Platelet-LNP packaging complex as well as preparation method and application thereof

Abstract

The invention relates to the field of biological medicine, in particular to a platelet-LNP packaging complex as well as a preparation method and application thereof. The platelet is used as a carrier, the LNP is encapsulated in the platelet, and the injury part can be effectively targeted by using the unique homing characteristic of the platelet. The platelet-carrying packaged LNP can be accurately found and actively enriched in a damaged area in the injury such as myocardial ischemia or myocardial infarction, so that the accuracy of an LNP delivery gene therapy is improved, the use amount of the LNP is remarkably reduced, and meanwhile, the targeted delivery efficiency of a drug can also be improved. Meanwhile, after the platelet-packaged LNP enters blood circulation, the platelet can effectively protect the LNP from being cleared by the liver, and the delivery effect of the gene therapy is further optimized. The unique technical strategy not only improves the accuracy of the gene therapy, but also enhances the stability and durability of the gene therapy in vivo.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a platelet-LNP packaging complex and a preparation method and application thereof. Background Art

[0002] Lipid nanoparticles (LNP) are a non-viral gene delivery system. LNP is usually composed of four components: helper lipids, cationic lipids / ionizable lipids, cholesterol, and polyethylene glycol lipids (PEG-lipids). The ribonucleic acid (RNA, such as mRNA, siRNA) used in gene therapy and the cell membrane surface are negatively charged, and electrostatic repulsion makes it difficult for RNA to pass through the cell membrane and enter the cytoplasm. RNA molecules are unstable and easily degraded. And RNA used in gene therapy must enter the cell to exert its therapeutic effect. LNP can protect RNA from degradation and facilitate the delivery of RNA.

[0003] However, the tissue targeting of unmodified LNPs is currently mainly limited to the liver. After intravenous injection of LNPs, 80%-90% of the LNPs eventually accumulate in the liver, are phagocytosed by liver cells, and are ultimately inactivated by the liver, limiting their targeting to non-liver tissues. Therefore, how to achieve non-liver tissue targeting after LNP administration is a difficult problem to be solved. The off-target effects of LNP-loaded RNA may cause serious adverse reactions in the liver or other organs. If the treatment itself is targeted to the liver, a smaller dose of LNP can complete the delivery of gene therapy, but if it is targeted to other organs and tissues, a larger dose of LNP is required, which will increase the burden on the liver. Therefore, it is necessary to develop more targeted delivery therapies to reduce the dose of LNP required for treatment. Summary of the invention

[0004] The purpose of the present invention is to provide a platelet-LNP packaging complex and its preparation method and application to solve the problems existing in the above-mentioned prior art. The platelet-packaged lipid nanoparticles (LNP) used in the present invention have better organ targeting, thereby achieving the purpose of reducing the dose required for treatment.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a method for preparing a platelet-LNP packaging complex, comprising the following steps:

[0007] The platelets and lipid nanoparticles (LNP) were mixed and incubated at 37° C. for 2 h to obtain the platelet-LNP packaging complex.

[0008] Preferably, the quantity ratio of the platelets to the lipid nanoparticles is 1:100.

[0009] Preferably, the liposome nanoparticles include (2,3-dioleyloxypropyl)trimethylammonium chloride, polycarbonate, cholesterol and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol; the mass ratio of (2,3-dioleyloxypropyl)trimethylammonium chloride, polycarbonate, cholesterol and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol is 5:5:2:2.

[0010] The present invention provides a platelet-LNP packaging complex prepared by the above-mentioned preparation method.

[0011] The present invention provides the use of the platelet-LNP packaging complex in preparing a drug delivery system.

[0012] The present invention provides a drug delivery system, wherein the carrier of the drug delivery system is the platelet-LNP packaging complex.

[0013] The present invention provides application of the above-mentioned drug delivery system in preparing drugs.

[0014] The present invention provides a medicine, which comprises the above-mentioned drug delivery system.

