Nucleic acid medicine for mediating pyroptosis and application thereof

Abstract

The invention relates to the field of biological medicine, in particular to a nucleic acid medicine composition for mediating pyroptosis and application thereof. The nucleic acid pharmaceutical composition comprises mRNA capable of ionizing lipid compounds and GSDM protein family genes. The mRNA for coding the GSDM protein family is translated into the GSDM protein in vivo under the assistance of an LNP system containing ionizable lipid with a specific structure, and pyroptosis is triggered. Pyroptosis can induce cell death, start release of proinflammatory cytokines, activate and recruit immune cells in vivo, further trigger a series of cascade reaction events and further promote cell death, cytokine release and immune activation, and compared with commercially available products, the pyroptosis has the advantages that the pyroptosis effect is good; the ionizable lipid with a specific structure shows a more excellent effect of mediating pyroptosis of cells, and a brand-new treatment means with clinical transformation potential is provided for the related fields of pyroptosis of cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a nucleic acid drug for mediating cell pyroptosis and applications thereof. Background Art

[0002] Pyroptosis is a newly discovered form of programmed cell death, essentially a cascade-amplified inflammatory response. The Gasdermin (GSDM) family of proteins, comprising Gasdermin A (GSDMA), Gasdermin B (GSDMB), Gasdermin C (GSDMC), Gasdermin D (GSDMD), Gasdermin E (GSDME), and DFNB59, are key mediators of pyroptosis. Upon cell stimulation, the intracellular inflammasome—a protein complex formed by the innate immune system in response to various signals and involved in intracellular signaling—activates caspase-specific proteases (caspases). These activated proteases cleave the GSDM family of proteins, releasing their N-terminal domains, which recognize membrane lipids and create pores in the cell membrane. This alters cellular osmotic pressure, leading to an imbalance in electrolytes inside and outside the cell membrane. This causes cell swelling and rupture, releasing a large amount of inflammatory factors and cellular contents, which in turn recruit immune cells to further amplify the immune response and cause the target cell to die.

[0003] Gasdermin family proteins play a key role in diseases such as tumors, infectious diseases, neurological diseases, atherosclerotic diseases, diabetes, ankylosing spondylitis, asthma, inflammatory bowel diseases (such as Crohn's disease and ulcerative colitis), and metabolic diseases. However, drug development in the field of gasdermin is still in its early stages. The only report is that the team led by Shao Feng, an academician of the Chinese Academy of Sciences, developed the world's first small molecule inhibitor specific for gasdermin protein in August 2022. Therefore, the field urgently needs to develop gasdermin-related drugs to provide new solutions to these unmet clinical needs.

[0004] Nucleic acid drugs have been at the forefront of biopharmaceutical development in recent years. Compared to traditional small molecule drugs and antibody drugs, they are theoretically not limited by the "undruggability" of their targets. With the advancement of clinical trials and the maturity of related technologies, the efficient development of mRNA vaccines has driven the rapid development of the entire nucleic acid drug field, and is expected to usher in a wave of third-generation drugs.

[0005] As an exogenous drug, nucleic acid drugs need to overcome multiple obstacles before they can enter the body and exert their effects: instability, immunogenicity, low cellular uptake efficiency, difficulty in endosome escape, poor in vivo translation efficiency, etc. An efficient and safe delivery system is an important guarantee for nucleic acid drugs to overcome the above defects and exert stable targeted efficacy.

[0006] Currently, lipid nanoparticles (LNPs) are the only commercially successful nucleic acid drug delivery vehicles. The LNP system mainly consists of four components: ionizable lipids, cholesterol, phospholipids, and PEG-lipids. Among them, ionizable lipids are the most critical component in the LNP delivery system, with the characteristics of binding to negatively charged nucleic acids, facilitating cellular uptake and endosomal escape, and enhancing the transfection of nucleic acid drugs in vivo. Although the existing technology has disclosed some ionizable lipid compounds, the field still needs to develop ionizable lipids with higher transfection efficiency and better stability to prepare nucleic acid drugs that can express gasdermin protein, thereby mediating cell pyroptosis and meeting clinical needs. Summary of the Invention

[0007] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a nucleic acid pharmaceutical composition for mediating cell pyroptosis and its application, so as to solve the problems in the prior art.

[0008] To achieve the above objectives and other related objectives, the present invention provides a nucleic acid pharmaceutical composition that mediates cell pyroptosis, wherein the nucleic acid pharmaceutical composition comprises a compound represented by formula (I) and mRNA of a GSDM protein family gene.

[0009] The nucleic acid pharmaceutical composition provided by the present invention further comprises any one or more combinations of structural lipids, helper lipids, PEG-lipids, and polymers.

[0010] The nucleic acid pharmaceutical composition provided by the present invention further comprises a pharmaceutically acceptable excipient.

[0011] The present invention also provides a method for preparing the aforementioned nucleic acid pharmaceutical composition comprising the following steps:

[0012] 1) mixing the prepared LNP with the aforementioned mRNA capable of expressing the GSDM protein family;

[0013] 2) Purifying the mixed product of step 1) to obtain the nucleic acid pharmaceutical composition.

[0014] The present invention also provides the use of the nucleic acid pharmaceutical composition in the preparation of a drug that mediates cell pyroptosis, and has the following beneficial effects:

[0015] In the present invention, the mRNA encoding the GSDM protein family is translated into GSDM protein in vivo with the assistance of an LNP system containing ionizable lipids of a specific structure. The N-terminal domain is released through protease hydrolysis, or directly translated into an N-terminal domain that does not require protease hydrolysis, triggering cell pyroptosis. Pyroptosis can induce cell death, initiate the release of proinflammatory cytokines, activate and recruit immune cells in the body, and then trigger a series of cascade reaction events, further promoting cell death, cytokine release, and activation of immune responses. Compared with commercially available products, the ionizable lipids of the specific structure of the present invention exhibit a more excellent effect in mediating cell pyroptosis, providing a new therapeutic method with clinical translation potential for the field of cell pyroptosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The electron microscope image shows the particle size of the nucleic acid drug of the present invention. DETAILED DESCRIPTION

[0017] The present invention provides a nucleic acid pharmaceutical composition for mediating cell pyroptosis, comprising a compound represented by formula (I) and mRNA capable of expressing the GSDM protein family; the compound represented by formula (I), or a pharmaceutically acceptable salt thereof, or one or more combinations thereof:

[0018]

[0019] R1 is selected from:

[0020] R2 is selected from:

[0021] R3 is:

[0022] R4 is:

[0023] R5 is:

[0024] R6 is:

[0025] R7 is:

[0026] R8 is:

[0027] R9 is selected from:

[0028]

[0029] R 10 Selected from:

[0030]

[0031] R 11 Selected from:

[0032]

[0033] M0, M1, M2, and M3 are independently selected from:

[0034]

[0035] In some specific embodiments, at least two of M0, M1, M2, and M3 are ester bonds.

