Engineered escherichia coli strain as well as preparation method and application thereof

Abstract

The invention provides an engineered escherichia coli strain as well as a preparation method and application thereof. The recF and / or recJ protein of the engineered Escherichia coli strain is low-expressed or non-expressed, or the recF and / or recJ protein with deletion or inactivity is expressed, and furthermore, the recE protein of the engineered Escherichia coli strain is low-expressed or non-expressed, or the recE protein with deletion or inactivity is expressed. According to the invention, the stability of the plasmid containing the polyA sequence prepared by escherichia coli can be improved.

Description

Technical Field

[0001] The present invention relates to an engineered Escherichia coli strain, a preparation method and application thereof, and more specifically, to an engineered Escherichia coli strain capable of improving the stability of plasmid production, a preparation method thereof and application thereof in preparing plasmids containing tandem repeat sequences such as polyA sequences. Background Art

[0002] E. coli fermentation is currently the primary method for plasmid production. When homologous fragments are present on the plasmid, homologous recombination often occurs, resulting in the loss of some fragments or the insertion of additional fragments. To prevent homologous recombination, recA, the primary homologous recombination enzyme in E. coli, is often deleted. Conventional E. coli strains used for plasmid production, such as DH5α, JM109, TOP10, and stbl2, all contain recA defects.

[0003] The rapid development of gene therapy and nucleic acid vaccines has led to higher demands for plasmid stability. In the mRNA field, to increase mRNA translation, a longer polyA sequence is added to its 3' end. To ensure the consistency of the polyA sequence, the polyA sequence is typically constructed onto the plasmid DNA template. PolyA is a simple tandem repeat sequence. In Escherichia coli, simple tandem repeat sequences often experience deletions or additions, but the specific mechanisms are currently unclear. Possible mechanisms include homologous recombination, slippage of DNA polymerase during DNA replication, and DNA mismatch repair.

[0004] When using conventional recA-deficient E. coli, such as DH5α, to generate plasmids containing long polyA, polyA deletion is very serious. This shows that polyA deletion is not dependent on recA and there are other unknown pathways.

[0005] To ensure the stability of polyA, the current technical means mainly focus on plasmid modification, such as the use of the linear plasmid pVEL (A.E.Grier, S.Burleigh, J.Sahni, et al. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences. Molecular Therapy-Nucleic Acids. 2016, 5: e306.), but this method has low plasmid yields and is not currently widely used. The more widely used method is to insert other base sequences in the middle of polyA to avoid excessively long polyA sequences, but after long fermentation periods, a small amount of polyA deletions will still occur, and the range of polyA sequences that can be selected is also limited.

[0006] CN115461463A discloses a genetically modified Escherichia coli strain that can increase the stability of polyA. The modification method is to knock out the sbcC and / or sbcD genes related to DNA repair in Escherichia coli. However, the literature (X. Pan, DRLeach, The roles of mutS, sbcCD and recA in the propagation of TGG repeats in Escherichia coli, Nucl. Acids Res. 28 (2000) 3178–3184) reported that knocking out sbcC and sbcD on top of recA had no effect on the (TGG)24 tandem repeat sequence.

[0007] There is currently no E. coli strain on the market that can clearly guarantee the stability of plasmid polyA. Summary of the Invention

[0008] One object of the present invention is to provide an engineered Escherichia coli strain.

[0009] Another object of the present invention is to provide the use of the engineered Escherichia coli strain in producing plasmids.

[0010] Another object of the present invention is to provide a method for preparing a plasmid using the engineered Escherichia coli strain.

[0011] In order to increase the stability of E. coli production plasmids, especially those containing tandem repeat sequences such as polyA sequences, the present invention genetically modifies E. coli for both homologous recombination and DNA mismatch repair. For homologous recombination, the present invention selects rarA, recE, recF, recO, recR, and recJ as targets for modification. For DNA mismatch repair, the present invention selects DNA polymerase II and DNA polymerase V involved in DNA error repair in E. coli as targets for modification. The modification target of the present invention is to make the target gene not expressed, express a missing or inactive protein. The modification method can be point mutation, deletion of part or the entire ORF reading frame, etc.

[0012] In one aspect, the present invention provides an engineered Escherichia coli strain having low expression or no expression, or expression of missing or inactive proteins of one or more of the following proteins: rarA, recE, recF, recO, recR, recJ.