[0015] The present invention discloses the following technical effects:

[0016] The present invention uses platelets as carriers to encapsulate LNPs therein, and utilizes the unique homing characteristics of platelets to effectively target the site of injury. For example, in injuries such as myocardial ischemia or myocardial infarction, platelets carry packaged LNPs, which can accurately find and actively enrich in damaged areas, improve the accuracy of LNP delivery gene therapy, significantly reduce the amount of LNP used, and also improve the efficiency of targeted drug delivery. At the same time, after the platelet-packaged LNPs enter the blood circulation, the platelets can effectively protect the LNPs from liver clearance, further optimizing the delivery effect of gene therapy. This unique technical strategy not only improves the accuracy of gene therapy, but also enhances the stability and durability of gene therapy in vivo. Compared with the prior art, the targeting of gene therapy delivery can be improved. It can be seen that the present invention provides a new gene therapy delivery platform. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 The images are observed by transmission electron microscope; A is the image of platelet-LNP packaging complex, and B is the local magnified image of A;

[0019] Figure 2 This is a transmission electron microscope image.

[0020] Figure 3 The bar graphs were investigated for the left ventricular ejection fraction (LVEF) of mice treated differently;

[0021] Figure 4 qPCR results of knockdown effects of different ratios of platelets and LNPs (different ratios of platelets and LNPs);

[0022] Figure 5 The q-PCR results of knockdown effects in different groups. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] Platelets are small cytoplasmic fragments derived from megakaryocytes that can precisely target and adhere to damaged blood vessels by relying on their surface receptors. The open duct system (OCS) is a duct system formed by the invagination of the platelet membrane into the interior of the platelet. It is a channel for various substances to enter the platelet and for the granule contents to be released outside the cell. The latest research shows that platelets can take in exogenous substances through the OCS and release them after platelet activation. These characteristics allow the inventors to develop a new gene delivery system around platelets.

[0029] Sources:

[0030] ACD buffer: manufacturer is Sigma-Aldrich (Sigma-Aldrich (Shanghai) Trading Co., Ltd.), brand number C3821;

[0031] 1% Penicillin / Streptomycin (P / S): manufacturer is Sigma-Aldrich (Sigma-Aldrich (Shanghai) Trading Co., Ltd.), brand number is P7539;

[0032] Prostaglandin E1 (PGE1): manufacturer is MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), brand number is HY-B0131;

[0033] Tyrode's buffer: manufacturer is Wuhan Pronocell Life Science Co., Ltd., brand name is PB180341;

[0034] PBS buffer: The manufacturer is Wuhan Saiweier Biotechnology Co., Ltd., brand number G4200;

[0035] HEPES solution: The manufacturer is Wuhan Saiweier Biotechnology Co., Ltd., brand number is G4210-100ml;

[0036] Bovine serum albumin (BSA): manufacturer: MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), brand: HY-D0842;

[0037] DMEM medium: manufacturer is Sigma-Aldrich (Sigma-Aldrich (Shanghai) Trading Co., Ltd.), brand number is D6429;

[0038] Glucose: manufacturer: MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), brand: HY-B0389;

[0039] DOTAP: The manufacturer is MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), the brand number is HY-112754A;

[0040] Phosphatidylcholine (PC): manufacturer: MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), brand: HY-B2235;

[0041] Cholesterol: manufacturer: MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), brand: HY-N0322;

[0042] DSPE-PEG: The manufacturer is MedChemExpress (Shanghai Haoyuan Pharmaceutical Co., Ltd. (agent)), brand number: HY-143209;

[0043] Anhydrous ethanol: manufacturer is Shanghai Test, brand number: 10009218;

[0044] Sodium citrate buffer: manufacturer is Beijing Solebow Technology Co., Ltd., brand: C1013-500ml;

[0045] Ultrafiltration tube: manufacturer is Millipore, brand number: UFC901096.

[0046] Example 1

[0047] The preparation of platelet-LNP packaging complexes, the specific steps are as follows:

[0048] Collect whole blood in a test tube containing 1 / 10 volume of ACD anticoagulant, mix gently, and then centrifuge to separate it into 3 layers. The centrifugation conditions have a large variable range. At room temperature, such as from 800×g for 5min to 100×g for 20min, different centrifugation conditions can produce stable and good separation effects. This embodiment selects 800×g for 5min. Then carefully draw the top layer of liquid, which is platelet-rich plasma (PRP), and transfer it to a new test tube. Add HEPES buffer solution to the absorbed PRP to a final concentration of HEPES of 1.9mM, and add PGE1 to a final concentration of PGE1 of 1μM to prevent premature activation of platelets. After gentle mixing, centrifuge at room temperature for 20min at 800×g, discard the supernatant, and the white precipitate at the bottom is the platelet precipitate. The platelet pellet was gently resuspended with Tyrode's buffer, and glucose and BSA were added to make the final concentration of glucose 5 mM and the final concentration of BSA 3 mg / mL. PGE1 was then added to make the final concentration of PGE1 1 μM to prevent platelet activation, thereby obtaining a platelet suspension.