[0036] In some embodiments, the compound represented by formula (I) is selected from one or more combinations of compounds having the following structures, or pharmaceutically acceptable salts thereof, or isomers thereof:

[0037]

[0038]

[0039]

[0040]

[0041] The compound represented by formula (I) is a lipid whose protonation degree and thus charge properties are affected by pH. Preferably, it is a lipid that is generally almost uncharged under normal neutral physiological pH conditions, but can be positively charged at acidic pH, thereby binding to negatively charged nucleic acids.

[0042] In the present application, the compound represented by formula (I) can be prepared by referring to Chinese invention patent application CN202210344395.1.

[0043] The “isomers” refer to different compounds with the same molecular formula, including but not limited to enantiomers, diastereomers, cis-trans isomers, etc. known in the art.

[0044] The term "pharmaceutically acceptable salt" refers to an acid addition salt or a base addition salt. All compounds of the present invention that exist in the form of a free base or free acid can be converted into their pharmaceutically acceptable salts by treating with an appropriate inorganic or organic base or acid according to methods known to those skilled in the art. Salts of the compounds of the present invention can be formed by converting them into their free base or acid form using standard techniques.

[0045] Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts with amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, citrate, dodecylsulfate, ethanesulfonate, formate, fumarate, gluconoheptate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. The salt derived from suitable base comprises alkali metal salt, alkaline earth metal salt, ammonium salt.Representational alkali metal salt or alkaline earth metal salt comprises sodium salt, lithium salt, potassium salt, calcium salt, magnesium salt etc.In appropriate cases, other pharmaceutically acceptable salt comprises the non-toxic ammonium, quaternary ammonium and amine cation formed using the counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, sulfonate and aryl sulfonate.Other pharmaceutically acceptable salt comprises the salt formed by the quaternization of amine, and this quaternization is carried out using suitable electrophilic reagent (for example, alkyl halide), to form quaternized alkylated amino salt.

[0046] In some specific embodiments, the GSDM protein family gene is selected from one or more of Gasdermin A (GSDMA) gene, Gasdermin B (GSDMB) gene, Gasdermin C (GSDMC) gene, GasderminD (GSDMD) gene, GasderminE (GSDME) gene or DFNB59 gene.

[0047] In some specific embodiments, the mRNA capable of expressing the GSDM protein family is a full-length mRNA capable of expressing GSDM. The nucleotide sequence of the full-length GSDMA gene mRNA is shown in SEQ ID No. 1; the nucleotide sequence of the full-length GSDMB gene mRNA is shown in SEQ ID No. 2; the nucleotide sequence of the full-length GSDMC gene mRNA is shown in SEQ ID No. 3; the nucleotide sequence of the full-length GSDMD gene mRNA is shown in SEQ ID No. 4; the nucleotide sequence of the full-length GSDME gene mRNA is shown in SEQ ID No. 5; and the nucleotide sequence of the full-length DFNB59 gene mRNA is shown in SEQ ID No. 6.

[0048] In some specific embodiments, the mRNA capable of expressing the GSDM protein family is an mRNA capable of expressing an N-terminal domain. The nucleotide sequence of the mRNA expressing the GSDMA N-terminal domain is shown in SEQ ID No. 7; the nucleotide sequence of the mRNA expressing the GSDMB N-terminal domain is shown in SEQ ID No. 8; the nucleotide sequence of the mRNA expressing the GSDMC N-terminal domain is shown in SEQ ID No. 9; the nucleotide sequence of the mRNA expressing the GSDMD N-terminal domain is shown in SEQ ID No. 10; and the nucleotide sequence of the mRNA expressing the GSDME N-terminal domain is shown in SEQ ID No. 11.

[0049] In some specific embodiments, the mRNA of the GSDM protein family gene can also be: a polynucleotide having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence similarity to the nucleotide sequence shown in SEQ ID No. 1-11.

[0050] In some embodiments, the aforementioned mRNA capable of expressing the GSDM protein family comprises entirely unmodified bases, nucleosides or nucleotides.

[0051] In some embodiments, the mRNA of the aforementioned GSDM protein family gene further comprises one or more modified bases, nucleosides, or nucleotides (referred to as "modified mRNA" or "mmRNA"). More specifically, compared to a reference unmodified mRNA, the modified mRNA can have useful properties, including enhanced mRNA stability, reduced degradation, improved translation efficiency, and / or reduced innate immune responses resulting from mRNA introduction. Thus, the use of modified mRNA can not only enhance protein expression efficiency but also reduce immunogenicity.

[0052] In some embodiments, the mRNA expressing the GSDM family of proteins comprises one or more (e.g., 1, 2, 3, or 4) different modified bases, nucleosides, or nucleotides. In some embodiments, the mRNA comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more) different modified bases, nucleosides, or nucleotides. In some embodiments, the modified mRNA can reduce degradation in cells relative to unmodified mRNA.

[0053] In some embodiments, the modified base is a modified uracil. Exemplary bases and nucleosides having modified uracil include, but are not limited to, pseudouridine (ψ), 2-thio-pseudouridine, 5-methoxy-uridine (mo5U), 1-methyl-pseudouridine (m1ψ), N1-methylpseudouridine (m1ψ), 2-thiouridine, and 4'-thiouridine.

[0054] In some embodiments, the modified base is a modified cytosine. Exemplary bases and nucleosides with modified cytosine include, but are not limited to, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-methyl-cytidine (m5C), 5-hydroxymethyl-cytidine (hm5C), and 5-methylcytosine.

[0055] In some embodiments, the modified base is a modified adenine. Exemplary bases and nucleosides having a modified adenine include, but are not limited to, 1-methyl-adenosine (m1A), N6-methyl-adenosine (m6A), N6,N6-dimethyl-adenosine (m62A), N6,2'-O-dimethyl-adenosine (m6Am), and α-thio-adenosine.