[0013] According to a preferred embodiment of the present invention, the engineered Escherichia coli strain of the present invention has low expression or no expression of recF and / or recJ proteins, or expresses deleted or inactive recF and / or recJ proteins.

[0014] According to a specific embodiment of the present invention, the coding sequence of recF and / or recJ in the genome of the engineered Escherichia coli strain of the present invention is completely or partially truncated or mutated, so that the strain recF and / or recJ protein is lowly expressed or not expressed, or expresses missing or inactive recF and / or recJ protein.

[0015] According to a specific embodiment of the present invention, the engineered Escherichia coli strain of the present invention further has low expression or no expression of recE protein, or expresses a missing or inactive recE protein.

[0016] According to a specific embodiment of the present invention, the engineered Escherichia coli strain of the present invention further has low or no expression of DNA polymerase V, or expresses a missing or inactive DNA polymerase V.

[0017] According to a specific embodiment of the present invention, the engineered Escherichia coli strain of the present invention further has non-defective expression of DNA polymerase II.

[0018] According to a specific embodiment of the present invention, the engineered Escherichia coli strain of the present invention is an engineered DH5α or stbl2 strain.

[0019] On the other hand, the present invention also provides a method for preparing the engineered Escherichia coli strain, which comprises:

[0020] By adopting point mutation or deletion of part or the entire ORF reading frame, the protein of the E. coli strain is lowly expressed or not expressed, or the protein is expressed but is missing or inactive.

[0021] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or the entire ORF reading frame of its rarA, recE, recF, recO, recR or recJ gene is knocked out respectively, so that the strain does not express the corresponding protein, thereby preparing the engineered strains Stbl2-ΔrarA, Stbl2-ΔrecE, Stbl2-ΔrecF, Stbl2-ΔrecJ, Stbl2-ΔrecO, and Stbl2-ΔrecR.

[0022] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or all of the ORF reading frames of its recF and recJ genes are knocked out, so that the strain does not express the corresponding recF and recJ proteins, thereby preparing the engineered strain Stbl2-ΔrecFΔrecJ.

[0023] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or all of the ORF reading frames of its recE and recF genes are knocked out, so that the strain does not express the corresponding recE and recF proteins, thereby preparing the engineered strain Stbl2-ΔrecEΔrecF.

[0024] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or all of the ORF reading frames of its recE, recF and recJ genes are knocked out, so that the strain does not express the corresponding recE, recF and recJ proteins, and the engineered strain Stbl2-ΔrecEΔrecFΔrecJ is prepared.

[0025] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or all of the ORF reading frames of its recE, recF and rarA genes are knocked out, so that the strain does not express the corresponding recE, recF and rarA proteins, and the engineered strain Stbl2-ΔrecEΔrecFΔrarA is prepared.

[0026] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or all of the ORF reading frames of its recE, recF and DNA polymerase pol V genes are knocked out, so that the strain does not express the corresponding recE, recF proteins and DNA polymerase pol V, thereby preparing the engineered strain Stbl2-ΔrecEΔrecFΔpolⅤ.

[0027] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or all of the ORF reading frames of its recE, recF and DNA polymerase pol II genes are knocked out, so that the strain does not express the corresponding recE, recF proteins and DNA polymerase pol II, thereby preparing the engineered strain Stbl2-ΔrecEΔrecFΔpol II.

[0028] In some specific embodiments of the present invention, the present invention is based on Escherichia coli stbl2, and part or the entire ORF reading frame of its recE, recF, DNA polymerase pol V and DNA polymerase pol II genes is knocked out, so that the strain does not express the corresponding recE, recF proteins, DNA polymerase pol V and DNA polymerase pol II, and the engineered strain Stbl2-ΔrecEΔrecFΔpolⅤΔpolⅡ is prepared.

[0029] In some specific embodiments of the present invention, the present invention is based on Escherichia coli DH5α, and knocks out part or all of the ORF reading frame of its recF gene, so that the strain does not express the corresponding recF protein, thereby preparing the engineered strain DH5α-ΔrecF.

[0030] In some specific embodiments of the present invention, the present invention is based on Escherichia coli DH5α, and knocks out part or all of the ORF reading frame of its recJ gene, so that the strain does not express the corresponding recJ protein, thereby preparing the engineered strain DH5α-ΔrecJ.