[0049] DOTAP ((2,3-dioleyloxypropyl)trimethylammonium chloride), PC (phosphatidylcholine), Cholesterol (cholesterol) and DSPE-PEG (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol) were dissolved in anhydrous ethanol at a mass ratio of 5:5:2:2, placed in a centrifuge tube and vortexed, and 3 volumes of sodium citrate buffer were quickly added and vortexed for 30 seconds. After standing at room temperature for 15 minutes, the mixture was placed in a 15 mL 10KD ultrafiltration tube and centrifuged at 2500 × g for 30 minutes at room temperature. An appropriate volume of ddHO was added. 2 O to prepare LNP suspension. At this time, add therapeutically relevant RNA to the LNP suspension and sonicate for 5 minutes to package the RNA into LNP, wherein the mass ratio of DOTAP to therapeutically relevant RNA is 10:1 based on the mass of DOTAP.

[0050] The LNP to be packaged is added to the platelet suspension, and the ratio of platelets to LNPs is 1:100. At the same time, the ratio of platelets to LNPs can also be 1:10, 1:20, 1:50 and 1:200.

[0051] The platelet suspension containing LNPs was gently shaken (co-incubated) at 37° C. for 2 h to obtain platelet-packaged LNPs, also referred to as platelet-LNP packaging complexes.

[0052] The transmission electron microscope photo of the ultrathin sections made of platelet-packaged LNP after conventional resin embedding and fixation is shown in Figure 2. Figure 1 As shown ( Figure 1 B is a partial magnified image of A), and it can be seen that platelets engulf LNPs to form platelet-LNP packaging complexes. Figure 2 shown.

[0053] Example 2

[0054] The therapeutic effect of LNPs loaded with mRNA packaged in platelets was verified by the following steps:

[0055] The latest research has revealed that inhibiting fatty acid metabolism can promote the proliferation of damaged cardiomyocytes. Cpt1b is a fatty acid transporter on the cell mitochondrial membrane. Knocking out the Cpt1b gene can inhibit mitochondrial use of fatty acids, thereby promoting cardiomyocyte proliferation. The inventors designed and prepared a siRNA that can reduce the expression of the Cpt1b gene at the transcriptional level (the sequence of the sense strand of the siRNA is AGAGACAGACUUGCUACAGC, SEQ ID NO.1; the sequence of the antisense strand is UGUAGCAAGUCUGUCUCUUUG, SEQ ID NO.2), and packaged it into LNP for gene therapy intervention of damaged mice. The preparation method is the same as that in Example 1.

[0056] (1) Establishing C57BL / 6 mice with myocardial ischemia / reperfusion injury, the specific steps are as follows:

[0057] 1) C57BL / 6 mice were weighed, connected to a ventilator and anesthetized, and then fixed on the operating table in a supine position.

[0058] 2) After shaving the mouse chest hair and disinfecting it, make an incision about 1 cm long along the edge of the pectoralis major muscle between the 3rd and 4th intercostal spaces on the left side of the sternum, and bluntly separate the subcutaneous tissue, pectoralis major muscle, and serratus anterior muscle.

[0059] 3) Use mosquito forceps to penetrate the 3rd and 4th intercostal spaces and quickly squeeze out the heart.

[0060] 4) Use 6-0 silk thread to ligate the left anterior descending coronary artery (LAD); tie the ligature into a slipknot, cut the end near the needle short, leave 3-4 cm of the thread end far from the needle outside the chest cavity, and suture the wound.

[0061] 6) After 60 minutes of ischemia, the ligature was slowly pulled out to restore myocardial blood supply. The experiment was terminated and C57BL / 6 mice with myocardial ischemia / reperfusion injury were obtained.

[0062] (2) PBS (pbs), platelet-packaged LNP loaded with siRNA (LNP@PLT), and LNP packaged with siRNA (LNP) were injected intravenously into mice, 200 μL each time, once every 7 days, for a total of 4 injections, i.e., a total of 28 days. A sham operation group (sham) was also set up.

[0063] (3) Four weeks after treatment, cardiac function of mice was evaluated by echocardiography.