[0056] In some embodiments, the modified base is a modified guanine. Exemplary bases and nucleosides with modified guanine include, but are not limited to, inosine (I), α-thio-guanosine, 6-thio-7-deaza-guanosine, 7-methyl-guanosine (m7G), 7-methyl-8-oxo-guanosine.

[0057] In some specific embodiments, the mRNA that can express the GSDM protein family contains pseudouridine (ψ); or, the mRNA that can express the GSDM protein family contains pseudouridine and 5-methyl-cytidine (m5C); or, the mRNA that can express the GSDM protein family contains 1-methyl-pseudouridine (m1ψ); or, the mRNA that can express the GSDM protein family contains 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C); or, the mRNA that can express the GSDM protein family contains 2-thiouridine (s2U); or, the mRNA that can express the GSDM protein family contains 2-thiouridine and 5-methyl-cytidine (m5C); or, The mRNA expressing the GSDM protein family contains 5-methoxy-uridine (mo5U); or, the mRNA expressing the GSDM protein family contains 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C); or, the mRNA expressing the GSDM protein family contains 2'-O-methyluridine; or, the mRNA expressing the GSDM protein family contains 2'-O-methyluridine and 5-methyl-cytidine (m5C); or, the mRNA expressing the GSDM protein family contains N6-methyl-adenosine (m6A); or, the mRNA expressing the GSDM protein family contains N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

[0058] In some embodiments, the mRNA expressing the GSDM family of proteins is uniformly modified (i.e., completely modified, modified throughout the entire sequence) for a specific modification. For example, the mRNA can be uniformly modified with 5-methyl-cytidine (m5C), meaning that all cytosine residues in the mRNA sequence are replaced with 5-methyl-cytidine (m5C). Similarly, the mRNA expressing the GSDM family of proteins can be uniformly modified with any type of base present in the sequence by replacing it with a modified base such as those shown above.

[0059] In some embodiments, the mRNA expressing the GSDM protein family can be modified in the coding region (e.g., an open reading frame encoding a polypeptide). In some embodiments, the mRNA expressing the GSDM protein family can be modified in regions outside the coding region. For example, in some embodiments, a 5'-UTR and / or a 3'-UTR is provided, either or both of which can independently contain one or more different nucleoside modifications. In such embodiments, nucleoside modifications can also be present in the coding region.

[0060] In some specific embodiments, the drug that mediates cell pyroptosis is one or more combinations of tumor drugs, infectious and / or inflammatory disease drugs, nervous system disease drugs, metabolic disease drugs, immune disease drugs, cardiovascular and cerebrovascular disease drugs, and respiratory disease drugs.

[0061] In some embodiments, the drug that mediates cell pyroptosis is an anti-tumor drug.

[0062] In some embodiments, the tumor is selected from one or more combinations of adrenal cortex tumor, bladder urothelial tumor, breast tumor, cervical tumor, bile duct tumor, colon gland tumor, lymphoid tumor, esophageal tumor, glioma, squamous cell tumor, renal cell tumor, hepatocellular tumor, mesothelial cell tumor, ovarian tumor, pancreatic tumor, pheochromocytoma, paraganglioma, prostate tumor, rectal tumor, malignant sarcoma, melanoma, gastric tumor, testicular germ cell tumor, thyroid tumor, thymus tumor, endometrial tumor, myeloproliferative neoplasm, lung tumor, anal tumor, and retinoblastoma;

[0063] The infectious or inflammatory disease includes, but is not limited to, enteritis, mesenteric infarction, sepsis, viral hepatitis or hepatitis caused by other infectious sources, acute kidney injury, renal ischemia, glomerulonephritis, gastric ulcer, acute and chronic pancreatitis, dermatitis, eczema, and psoriasis; the infectious disease includes, but is not limited to, a combination of one or more of bacterial infection, fungal infection, and viral infection. In some embodiments, the infectious disease includes, but is not limited to, a disease caused by one or more of influenza virus, parainfluenza virus, measles virus, mumps virus, herpes virus, adenovirus, respiratory syncytial virus, poliovirus, coxsackie virus, or echovirus.

[0064] The nervous system diseases include, but are not limited to, one or more combinations of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, transient ischemic attack, prenatal cerebral hypoxia, and adult or childhood cerebral hypoxia.

[0065] The metabolic diseases include, but are not limited to, gout, diabetes, diabetes insipidus, glucose intolerance syndrome, obesity, hyperlipidemia, hypothalamic-pituitary axis dysfunction, thyroiditis, abetalipoproteinemia, galactosemia, glycogen disease, and Wilson's disease, or a combination thereof.

[0066] The immune diseases include, but are not limited to, one or more combinations of rheumatoid arthritis, systemic lupus erythematosus, systemic lupus erythematosus nephritis, AIDS, rheumatoid arthritis, inflammatory bowel disease, psoriasis, vasculitis, bronchial asthma, chronic obstructive pulmonary disease, and eosinophilic sinusitis.

[0067] The cardiovascular and cerebrovascular diseases include but are not limited to one or more combinations of stroke, coronary heart disease, atherosclerosis, cardiovascular ischemia, myocardial infarction, ischemic heart disease, chronic or acute heart failure, arrhythmia, tachycardia, and hypertrophic cardiomyopathy.

[0068] The respiratory diseases include, but are not limited to, pneumonia, asthma, chronic obstructive pulmonary disease, chronic bronchitis and emphysema, or a combination of one or more of the group consisting of:

[0069] In some specific embodiments, the drug that mediates cell pyroptosis is a combination of one or more drugs for treating gout, enteritis, sepsis, atherosclerosis, diabetes, Alzheimer's disease, rheumatoid arthritis, systemic lupus erythematosus, lupus nephritis, AIDS, Parkinson's disease, colon cancer, lung cancer, gastric cancer, cervical cancer, esophageal cancer, liver cancer, melanoma, breast cancer, coronary heart disease, stroke, amyotrophic lateral sclerosis, ankylosing spondylitis, asthma, Crohn's disease, and ulcerative colitis.

[0070] The nucleic acid pharmaceutical composition provided by the present invention further comprises any one or more combinations of structural lipids, helper lipids, PEG-lipids, and polymers.

[0071] The structured lipids refer to lipids containing structures that can stabilize the composition, including but not limited to one or more combinations of sterols and their derivatives and non-sterols and their derivatives.