[0031] In some specific embodiments of the present invention, the present invention is based on Escherichia coli DH5α, and knocks out part or all of the ORF reading frames of its recF and recJ genes, so that the strain does not express the corresponding recF and recJ proteins, thereby preparing the engineered strain DH5α-ΔrecFΔrecJ.

[0032] On the other hand, the present invention also provides the use of the engineered Escherichia coli strain in producing plasmids.

[0033] According to a specific embodiment of the present invention, the plasmid is a plasmid containing a tandem repeat sequence. Preferably, the tandem repeat sequence is a simple tandem repeat sequence, for example, a repeating sequence formed by connecting a relatively constant short sequence of one or more bases (e.g., 1-6 nt) as a repeating unit, end to end, in tandem. In some specific embodiments of the present invention, the tandem repeat sequence includes but is not limited to a polyA sequence.

[0034] On the other hand, the present invention also provides a method for preparing a plasmid, in particular a plasmid containing a tandem repeat sequence (e.g., a polyA sequence), the method comprising:

[0035] The engineered Escherichia coli strain of the present invention is used to ferment and prepare a plasmid containing a tandem repeat sequence (eg, a polyA sequence).

[0036] In some specific embodiments of the present invention, the tandem repeat sequence is a polyA sequence. Preferably, the polyA sequence contains at least 12 nt, at least 24 nt, at least 36 nt, or at least 48 nt of A bases and 0-24 nt or 0-12 nt of non-A bases. According to a preferred embodiment of the present invention, the full length of the polyA sequence is 24 nt to 144 nt, more preferably 90 nt to 120 nt.

[0037] In some specific embodiments of the present invention, in the method for preparing a plasmid of the present invention, the fermentation conditions are: culturing at 28-32° C. for 12 h to 72 h.

[0038] The engineered Escherichia coli strains of the present invention ferment and produce plasmids containing tandem repeat sequences, and have a certain degree of plasmid production stability. In some specific embodiments of the present invention, the engineered Escherichia coli strains of the present invention, Stbl2-ΔrarA, Stbl2-ΔrecF, Stbl2-ΔrecJ, Stbl2-ΔrecR, Stbl2-ΔrecFΔrecJ, Stbl2-ΔrecEΔrecF, Stbl2-ΔrecEΔrecFΔrecJ, Stbl2-ΔrecEΔrecFΔpolV, DH5α-ΔrecF, DH5α-ΔrecJ, and DH5α-ΔrecFΔrecJ, can all improve plasmid production stability to a certain extent. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The results of the rarA knockout experiment are shown in Figure 5.

[0040] Figure 2 Shows the experimental results of stability evaluation of polyA120 of stbl2 strain.

[0041] Figure 3 Shows the experimental results of stability evaluation of polyA120 of the stbl2-ΔrecE strain.

[0042] Figure 4 Shows the experimental results of stability evaluation of polyA120 of the stbl2-ΔrecF strain.

[0043] Figure 5Shows the experimental results of stability evaluation of polyA120 of the stbl2-ΔrecEΔrecFΔrecJ strain. DETAILED DESCRIPTION

[0044] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of the present invention. The starting reagents and materials used in the examples of the present invention are all commercially available. The experimental methods in each example without specifying specific conditions were performed according to conventional conditions in the relevant field or according to the conditions recommended in the manufacturer's instructions.

[0045] To increase the stability of E. coli polyA, the present invention genetically modifies E. coli for both homologous recombination and DNA mismatch repair. For homologous recombination, the present invention targets rarA, recE, recF, recO, recR, and recJ for modification. For DNA mismatch repair, the present invention targets DNA polymerase II and DNA polymerase V, enzymes involved in DNA error repair in E. coli. The modification targets the target gene, resulting in a missing or inactive protein. Modification methods can include point mutations, deletion of part or the entire ORF reading frame, and the like.

