of Listeria monocytogenes, Streptococcus pneumoniae, Mycobacterium tuberculosis, Neisseria meningitidis, Streptococcus agalactiae, Escherichia coli, Haemophilus influenzae, Cryptococcus neoformans, Herpes simplex virus type 1, Herpes simplex virus type 2, Varicella-zoster virus, Epstein-Barr virus, Cytomegalovirus, Human herpesvirus 6, Human herpesvirus 7, Adenovirus, JC virus, Enterovirus, Japanese encephalitis virus, and Mumps virus samples. After analysis by the open-source Centrifuge software, they were all accurately determined to be positive for CNS infection, and the pathogen names were provided.

[0083] The sequences amplified by the 16S rRNA universal primers were analyzed using the open-source Centrifuge software and corresponded to *Listeria monocytogenes*, *Streptococcus pneumoniae*, *Mycobacterium tuberculosis*, *Neisseria meningitidis*, *Streptococcus agalactiae*, *Escherichia coli*, and *Haemophilus influenzae*, respectively, thus demonstrating that the 16S rRNA universal primers can be used to assist in identifying the bacterial species in the samples. The sequences amplified by the ITS universal primers were analyzed using the open-source Centrifuge software and corresponded to *Cryptococcus neoformans*, thus demonstrating that the ITS universal primers can be used to assist in identifying the fungal species in the samples. For various samples with an initial concentration of 10 1 copies / mL, which were below the detection limit of 10 2 copies / ml, they were determined to be negative for CNS infection.

[0084] The initial sample concentrations of 10 3 and 10 4 copies / ml of *Lactobacillus fermentum*, *Bacillus subtilis*, and *Saccharomyces cerevisiae* were used to verify the specificity of the 24 pairs of specific primers shown in Table 1. Among them, *Lactobacillus fermentum* and *Bacillus subtilis* could amplify the corresponding 16S rRNA sequences through the 16S rRNA universal primers and corresponded to them after analysis using the open-source Centrifuge software. *Saccharomyces cerevisiae* could amplify the corresponding ITS sequences through the ITS universal primers and corresponded to them after analysis using the open-source Centrifuge software. However, since there was no marker gene information for CNS infection pathogens and it was not associated with CNS infection, the results were all determined to be negative for CNS infection.

[0085] Comparative Example 1: The specific primers for the ppk gene in Table 1 were changed to: upstream: TGCTGAAAGCCGATCAGGAA; downstream: ATTGGCTTTGCCGACATTGG, and the rest was the same as in Example 2. The results showed that after multiplex PCR amplification, the PCR products did not show the target band corresponding to the ppk gene on agarose gel electrophoresis, and no ppk gene information was obtained after nanopore sequencing and data analysis.

[0086] Comparative Example 2: The specific primers for the ppk gene in Table 1 were changed to: upstream: CCCGCTGATTGAAAGGATGC; downstream: AAACGCTGCTTGAGACTGGA, and the rest was the same as in Example 2. The results showed that after multiplex PCR amplification, the PCR products did not show the target band corresponding to the ppk gene on agarose gel electrophoresis, and no ppk gene information was obtained after nanopore sequencing and data analysis.

[0087] Comparative Example 3: The specific primers of the CNN02320 gene in Table 1 were changed to: upstream: TGGGTTCTCCACATTTCCGT; downstream: AGGACTCGGTGAACTTGCAG, and the rest were the same as Example 2. The results showed that after multiplex PCR amplification, the PCR product did not show the target band corresponding to the CNN02320 gene by agarose gel electrophoresis, and no CNN02320 gene information was obtained after nanopore sequencing and data analysis.

[0088] Example 3: Application of the kit to clinical samples

[0089] The test samples include: 5 bacterial culture samples, 4 cerebrospinal fluid samples, and 7 blood samples.

[0090] Since the QIAamp UCP Pathogen Mini Kit has an optional menu corresponding to the pre-treatment steps of different types of samples, the three samples were pre-treated according to the kit instructions, and then DNA / RNA was co-extracted and finally eluted into 50μL DEPC water; the subsequent experimental process was the same as Example 2.

[0091] Test results: The results of the 16 clinical samples were consistent with the clinical diagnosis results. Among them, 7 were positive, including Streptococcus pneumoniae, Streptococcus agalactiae, Cryptococcus neoformans, Escherichia coli, Mycobacterium tuberculosis, herpes simplex virus type 1, and cytomegalovirus, as shown in Table 2. The entire nanopore sequencing process takes about 8 hours, which is time-saving and labor-saving than conventional clinical methods, and helps guide the medication and treatment of CNS infections.

[0092] Table 2 Clinical sample test results

[0093]

[0094]

[0095] Finally, it should be noted that the above are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A primer combination for detecting pathogens of central nervous system infection, characterized in that: Includes the following 20 pairs of specific primers:

2. The primer combination for detecting pathogens of central nervous system infection according to claim 1, characterized in that: Also included are the following 4 pairs of specific primers and 2 pairs of universal primers:

3. A kit for detecting pathogens of central nervous system infection, characterized in that: Comprising the primer combination as described in claims 1 and 2.

4. The kit for detecting pathogens of central nervous system infection according to claim 3, characterized in that: (1) Reverse transcription system: A reverse transcription primer mixture consisting of reverse transcription primers of M, HEVAgp1, and POLY, reverse transcriptase, RNase inhibitor, 5× reverse transcription buffer, and dNTPs; (2) Multiplex PCR amplification system: Multiplex PCR amplification primer mixture consisting of 24 pairs of specific primers and 2 pairs of universal primers, multiplex PCR polymerase, 5× PCR amplification buffer, 5× high GC enhancer, and dNTPs.

5. The kit for detecting pathogens of central nervous system infection according to claim 4, characterized in that: In the reverse transcription system: the final concentration of each reverse transcription primer in the reverse transcription primer mixture is 100nM to 1μM; the final concentration of reverse transcriptase is 0.5 to 15U / 20μL; the final concentration of dNTPs is 0.2 to 1mM; the final concentration of RNase inhibitor is 0.2 to 2U / μL; 5× reverse transcription buffer is diluted to 1×; In the multiplex PCR amplification system: the final concentration of each primer in the multiplex PCR amplification primer mixture is 100nM to 1μM, the final concentration of the multiplex PCR polymerase is 0.5 to 3U / 25μL, and the 5× PCR amplification buffer is diluted to the Mg content. 2+ The final concentration is 0.5mM~3mM; 5× High GC Enhancer is diluted to 1×, and the final concentration of dNTPs is 0.2~1mM.

6. The kit for detecting pathogens that infect the central nervous system according to claim 4 or 5, characterized in that: The reverse transcription primers of M, HEVAgp1, and POLY are their corresponding specific primers.

7. The kit for detecting pathogens of central nervous system infection according to claim 6, characterized in that: The multiplex PCR polymerase is one of Kapa DNA polymerase, Hieff DNA polymerase, EpiQuick DNA polymerase, HiPerplus DNA polymerase, PrimeStar DNA polymerase, Phanta DNA polymerase, and NEB Q5 DNA polymerase; The reverse transcriptase is one of PrimeScript reverse transcriptase, MMLV reverse transcriptase, AMV reverse transcriptase, BcaBEST reverse transcriptase, and Induro reverse transcriptase.

Images