[0072] In some specific embodiments, the structured lipids include, but are not limited to, a combination of one or more of sterols and their derivatives, non-sterols, sitosterol, ergosterol, cholestanone, cholestenone, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, coprosterol, α-tocopherol, or corticosteroids. Sterols are preferably cholesterol and its derivatives; non-limiting examples of cholesterol derivatives include: polar analogs such as 5α-cholestanol, 5α-coprosterol, cholesteryl-(2'-hydroxy) ethyl ether, cholesteryl-(4'-hydroxy) butyl ether, and 6-ketocholesterol; non-polar analogs such as 5α-cholestane, cholesterenone, 5α-cholestenone, and cholesterol decanoate; and mixtures thereof. In a preferred embodiment, the cholesterol derivative is a polar analog, such as cholesteryl-(4'-hydroxy) butyl ether. This is not exhaustive, and the selection of structured lipids is not limited, and any structured lipid can be applied to the present invention.

[0073] In some embodiments, the structured lipid is a combination of one or more of cholesterol, sitosterol, ergosterol, corticosteroids and their derivatives.

[0074] In some embodiments, the structured lipid is cholesterol.

[0075] There is no limitation on the type of the “helper lipid”, and phospholipids are preferred, including but not limited to: a combination of one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, phosphatidylserine, phosphatidylinositol, phosphatidic acid, phosphatidylglycerol, and dimyristoylphosphatidylglycerol.

[0076] In some embodiments, the helper lipid can be selected from the group consisting of: 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPPC), 1,2-di ...oleoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-s ), 1,2-heneicosanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE), dipalmitoylphosphatidylethanolamine (DPPE), 1- Oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-O-hexadecyl-sn-glycero-3-phosphocholine, 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diachidonoyl-sn-glycero-3-phosphocholine, 1,2-docohexanoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl A combination of one or more of acyl-sn-glycero-3-phosphoethanolamine, 1,2-dialinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-docohexanoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), diacetyl-phosphatidylethanolamine (DEPE), stearoyl-phosphatidylethanolamine (SOPE), lysophosphatidylcholine, and sphingomyelin.

[0077] In some embodiments, the phosphatidylcholine is a combination of one or more of DSPC, DPPC, DMPC, DOPC, and POPC.

[0078] In some embodiments, the helper lipid is phosphatidylcholine, specifically DSPC.

[0079] In some embodiments, the helper lipid is phosphatidylethanolamine, specifically DOPE.

[0080] In some specific embodiments, the auxiliary lipid is selected from one or more combinations of DOTAP ((1,2-dioleyloxypropyl)trimethylammonium chloride), DODAP (1,2-dioleoyl-3-dimethylammonium-propane), 18:1PA (1,2-DI (cis-9-octadecenoyl)-SN-glycerol 3-phosphate sodium salt), HS15 (polyethylene glycol (15)-hydroxystearate), and GL67 (N4-arginine cholesterol carbonylamide).

[0081] The PEG-lipid is formed by chemically linking PEG (polyethylene glycol) to lipid molecules, including but not limited to PEG-modified phospholipids and derived lipids, exemplified by one or more combinations of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.

[0082] In some embodiments, the PEG-lipids include but are not limited to PEG-C-DMG, PEG-C-DOMG, PEG-DLPE, PEG-DMPE, PEG-DPPE, PEG-DOPE, PEG-DPPC, AzidoPPCM, PEG-distearoylphosphatidylethanolamine (PEG-DSPE), PEGG-DS, Chol (cholesterol)-PEG, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (PEG-DMG), PEG-S-DMG, PEGylated phosphatidylethanolamine (PEG-PE), PEGylated ceramide , polyethylene glycol-dimethacrylate (PEG-DMA), PEGG distearyl glycerol (PEG glycerol MA), PEGG dipalmitoleyl, PEG dioleyl, PEG distearyl, PEG diacyl glycylamide (PEG amide, A), PEGG dipalmitoyl phosphatidylethanolamine (PEG phosphatidylethanol, PEGG phosphatidyl ethylene dimyristyloxypropyl-3-amine (PEG oxypropyl alcoholamine, 1,2-distearoyloxypropyl-3-amine-N[methoxy(polyethylene glycol)] (PEG-DSA), methoxypolyethylene glycol ditetradecyl acetamide (ALC0159) One or more combinations thereof.

[0083] In some embodiments, the PEG-lipid is PEG-DMG.

[0084] The type of the "polymer" is not limited, and the polymer may include but is not limited to amphiphilic block copolymers, which are block copolymers composed of hydrophobic polymers and hydrophilic compounds, including but not limited to polylactic acid (PLA), polylactic acid-polyglycolic acid copolymer (PLGA), glycolide-lactide copolymer (PLCG), polycaprolactone (PCL), polyorthoesters, polyanhydrides (PAH), polyphosphazenes, poly-β-polyamino esters (PBAE), poly(α-hydroxy acids), lactide / glycolide copolymers (PLGA or PLG) (including lactide / glycolide copolymers, D-lactide / glycolide copolymers, L-lactide / glycolide copolymers and D,L-lactide / glycolide copolymers), polyglycolide (PGA), polyorthoesters (POE), linear or branched polyethylene glycol (PEG), conjugates of poly(α-hydroxy acids), polyaspirins, polyphosphazenes, D-lactide, D,L-lactide-caprolactone, D,L-lactide-glycolide-caprolactone, dextran, vinylpyrrolidone, polyvinyl alcohol (PVA), methacrylate, poly N-isopropylacrylamide), SAIB (sucrose acetate isoate), hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxyethyl methylcellulose, carboxymethyl cellulose or its salt, carboxyvinyl poly, poly (hydroxyethyl methacrylate), poly (methoxyethyl methacrylate), poly (methoxyethoxy-ethyl methacrylate), polymethyl methacrylate (PMMA), methyl methacrylate (MMA), PVA-g-PLGA, PEGT-PBT copolymer, PEO-PPO-PEO (pluronics), PEO-PPO-PAA copolymer, PLGA-PEO-PLGA, PEG-PLG, PLA-PLGA, poloxamer 407, PEG-PLGA-PEG triblock copolymer, or block copolymers thereof with polyethylene glycol (PEG), or a combination of one or more of the above polymers or copolymers.

[0085] In certain embodiments of the present invention, the weight average molecular weight of PEG in the PEG-lipid is 1000-10000, for example, 1000-2000, 2000-4000, 4000-6000, 6000-8000, 8000-10000, preferably 2000.

[0086] In some specific embodiments, the nucleic acid pharmaceutical composition comprises 20-65% ionizable lipid compound, 20-60% structural lipid, 3-40% auxiliary lipid, and 0.1-10% PEG-lipid, where % refers to molar percentage.