[0046] Example 1. Knockout of the rarA gene in Escherichia coli stbl2 and its evaluation

[0047] In this example, the vectors pEcCas (addgene 73227) and pEcgRNA (addgene 166581) were used to knock out rarA in the Escherichia coli stbl2 strain using the CRISPR-Cas9 method. The editing site GGATAATACTTTTCAACCTC (SEQ ID No. 1) of rarA was selected, and the primers TAGTGGATAA TACTTTTCAACCTC (SEQ ID No. 2) and AAACGAGGTTGAAAAGTATTATCC (SEQ ID No. 3) were annealed and inserted into the BsaI site of pEcgRNA, replacing the fragment between the original two BsaI sites, to construct the pEcgRNA-rarA vector. The upstream homology arm of rarA was amplified by PCR using primers CTTTGTCCTGACGCCGAAAGC (SEQ ID No. 4) and CCGCAACGATAACATTAGAAAAATCGAGCGACAGATTGC (SEQ ID No. 5), and the downstream homology arm of rarA was amplified by PCR using primers CGCTCGATTTTCTAATGTTAT CGTTGCGGTAATGTTGTT (SEQ ID No. 6) and GGGAGTTACGCTCCGCTTGC (SEQ ID No. 7). The two homology arms were spliced ​​into the rarA knockout homology arm using overlap PCR. Gene knockout was performed according to the method described in the literature Q Li, B Sun, J Chen, et al. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichiacoli. Acta Biochim Biophys Sin, 2021, 53(5), 620–627, deleting the DNA fragment at positions 27-1341 of rarA (1344 bp) on the genome. The resulting sequence was GTGAGCAATCTGTCGCTCGATTTTTCTAA (SEQ ID No. 8).

[0048] The knockout steps are as follows:

[0049] 1) Competent Culture Preparation: Inoculate a single Stbl2 colony containing the pEcCas plasmid into 5 mL of liquid LB medium containing kanamycin and culture overnight at 37°C for 16 hours. Inoculate 1% of the colony into 10 mL of fresh LB medium containing kanamycin and culture at 37°C until OD600 = 0.2. Add arabinose to a final concentration of 10 mM and continue culturing until OD600 = 0.6. Place on ice for 15 minutes, then centrifuge at 3000 rpm at 4°C for 5 minutes. Resuspend in 10% pre-chilled glycerol and centrifuge. Wash three times. Add 10% pre-chilled glycerol to a final volume of 100 μL.

[0050] 2) Transformation: Add 100 ng of pEcgRNA-rarA plasmid and 400 ng of the rarA homology arm fragment to 100 μl of Stbl2-pEcCas competent medium. Gently mix thoroughly, place on ice for 3 minutes, transfer to a pre-chilled 0.1 mm electroporation cuvette at 1.8 kV, and immediately add 600 μl of LB. Gently mix thoroughly, transfer to a sterile 1.5 mL EP tube, and resuspend at 220 rpm at 37°C for 45 minutes. Then, spread on a plate containing 50 μg / ml kanamycin and 50 μg / ml spectinomycin, and incubate overnight at 37°C for 16 hours.

[0051] 3) PCR Identification: Randomly pick a single colony and perform colony PCR verification using primers CTTTGTCCTGACGCCGAAAGC (SEQ ID No. 4) and GGGAGTTACGCTCCGCTTGC (SEQ ID No. 7). The fragment size of a successful knockout should be 503 bp, and the fragment size of an unsuccessful knockout should be 1818 bp.

[0052] 4) Elimination of the helper plasmid: The single colony verified above was inoculated into 3 mL of LB medium supplemented with 10 mM rhamnose and 50 μg / mL kanamycin and cultured overnight at 37°C for 16 hours at 220 rpm. The bacterial solution was diluted 100,000-fold with sterile water, and 100 μL was spread onto an LB plate containing 50 μg / mL kanamycin and cultured overnight at 37°C. The grown single colonies were screened using 50 μg / mL kanamycin plates and plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin. Single colonies sensitive to spectinomycin successfully eliminated pEcgRNA. The single colonies obtained from the above screening were inoculated into 3 mL of liquid LB containing 5 g / L glucose and cultured overnight at 37°C at 220 rpm for 16 hours. The bacterial solution was then spread onto an LB plate containing 5 g / L glucose and 10 g / L sucrose and cultured overnight at 37°C for 16 hours. Single colonies were randomly selected and plated on LB plates and LB plates containing 50 μg / ml kanamycin. Colonies sensitive to kanamycin successfully eliminated pEcCas and glycerol-containing bacteria.

[0053] PCR identification of rarA knockout Figure 1 As shown, clone 15 successfully knocked out the target fragment.