[0064] (4) Compared with other groups, the left ventricular ejection fraction (LVEF) was preserved to the greatest extent in the LNP@PLT group ( Figure 3 ). The results showed that platelet-packaged LNP-delivered gene therapy was more effective than simple LNP-delivered gene therapy.

[0065] Example 3

[0066] LNPs loaded with si-Cpt1b were prepared according to the method of Example 1, and LNPs were added to platelet suspensions at a platelet to LNP ratio of 1:10, 1:20, 1:50, 1:100, and 1:200, and gently shaken at 37°C for 2 h to prepare platelet-loaded LNPs. Afterwards, they were added to H9C2 cells cultured in DMEN medium containing 10% FBS and 1% penicillin / streptomycin (P / S) for 48 h. RNA was extracted from the cells, reverse transcribed to synthesize complementary DNA, and SYBR green was used as the detection method, and 2 -ΔΔCt Methods The mRNA level was calculated and normalized to the housekeeping gene, and the expression of Cpt1b was detected. Compared with other groups, the silencing effect of Cpt1b was best when the platelet to LNP ratio was 1:100 ( Figure 4 ). The results of q-PCR showed that the optimal ratio of platelets to LNPs was 1:100.

[0067] Experimental Example 4

[0068] According to the method of Example 1, LNP loaded with si-Cpt1b (LNP@PLT) was prepared, and LNP was added to the platelet suspension, with the ratio of platelet to LNP being 1:100. The platelet was gently shaken for 2 h at 37 °C to prepare platelet-loaded LNP. Platelet membranes were extracted according to the reference, and LNP was loaded onto the platelet membranes. After that, it was added to H9C2 cells cultured in DMEN medium containing 10% FBS and 1% penicillin / streptomycin (P / S) for 48 h. RNA was extracted from the cells, and complementary DNA was synthesized by reverse transcription. SYBR green was used as the detection method, and 2 -ΔΔCt Methods The mRNA level was calculated and normalized to the housekeeping gene, and the expression of Cpt1b was detected. At the same time, control (no treatment), LNP (only LNP) and LNP@PLT membrane (platelet membrane and LNP were fused, and platelet membrane was extracted as follows: 2% heparin sodium PBS buffer was added to the collected platelet-rich plasma, and a small amount of PGE1 was added to make the final concentration of PGE1 1μM to prevent platelet activation, and platelets were obtained by centrifugation at 800×g for 20min; the collected platelets were resuspended in 2% heparin sodium PBS buffer and stored at -80°C. The extracted platelets were frozen at -80°C, then thawed at 37°C, and after repeated freezing and thawing for 5 times, they were centrifuged at 12000×g for 20min, the supernatant was discarded, and the lower precipitate was the platelet membrane) and other treatments were set up. Compared with other groups, the platelet-loaded LNP group had a stronger silencing effect on Cpt1b than the platelet membrane-loaded LNP group ( Figure 5). The results of q-PCR showed that platelet-loaded LNP had a higher RNA delivery efficiency than the previous platelet membrane-loaded LNP.

[0069] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing a platelet-LNP packaging complex, characterized in that: The following steps are involved: After mixing the platelets and lipid nanoparticles, they were incubated at 37° C. for 2 hours to obtain the platelet-LNP packaging complex.

2. The preparation method according to claim 1, characterized in that: The quantity ratio of the platelets to the lipid nanoparticles is 1:

100.

3. The preparation method according to claim 1, characterized in that: The liposome nanoparticles include (2,3-dioleyloxypropyl)trimethylammonium chloride, polycarbonate, cholesterol and 1,2-distearoyl-sn-glycerol-3-phosphoethanolamine-polyethylene glycol; the mass ratio of the (2,3-dioleyloxypropyl)trimethylammonium chloride, polycarbonate, cholesterol and 1,2-distearoyl-sn-glycerol-3-phosphoethanolamine-polyethylene glycol is 5:5:2:

2.

4. A platelet-LNP packaging complex prepared by the preparation method according to any one of claims 1 to 3.

5. Use of the platelet-LNP packaging complex according to claim 5 in preparing a drug delivery system.

6. A drug delivery system, characterized in that The carrier of the drug delivery system is the platelet-LNP packaging complex according to claim 5.

7. Use of the drug delivery system according to claim 6 in preparing medicines.

8. A drug, characterized in that The drug comprises the drug delivery system according to claim 6.

Images