[0087] In some specific embodiments, the nucleic acid pharmaceutical composition comprises 35-49% ionizable lipid compound, 35-50% structural lipid, 5-20% helper lipid, and 1-2% PEG-lipid, where % refers to molar percentage.

[0088] In certain embodiments of the present invention, the molar ratio of N atoms in the nucleic acid drug composition to P atoms in the mRNA drug is (1-20):1, for example, it can be (3-15):1, (3-10):1, (5-10):1, or (5-8):1.

[0089] Further preferably, the nucleic acid pharmaceutical composition of the present invention further comprises a pharmaceutically acceptable excipient. Typically, these substances can be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 4-8, preferably about 5-7, although the pH value may vary with the properties of the formulated substance and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intravenous injection, intravenous drip, subcutaneous injection, local injection, intramuscular injection, intratumor injection, intraperitoneal injection (such as intraperitoneal), intracranial injection, intracavitary injection, inhalation administration, implantation administration, etc.

[0090] "Pharmaceutically acceptable" means that the drugs do not produce adverse, allergic or other untoward reactions when properly administered to animals or humans.

[0091] "Pharmaceutically acceptable excipients" should be compatible with the active ingredient, that is, they can be mixed with it without significantly reducing the effect of the drug under normal circumstances. Specific examples of some substances that can be used as pharmaceutically acceptable excipients can be sugars, such as glucose, mannitol, sucrose, lactose, trehalose, maltose, etc.; starches, such as corn starch and potato starch, etc.; cellulose and its derivatives, such as sodium methylcellulose, ethyl cellulose and methylcellulose, etc.; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate, etc.; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter, etc.; alcohols, such as ethanol, propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol, etc.; alginic acid; emulsifiers, such as Tween, etc.; wetting agents, such as sodium lauryl sulfate, etc.; surfactants; freeze-drying protectants; colorants; flavorings; tableting agents; stabilizers; diluents; excipients; antioxidants; preservatives; pyrogen-free water; isotonic saline solution; buffer solution, etc., and combinations thereof. These substances are used as needed to improve the stability of the formulation or to help increase the activity or its bioavailability or to produce an acceptable taste or flavor in the case of oral administration.

[0092] The nucleic acid pharmaceutical composition of the present invention can be prepared into an inhalable atomized formulation (such as a dry powder formulation, an aerosol formulation, an inhaled mist droplet formulation, etc.), an implantable gel formulation, a microneedle formulation, or an injection form, for example, using physiological saline or an aqueous solution containing glucose and other adjuvants by conventional methods. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount, for example, about 10 μg / kg body weight to about 50 mg / kg body weight per day.

[0093] In addition, the nucleic acid pharmaceutical composition described in the present invention can also be used in combination with other therapeutic agents, including but not limited to anti-CTLA4 antibodies or antigen-binding fragments thereof, anti-PD-1 antibodies or antigen-binding fragments thereof, anti-PD-L1 antibodies or antigen-binding fragments thereof, and combinations thereof.

[0094] The present invention also provides a method for treating a disease, comprising administering the aforementioned nucleic acid pharmaceutical composition to a patient.

[0095] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0096] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0097] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. Except for the specific method, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any method, equipment, and material of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention. Equipment, materials, etc. used in the present invention are all commercially available sources unless otherwise specified.

[0098] The sequence information used in this application is as follows:

[0099] SEQ ID No.1: GSDMA full-length nucleotide sequence:

[0100]

[0101] SEQ ID No.2: GSDMB full-length nucleotide sequence:

[0102]

[0103] SEQ ID No.3: GSDMC full-length nucleotide sequence:

[0104]

[0105] SEQ ID No.4: GSDMD full-length nucleotide sequence:

[0106]

[0107] SEQ ID No.5: GSDME full-length nucleotide sequence:

[0108]

[0109] SEQ ID No.6: DFNB59 full-length nucleotide sequence:

[0110]

[0111] SEQ ID No.7: Nucleotide sequence of the N-terminal domain of GSDMA:

[0112] ATGACCATGTTTGAAAATGTCACCCGGGCCCTGGCCAGACAGCTAAACCCTCGAGGGGACCTGACACCACTTGACAGCCTCATCGACTTCAAGCGCTTCCATCCCTTCTGCCTGGTGCTGAGGAAGAGGAAGAGCACGCTCTTCTGGGGGGCCCGGTACGTCCGCACCGACTACACGCTGCTGGATGTGCTTGAGCCCGGCAGCTCACCTTCAGACCCAACAGACACTGGGAATTTTGGCTTTAAGAATATGCTGGACACCCGAGTGGAGGGAGATGTGGATGTACCAAAGACGGTGAAGGTGAAGGGAACGGCAGGGCTCTCGCAGAACAGCACTCTGGAGGTCCAGACACTCAGTGTGGCTCCCAAGGCCCTGGAGACCGTGCAGGAGAGGAAGCTGGCAGCAGACCACCCATTCCTGAAGGAGATGCAAGATCAAGGGGAGAACCTGTATGTGGTGATGGAGGTGGTGGAGACGGTGCAGGAGGTCACACTGGAGCGAGCCGGCAAGGCAGAGGCCTGCTTCTCCCTCCCCTTCTTCGCCCCATTGGGGCTACAGGGATCCATAAATCACAAGGAGGCTGTAACCATCCCCAAGGGCTGCGTCCTGGCCTTTCGAGTGAGACAGCTGATGGTCAAAGGCAAAGATGAGTGGGATATTCCACATATCTGCAATGATAACATGCAAACCTTCCCTCCTGGAGAAAAGTCAGGAGAGGAGAAGGTCATCCTTATCCAG

[0113] SEQ ID No.8: Nucleotide sequence of the N-terminal domain of GSDMB:

[0114] ATGTTCAGCGTATTTGAGGAAATCACAAGAATTGTAGTTAAGGAGATGGATGCTGGAGGGGATATGATTGCCGTTAGAAGCCTTGTTGATGCTGATAGATTCCGCTGCTTCCATCTGGTGGGGGAGAAGAGAACTTTCTTTGGATGCCGGCACTACACAACAGGCCTCACCCTGATGGACATTCTGGACACAGATGGGGACAAGTGGTTAGATGAACTGGATTCTGGGCTCCAAGGTCAAAAGGCTGAGTTTCAAATTCTGGATAATGTAGACTCAACGGGAGAGTTGATAGTGAGATTACCCAAAGAAATAACAATTTCAGGCAGTTTCCAGGGCTTCCACCATCAGAAAATCAAGATATCGGAGAACCGGATATCCCAGCAGTATCTGGCTACCCTTGAAAACAGGAAGCTGAAGAGGGAACTACCCTTTTCATTCCGATCAATTAATACGAGAGAAAACCTGTATCTGGTGACAGAAACTCTGGAGACGGTAAAGGAGGAAACCCTGAAAAGCGACCGGCAATATAAATTTTGGAGCCAGATCTCTCAGGGCCATCTCAGCTATAAACACAAGGGCCAAAGGGAAGTGACCATCCCCCCAAATCGGGTCCTGAGCTATCGAGTAAAGCAGCTTGTCTTCCCCAACAAGGAGACGATGAAGAAGGATGGTGCTTCATCCTGTTTAGGAAAGTCTTTGGGTTCGGAGGATTCCAGAAACATGAAGGAGAAG

[0115] SEQ ID No.9: Nucleotide sequence of the N-terminal domain of GSDMC

[0116] ATGCCCTCCATGTTGGAACGCATTAGCAAAAATTTGGTCAAAGAGATTGGAAGCAAAGACCTGACACCTGTCAAATACCTATTGAGTGCCACCAAATTACGTCAGTTTGTTATATTACGAAAGAAGAAGGATTCTCGTTCATCATTTTGGGAACAATCTGACTATGTTCCAGTTGAATTCTCCCTCAATGACATCCTGGAGCCAAGTTCTTCAGTCCTAGAAACTGTTGTGACAGGACCGTTCCACTTCAGTGACATTATGATCCAGAAGCATAAGGCTGACATGGGTGTGAATGTTGGTATAGAAGTGAGTGTGTCAGGGGAGGCCTCTGTGGACCATGGATGCTCCCTCGAGTTTCAAATTGTTACCATCCCATCACCAAACCTGGAAGACTTTCAAAAAAGGAAACTGTTGGATCCAGAGCCATCATTTCTGAAGGAGTGCCGGAGGAGAGGGGACAACCTGTACGTGGTGACAGAGGCTGTTGAACTGATCAACAATACTGTGCTGTACGATAGCAGTAGTGTGAATATTTTAGGGAAAATTGCTCTTTGGATTACCTATGGCAAGGGTCAAGGCCAAGGAGAGAGTCTCAGAGTGAAGAAGAAGGCGCTGACTCTTCAGAAAGGCATGGTGATGGCTTATAAGAGAAAGCAGCTGGTTATCAAGGAGAAAGCCATTCTCATCTCAGATGATGATGAACAGAGAACCTTTCAAGATGAGTACGAAATTTCCGAAATGGTAGGCTACTGTGCTGCGAGGAGTGAGGGG

[0117] SEQ ID No.10: Nucleotide sequence of the N-terminal domain of GSDMD:

[0118] ATGGGGTCGGCCTTTGAGCGGGTAGTCCGGAGAGTGGTCCAGGAGCTGGACCATGGTGGGGAGTTCATCCCTGTGACCAGCCTGCAGAGCTCCACTGGCTTCCAGCCCTACTGCCTGGTGGTTAGGAAGCCCTCAAGCTCATGGTTCTGGAAACCCCGTTATAAGTGTGTCAACCTGTCTATCAAGGACATCCTGGAGCCGGATGCCGCGGAACCAGACGTGCAGCGTGGCAGGAGCTTCCACTTCTACGATGCCATGGATGGGCAGATACAGGGCAGCGTGGAGCTGGCAGCCCCAGGACAGGCAAAGATCGCAGGCGGGGCCGCGGTGTCTGACAGCTCCAGCACCTCAATGAATGTGTACTCGCTGAGTGTGGACCCTAACACCTGGCAGACTCTGCTCCATGAGAGGCACCTGCGGCAGCCAGAACACAAAGTCCTGCAGCAGCTGCGCAGCCGCGGGGACAACGTGTACGTGGTGACTGAGGTGCTGCAGACACAGAAGGAGGTGGAAGTCACGCGCACCCACAAGCGGGAGGGCTCGGGCCGGTTTTCCCTGCCCGGAGCCACGTGCTTGCAGGGTGAGGGCCAGGGCCATCTGAGCCAGAAGAAGACGGTCACCATCCCCTCAGGCAGCACCCTCGCATTCCGGGTGGCCCAGCTGGTTATTGACTCTGACTTGGACGTCCTTCTCTTCCCGGATAAGAAGCAGAGGACCTTCCAGCCACCCGCGACAGGCCACAAGCGTTCCACGAGCGAAGGCGCCTGGCCACAGCTGCCCTCTGGCCTCTCCATGATGAGGTGCCTCCACAACTTCCTGACAGAT

[0119] SEQ ID No.11: Nucleotide sequence of the N-terminal domain of GSDME:

[0120] ATGTTTGCCAAAGCAACCAGGAATTTTCTTAGAGAAGTTGATGCTGATGGTGACCTGATTGCAGTATCAAATCTGAATGACTCTGATAAGTTACAGCTTCTAAGTCTGGTGACAAAAAAGAAGAGATTCTGGTGCTGGCAGAGACCCAAGTACCAGTTTTTATCCCTCACCCTTGGCGATGTACTCATAGAAGACCAATTTCCGAGTCCAGTGGTCGTGGAGTCGGACTTTGTGAAATACGAGGGCAAGTTTGCAAACCACGTGAGTGGAACCCTGGAGACTGCACTGGGGAAGGTCAAGCTGAACCTGGGGGGCAGCAGCCGCGTAGAGAGCCAGTCTTCATTTGGAACCCTGAGGAAGCAGGAGGTGGATTTGCAGCAGCTCATCAGAGACTCTGCCGAGAGAACAATAAATCTGAGAAACCCTGTGCTCCAGCAGGTGCTGGAAGGAAGGAATGAGGTCCTGTGCGTTTTGACACAGAAGATCACGACGATGCAGAAGTGTGTGATCTCTGAGCACATGCAGGTCGAGGAGAAGTGTGGTGGCATCGTGGGCATCCAGACCAAGACGGTGCAGGTGTCAGCGACGGAGGATGGGAATGTCACCAAGGACTCCAACGTGGTGCTGGAGATCCCAGCTGCCACCACCATTGCCTACGGTGTCATTGAGTTATACGTGAAACTGGACGGCCAGTTCGAGTTCTGCCTTCTCCGAGGGAAGCAAGGTGGCTTCGAGAACAAGAAGAGAATTGACTCTGTCTACCTGGACCCCCTGGTCTTTCGAGAGTTTGCATTCATAGACATGCCAGAT