[0054] A polyA of 120 A (polyA120) was inserted into the pUC18 plasmid, and the polyA stability was verified using the plasmid containing 120 A (polyA120). After the plasmid was transformed, clones with the correct polyA size were screened by PCR. The clones were inoculated into LB liquid culture medium and cultured at 30°C for 20 hours. After plating on the plates, 40 clones were randomly selected, and the partial sequence containing polyA120 was amplified by PCR. The size of the PCR products was observed by agarose gel electrophoresis.

[0055] The results of the original strain stbl2 are as follows Figure 2 As shown, approximately 50% of the clones showed significant loss of poly A.

[0056] About 45% of the clones of the Stbl2-ΔrarA strain showed a significant loss of polyA. Judging from the overall band of polyA that was basically intact, the band of the rarA knockout strain was more single and clear, and knocking out rarA had a certain effect on improving the stability of polyA.

[0057] Example 2: Knockout of recE in Escherichia coli stbl2 and its evaluation

[0058] Using the same method as in Example 1, a DNA fragment at positions 47-288 of the recE gene (2601 bp) on the stbl2 genome was deleted. The sequence of the deleted fragment was: CCGGTGAACCTGACGTCGTCCTGTGGGC AAGCAACGATTTTGAATCGACCTGTGCCACTCTGGACTACCTGATCGTTAAGTCAGGTAAAAAACTGAGCAGCTATTTTAAAGCTGTTGCCACGAATTTTCCTGTCGTTAATGACCTGCCCGCTGAAGGTGAGATCGATTTTACCTGGAGTGAACGCTATCAACTCAGCAAAGACTCCATGACATGGGAACTAAAACCGGGAGCAGCACCAGAC (SEQ ID No. 9).

[0059] The effect of stbl2-ΔrecE on polyA stability was verified using a plasmid containing polyA120. The results are as follows Figure 3 As shown in the figure, 62.5% of the clones had significant poly A deletions, indicating that knocking out recE actually increased the instability of the poly A sequence.

[0060] Example 3: Knockout of recF in Escherichia coli stbl2 and its evaluation

[0061] Using the same method as in Example 1, the DNA fragment at positions 347-621 of the recF gene (1074 bp) on the stbl2 genome was deleted. The sequence of the deleted fragment was: TGATAACGCCAGAAGGGTTTACTTTACTCAA CGGCGGCCCCAAATACAGAAGAGCATTCCTCGACTGGGGATGCTTTCACAACGAACCCGGATTTTTCACCGCCTGGAGCAATCTCAAGCGATTGCTCAAGCAGCGCAATGCGGCGCTGCGCCAGGTGACACGTTACGAACAGCTACGCCCGTGGGATAAAGAGCTGATCCCGCTGGCGGAGCAAATCAGCACCTGGCGCGCGGAGTATAGCGCCGGTATCGCGGCCGATATGGCTGATACCTGT (SEQ ID No. 10).

[0062] The effect of stbl2-ΔrecF on polyA stability was verified using a plasmid containing polyA120. The results are as follows Figure 4 As shown in the figure, only about 17.5% of the clones had obvious polyA sequence deletions, indicating that knocking out recF can significantly improve the stability of polyA.

[0063] Example 4: Knockout of recJ in Escherichia coli stbl2 and its evaluation

[0064] Using the same method as in Example 1, delete the DNA fragment at positions 152 - 1076 of the recJ gene (1734bp) on the stbl2 genome. The deleted fragment sequence is GGCAGCAACTGAGCGGCGTCGAAAAGGCCGT TGAGATCCTTTACAACGCTTTTCGCGAAGGAACGCGGATTATTGTGGTCGGTGATTTCGACGCCGACGGCGCGACCAGCACGGCTCTAAGCGTGCTGGCGATGCGCTCGCTTGGTTGCAGCAATATCGACTACCTGGTACCAAACCGTTTCGAAGACGGTTACGGCTTAAGCCCGGAAGTGGTCGATCAGGCCCATGCCCGTGGCGCGCAGTTAATTGTCACGGTGGATAACGGTATTTCCTCCCATGCGGGGGTTGAGCACGCTCGCTCGTTGGGCATCCCGGTTATTGTTACCGATCACCATTTGCCAGGCGACACATTACCCGCAGCGGAAGCGATCATTAACCCTAACTTGCGCGACTGTAATTTCCCGTCGAAATCACTGGCAGGCGTGGGTGTGGCGTTTTATCTGATGCTGGCGCTGCGCACCTTTTTGCGCGATCAGGGCTGGTTTGATGAGCGTAACATCGCAATTCCTAACCTGGCAGAACTGCTGGATCTGGTCGCGCTGGGGACAGTGGCGGACGTCGTGCCGCTGGACGCTAATAATCGCATTCTGACCTGGCAGGGGATGAGTCGCATCCGAGCCGGAAAGTGCCGTCCGGGGATTAAAGCGCTGCTTGAAGTGGCAAACCGTGATGCACAAAAACTCGCCGCCAGCGATTTAGGTTTTGCGCTGGGGCCACGTCTCAATGCTGCCGGACGACTGGACGATATGTCCGTCGGTGTGGCGCTGTTGTTGTGCGACAACATCGGCGAAGCGCGCGTGCTGGCAAATGAACTCGATGCGCTAAACCAGACGCGAAAAGAGATCGAACAAGGAATGCAAATTGAAGCCCTGACCCTGTGCGAGAAACTGGAGCGCAGCCGTGACACGCTACCCGGCGGGCTGGC(SEQ ID No.11). .

[0065] The effect of stbl2-ΔrecJ on polyA stability was verified using a plasmid containing polyA120. The results showed that approximately 25% of the clones had obvious polyA deletions, indicating that knocking out recJ can significantly improve polyA stability.

[0066] Example 5: Knockout of recO or recR in Escherichia coli stbl2 and its evaluation

[0067] Using the same method as in Example 1, the DNA fragments from positions 1-729 of the recO gene (729 bp) and 1-603 of the recR gene (606 bp) on the stbl2 genome were deleted, respectively. The sequence of the recO deletion fragment was ATGGAAGGCTGGCAGCGCGCATTTGTCCTGCATAGTC (SEQ ID No. 12).The sequence of the RecR deletion fragment is: ATGCAAACCAGCCCGCTGTTAACACAGCTTAT (SEQ ID No. 13). In this example, 72 clones were randomly selected for PCR verification.

[0068] Using polyA120-containing plasmids, we verified the effects of stbl2-ΔrecO and stbl2-ΔrecR on polyA stability. The percentages of clones with significant polyA loss were 52.8% (38 / 72) and 47.2% (34 / 72), respectively, similar to those in the original stbl2 strain. This suggests that knocking out recO or recR does not affect polyA stability.

[0069] Example 6: Knockout of recF and / or recJ in Escherichia coli DH5α and Evaluation thereof

[0070] In the DH5α strain, recF and recJ were knocked out respectively using the same method as in Example 1, and their stability was evaluated using polyA120. The results showed that the proportions of DH5α, DH5α-ΔrecF, and DH5α-ΔrecJ strains with obvious polyA deletion were 72.2%, 52.1%, and 68.1%, respectively. It can be seen that knocking out recF and recJ helps to improve the stability of polyA, especially knocking out recF can significantly improve the stability of polyA120, which is consistent with the results of knocking out in the stbl2 strain.

[0071] Furthermore, when recF and recJ were knocked out simultaneously, 47.5% of the strain DH5α-ΔrecFΔrecJ showed a significant loss of polyA120, indicating that knocking out both recF and recJ in DH5α further improved the stability of polyA120 compared to knocking out either alone.

[0072] Example 7: Knockout of recJ based on stbl2-ΔrecF and characterization of its performance

[0073] The same method as in Example 1 was used to knock out recJ on the basis of stbl2-ΔrecF to construct the strain stbl2-ΔrecFΔrecJ.

[0074] Stability was assessed using polyA120, and the percentage of stbl2-ΔrecFΔrecJ with significant polyA deletion was 36.1%, indicating that simultaneous knockout of recF and recJ also helps improve polyA120 stability.

[0075] Example 8: Knockout of recF or further knockout of recJ based on stbl2-ΔrecE and performance evaluation thereof

[0076] The same method as in Example 1 was used to knock out recF on the basis of stbl2-ΔrecE to construct the strain stbl2-ΔrecEΔrecF, and then further knock out recJ on the basis of this strain to construct the strain stbl2-ΔrecEΔrecFΔrecJ.