[0121] SEQ ID No.12: T7 promoter:

[0122] TAATACGACTCACTATA

[0123] SEQ ID No.13: 5‘UTR:

[0124] AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

[0125] SEQ ID No.14: 3’UTR:

[0126] CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0127] SEQ ID No.15: PolyA:

[0128] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0129] SEQ ID No.16: pVAX1 vector sequence:

[0130]

[0131] Example 1 Preparation of mRNA capable of expressing the GSDM protein family

[0132] The in vitro transcribed mRNA sequence (including the T7 promoter (SEQ ID No. 12), 5' UTR (SEQ ID No. 13), GSDM-N-terminal coding sequence (SEQ ID No. 7-SEQ ID No. 11), 3' UTR (SEQ ID No. 14), and Poly(A) (SEQ ID No. 15)) was cloned into the pVAX1 (SEQ ID No. 16) vector by gene synthesis, and the sequence accuracy was confirmed by sequencing. The plasmid template was then linearized through transformation, E. coli fermentation, plasmid extraction, and digestion with the restriction endonuclease BsaI. Subsequently, under the action of T7 RNA polymerase (Thermo Fisher, EP0111), the in vitro transcription synthesis reaction was completed using a GAG cap analog (TriLink, N-7113-100) and 100% N1M-pseudouridine-5'-triphosphate (TriLink, N-1081-100). The prepared 100 μL IVT reaction solution (GTP 5 mM, CTP 5 mM, ATP 5 mM, N1MUTP 5 mM, GAG 4 mM, 1X transcription buffer, 1 ug plasmid template, T7 RNA polymerase 2.5 U / uL) was placed in a PCR instrument, and the temperature was set to 37°C and the time was set to 3 h. After the IVT reaction was completed, 5 μL DNase I was added, and the instrument was placed again in the PCR instrument, and the temperature was set to 37°C and the time was set to 15 min. After the DNase I digestion reaction was completed, the mRNA was recovered using an RNA purification kit, and the mRNA sample was eluted with 500 μL DNase / RNase-free purified water. The concentration of the purified and recovered mRNA samples was measured using a Nano Drop assay to determine the IVT yield, ultimately yielding mRNA expressing the GSDM-N terminus. The synthesized mRNA was stored at -80°C for future use.

[0133] Example 2 Preparation of Nucleic Acid Drugs

[0134] The prepared ionizable lipid compounds D1-D2 (wherein D1 is compound H7, D2 is compound H15) and commercially available D3-D4 (wherein D3 is commercially available, CAS number: 2832061-33-1; D4 is commercially available MC3, CAS number: 1224606-06-7) were prepared according to the formula and preparation method of mRNA-LNP in Chinese Patent 202210344395.1 (Experiment 1) and combined with the following parameters: the mass ratio of LNP to mRNA was 10:1 to 30:1; the mRNA was diluted to 0.2 mg / mL using citrate or sodium acetate buffer (pH = 3 or 5); the above-mentioned ionizable lipid ethanol solution and the mRNA solution were thoroughly mixed in a volume ratio of 1:5 to 1:1; the obtained nanoparticles were purified by ultrafiltration and dialysis; and filtered and sterilized to prepare an mRNA-LNP composition encapsulating the GSDM BN end.

[0135] like Figure 1 As shown, the average particle size of the nucleic acid drug is 80-110 nm, and the encapsulation efficiency is above 85%.

[0136] Example 3 Comparative Experiments on Cell Pyroptosis Mediated by Different Nucleic Acid Drugs

[0137] The experimental steps for nucleic acid drug-mediated cell pyroptosis are as follows:

[0138] 1) Lactate Dehydrogenase Assessment: Four tumor cell lines (HEK 293, Hela, 4T1, and B16F10-Luc) were cultured in a 37°C, 5% CO2 incubator in DMEM medium supplemented with 10% FBS, 100 U / mL penicillin, and 100 mg / mL streptomycin. The four different tumor cells were seeded in 12-well plates. After cell attachment, the cells were treated with PBS (control), GSDMBN mRNA@D1-LNP (Group D1), GSDM BN mRNA@D2-LNP (Group D2), GSDM BN mRNA@D3-LNP (Group D3), and GSDM BN mRNA@D4-LNP (Group D4), respectively. Each LNP was loaded with 250 ng of mRNA. The supernatant was collected after 24 hours of treatment, and the release of lactate dehydrogenase (LDH) was measured using a lactate dehydrogenase (LDH) quantitative detection kit to evaluate the pyroptosis of tumor cells mediated by nucleic acid drugs, namely GSDM BN mRNA@LNPs.

[0139] 2) Cell apoptosis assessment method: Cells seeded in 12-well plates were washed twice with Annexin V binding buffer and stained using a FITC-labeled Annexin V cell detection kit with PI. The cells were then analyzed by flow cytometry.

[0140] Annexin V / PI double staining is a classic method for detecting apoptosis. However, when pyroptosis occurs, pores form in the cell membrane, exposing the inner side of the cell membrane to the external environment. This allows Annexin V to bind to phosphatidylserine exposed on the outer side of the cell, resulting in a positive result after Annexin V staining. Furthermore, pyroptosis also reveals features similar to apoptosis, such as nuclear condensation, chromatin condensation, and DNA fragmentation. Therefore, PI staining can also detect pyroptotic cells and result in a positive result. Therefore, Annexin V / PI double staining can be used to analyze pyroptosis.

[0141] 3) Cytokine release assessment: B16F10 cells were seeded in a 12-well plate and treated with PBS (control), GSDM BN mRNA@D1-LNP, GSDM BN mRNA@D2-LNP, GSDM BN mRNA@D3-LNP, and GSDM BN mRNA@D4-LNP. Each group of LNPs was loaded with 250 ng of mRNA. After 48 h of treatment, the cell supernatants were collected and the expression levels of the proinflammatory cytokines IFN-γ, IL-1β, and TNF-α in the supernatants were detected using ELISA kits (Thermo Fisher).