[0077] The stability was evaluated by polyA120. The results showed that the proportion of stbl2-ΔrecEΔrecF with obvious polyA deletion was 12.5%, while the proportion of stbl2-ΔrecEΔrecFΔrecJ with obvious polyA deletion was only 11.6% (e.g. Figure 5 ). However, the proportion of stbl2-ΔrecE cells with significant polyA deletion was 62.5%, further demonstrating that knockout of recF and recJ helps improve the stability of polyA120.

[0078] Example 9: Knockout of rarA based on stbl2-ΔrecEΔrecF and performance evaluation thereof

[0079] Using the same methods as in Example 1, rarA was deleted from stbl2-ΔrecEΔrecF to construct the strain stbl2-ΔrecEΔrecFΔrarA. The effect of the strain on polyA stability was evaluated using polyA120. The percentage of strains with significant polyA deletion was 55%, a higher percentage than that of stbl2-ΔrecEΔrecF. Deleting rarA did not further improve the polyA120 stability of stbl2-ΔrecEΔrecF.

[0080] Example 10: Knockout of DNA polymerase based on stbl2-ΔrecEΔrecF and its evaluation

[0081] Using the same method as in Example 1, the error-prone DNA polymerase pol II (polB, 2352 bp) and DNA polymerase pol V (1269 bp) were knocked out separately and simultaneously on the basis of stbl2-ΔrecEΔrecF, wherein pol II deleted the DNA fragment at positions 17-747, the sequence of which is: TTATCTTAACCCGACACTGGCGGGAC (SEQ ID No.14), Pol V deletes the DNA fragment at positions 370 - 1223, and its sequence is: CGCG CAACGGTGCTACAACGTACCCATCTTACTGTTGGTGTGGGGATCGCCCAGACCAAAACGCTGGCTAAGCTTGCCAATCATGCGGCAAAAAAATGGCAGCGGCAGACGGGTGGGGTGGTGGATTTATCAAATCTGGAACGCCAGCGTAAATTAATGTCTGCTCTCCCCGTGGATGACGTCTGGGGGATTGGACGGCGGATCAGCAAAAAACTGGACGCGATGGGGATCAAAACCGTTCTCGATTTGGCGGATACAGATATCCGGTTTATCCGTAAACATTTTAATGTCGTGCTCGAAAGAACGGTGCGTGAACTGCGCGGCGAACCCTGTTTGCAACTGGAAGAGTTTGCACCGACGAAGCAGGAAATTATCTGTTCCCGCTCGTTTGGTGAACGCATCACGGATTATCCGTCGATGCGGCAGGCCATTTGTAGTTACGCTGCCCGGGCGGCGGAAAAACTTCGCAGCGAGCATCAATATTGTCGGTTTATCTCCACGTTTATTAAGACGTCACCATTTGCGCTCAATGAACCTTATTACGGCAATAGCGCGTCGGTAAAACTGCTGACGCCCACTCAGGACAGCAGGGATATCATTAACGCTGCTACGCGATCTCTGGATGCCATCTGGCAAGCGGGCCATCGTTACCAAAAAGCGGGCGTGATGCTGGGGGATTTCTTCAGTCAGGGAGTCGCGCAGCTCAATTTATTCGATGACAACGCACCGCGCCCCGGGAGTGAGCAATTGATGACGGTAATGGATACACTGAATGCTAAAGAGGGCAGAGGAACACTCTATTTTGCCGGGCAGGGGATCCAGCAACAATGGCAGATGAAGCGAGCCATGCTTTC(SEQ ID No. 15).

[0082] Three strains were constructed: stbl2-ΔrecEΔrecFΔpol II, stbl2-ΔrecEΔrecFΔpol V and stbl2-ΔrecEΔrecFΔpol IIΔpol V.

[0083] Similarly, polyA120 was used to evaluate the effects of the strains on polyA stability. The results showed that the proportions of these three strains with significant polyA deletions were 52.5%, 30%, and 60%, respectively, all higher than the 12.5% ​​of stbl2-ΔrecEΔrecF. This suggests that knocking out error-prone DNA polymerases does not effectively improve polyA stability.