[0142] The experimental results of the above three methods for evaluating nucleic acid drug-mediated cell pyroptosis are shown in Tables 1, 2, and 3:

[0143] Table 1

[0144]

[0145] Table 2

[0146]

[0147]

[0148] Table 3

[0149]

[0150] As can be seen from Table 1, when the lactate dehydrogenase (LDH) release assay was used to evaluate the killing effect of GSDM BN mRNA@LNPs on four tumor cells, compared with the control, GSDM BN mRNA@LNPs treatment resulted in a significant increase in the cell death rate of HEK 293, HeLa, 4T1 and B16F10 cells, especially GSDM BN mRNA@D2-LNP showed a higher killing rate for all four cells, which were 58%, 55%, 40% and 30%, respectively. Compared with LNPs prepared from commercially available ionizable lipids D3 and D4, the GSDM BN mRNA@D1-LNP and GSDM BN mRNA@D2-LNP provided in this application can more efficiently mediate cell pyroptosis.

[0151] As can be seen from Table 2, when the annexin V / propidium iodide (PI) reagent was used to quantitatively analyze the killing effect of GSDM BN mRNA@LNPs on tumor cells, after treatment with GSDM BN mRNA@LNPs for 24 hours, all groups of GSDM BN mRNA@LNPs could induce apoptosis of tumor cells. Under the same treatment time and dosage conditions, after treatment with GSDM BN mRNA@D2-LNP, approximately 50%, 43%, 40% and 30% of HEK 293, HeLa, 4T1 and B16F10 cells underwent late apoptosis, confirming that GSDMBN mRNA@D2-LNP has a stronger tumor killing effect.

[0152] As shown in Table 3, when the cytokine release evaluation method was used, compared with the PBS group (control), GSDM BN mRNA@LNPs treatment significantly increased the expression levels of IFN-γ, IL-1β and TNF-α, especially GSDM BN mRNA@D2-LNP, which had an excellent effect. Compared with the control group, the release of pro-inflammatory cytokines was 4, 11.3 and 12.7 times that of the control group, respectively.

[0153] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A nucleic acid pharmaceutical composition for mediating cell pyroptosis, comprising a compound represented by formula (I), or a pharmaceutically acceptable salt thereof, or any one or more combinations of isomers thereof, and mRNA encoding a GSDM protein family; the compound represented by formula (I) is as follows: The R 1 for: The R 2 Selected from: The R 3 for: The R 4 for: The R 5 for: The R 6 for: The R 7 for: The R 8 for: The R 9 Selected from: The R 10 Selected from: The R 11 Selected from: The M 0 、The M 1 、The M 2 、The M 3 Independently selected from:

2. The nucleic acid pharmaceutical composition according to claim 1, It is characterized in that In the compound structure represented by the formula (I), M 0 、M 1 、M 2 、M 3 At least two are ester bonds.

3. The nucleic acid pharmaceutical composition according to claim 1, It is characterized in that The compound represented by formula (I) is selected from the following compounds, or one or more combinations thereof, or pharmaceutically acceptable salts thereof, or isomers thereof:

4. The nucleic acid pharmaceutical composition according to claim 1, Features The GSDM protein family mRNA is selected from one or more of the full-length mRNAs that can express GSDM in the GSDMA gene, GSDMB gene, GSDMC gene, GSDMD gene, GSDME gene or DFNB59 gene; and / or, the GSDM protein family mRNA is selected from one or more of the mRNAs that can express the N-terminal domain in the GSDMA gene, GSDMB gene, GSDMC gene, GSDMD gene, GSDME gene; preferably, the full-length mRNA nucleotide sequence is as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 SEQ ID No.4, SEQ ID No.5, and SEQ ID No.6; the mRNA nucleotide sequence of the N-terminal domain is as shown in SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, and SEQ ID No.

11.

5. The nucleic acid pharmaceutical composition according to claim 1, It is characterized in that The nucleic acid pharmaceutical composition further comprises any one or more combinations of structural lipids, auxiliary lipids, PEG-lipids, and polymers.

6. The nucleic acid pharmaceutical composition according to claim 5, It is characterized in that The nucleic acid pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

7. The nucleic acid pharmaceutical composition according to claim 5, It is characterized in that The structural lipid is selected from a combination of one or more of sterols, non-sterols or their respective derivatives; and / or the auxiliary lipid is selected from a combination of one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, phosphatidylserine, phosphatidylinositol, phosphatidic acid, phosphatidylglycerol, dimyristoylphosphatidylglycerol, DOTAP, DODAP, 18:1PA, HS15, and GL67; and / or the PEG-lipid is selected from a combination of one or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and methoxypolyethylene glycol ditetradecylacetamide.

8. The nucleic acid pharmaceutical composition according to claim 5, It is characterized in that The molar ratio of the ionizable lipid compound: auxiliary lipid: structural lipid: PEG-lipid is (20-65): (3-40): (20-60): (0.1-10).

9. Use of the nucleic acid pharmaceutical composition according to any one of claims 1 to 8 in the preparation of a drug for mediating cell pyroptosis, It is characterized in that The drug that mediates cell pyroptosis is one or more combinations of tumor drugs, infectious and / or inflammatory disease drugs, nervous system disease drugs, metabolic disease drugs, immune disease drugs, cardiovascular and cerebrovascular disease drugs, and respiratory disease drugs.

10. Use of the nucleic acid pharmaceutical composition according to claim 9, It is characterized in that The tumor is selected from one or more combinations of adrenal cortical tumors, bladder urothelial tumors, breast tumors, cervical tumors, bile duct tumors, colon gland tumors, colon tumors, lymphoid tumors, esophageal tumors, gliomas, squamous cell tumors, renal cell tumors, hepatocellular tumors, mesothelial cell tumors, ovarian tumors, pancreatic tumors, pheochromocytomas, paragangliomas, prostate tumors, rectal tumors, malignant sarcomas, melanomas, gastric tumors, testicular germ cell tumors, thyroid tumors, thymic tumors, endometrial tumors, myeloproliferative tumors, lung tumors, anal tumors, and retinoblastomas; and / or, the drug that mediates cell pyroptosis is a combination of one or more drugs for treating gout, enteritis, sepsis, atherosclerosis, diabetes, Alzheimer's disease, rheumatoid arthritis, systemic lupus erythematosus, lupus nephritis, AIDS, Parkinson's disease, coronary heart disease, stroke, amyotrophic lateral sclerosis, ankylosing spondylitis, asthma, and Crohn's disease; preferably, the drug that mediates cell pyroptosis is a tumor drug.

Images