[0084] Table 1 Evaluation of strains using polyA120

[0085] strains The proportion of polyA deletion Stbl2 50％ Stbl2-ΔrarA 45.0％ Stbl2-ΔrecE 62.5％ Stbl2-ΔrecF 17.5％ Stbl2-ΔrecJ 25.0％ Stbl2-ΔrecO 52.8％ Stbl2-ΔrecR 47.2％ Stbl2-ΔrecFΔrecJ 36.1％ Stbl2-ΔrecEΔrecF 12.5％ Stbl2-ΔrecEΔrecFΔrecJ 11.6％ Stbl2-ΔrecEΔrecFΔrarA 55.0％ Stbl2-ΔrecEΔrecFΔpolV 30.0％ Stbl2-ΔrecEΔrecFΔpolⅡ 52.5％ Stbl2-ΔrecEΔrecFΔpolⅤΔpolⅡ 60.0％ DH5α 72.2％ DH5α-ΔrecF 52.1％ DH5α-ΔrecJ 68.1％ DH5α-ΔrecFΔrecJ 47.5％

[0086] Example 11: Verification of the Stability of PolyA in stbl2-ΔrecF and stbl2-ΔrecEΔrecF Using PolyA90

[0087] Plasmids containing 90 consecutive A sequences (polyA90) were introduced into stbl2-ΔrecF and stbl2-ΔrecEΔrecF, respectively. After incubation at 30°C for 20 hours, the plasmids were plated on LB plates. Seventy-two single clones were selected for PCR amplification of the polyA90-containing fragment. Band size was determined by agarose gel electrophoresis. The percentages of stbl2, stbl2-ΔrecF, and stbl2-ΔrecEΔrecF with significant polyA deletions were 2.8%, 4.2%, and 2.8%, respectively. Due to the short tandem repeats of polyA90, these sequences were relatively stable at 30°C, with no significant differences observed between the different host strains.

[0088] Plasmids containing 90 consecutive A sequences (polyA90) were introduced into stbl2-ΔrecF and stbl2-ΔrecEΔrecF, respectively. After incubation at 37°C for 20 h, the plates were spread on LB plates. Randomly selected clones were PCR amplified for fragments containing polyA90, and the band sizes were identified by agarose gel electrophoresis. The proportions of stbl2, stbl2-ΔrecF, and stbl2-ΔrecEΔrecF with obvious polyA deletions were 94.4%, 91.7%, and 58.3%, respectively.

[0089] Example 12: Verification of the Stability of PolyA in stbl2, stbl2-ΔrecF, and stbl2-ΔrecEΔrecF Using Multi-Segmented PolyA

[0090] The plasmid containing the multi-segmented polyA (the sequence of the multi-segmented polyA is: AAAAAAAAAAAAAAA AAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No. 16) was transformed into the stbl2, stbl2-ΔrecF, and stbl2-ΔrecEΔrecF strains, respectively. After culturing in liquid LB medium at 30°C for 24 h, the cells were transferred to fresh LB medium and cultured 10 times. The cells were plated on solid LB plates, and 96 single colonies were selected for PCR verification of the polyA deletion rate. The results showed that the proportions of clones with significant polyA deletions were 21.9%, 6.3%, and 18.9% for stbl2, stbl2-ΔrecF, and stbl2-ΔrecEΔrecF, respectively.

[0091] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. An engineered Escherichia coli strain, wherein the recF and / or recJ proteins are lowly expressed or not expressed, or the recF and / or recJ proteins are missing or inactive.

2. The engineered Escherichia coli strain according to claim 1, wherein the coding sequence of recF and / or recJ in its genome is truncated or mutated in whole or in part, so that the strain recF and / or recJ protein is under-expressed or not expressed, or expresses missing or inactive recF and / or recJ protein.

3. The engineered Escherichia coli strain according to claim 1 or 2, wherein the recE protein is lowly expressed or not expressed, or the recE protein is missing or inactive.

4. The engineered Escherichia coli strain according to any one of claims 1 to 3, wherein the DNA polymerase V is lowly expressed or not expressed, or the DNA polymerase V is missing or inactive; Preferably, the engineered E. coli strain has no defective expression of DNA polymerase II.

5. The engineered Escherichia coli strain according to any one of claims 1 to 4, which is an engineered DH5α or stbl2 strain.

6. A method for preparing an engineered Escherichia coli strain according to any one of claims 1 to 5, wherein include: By using point mutation or deleting part or the whole ORF reading frame, the protein of the E. coli strain is lowly expressed or not expressed, or the protein is missing or inactive.

7. Use of the engineered Escherichia coli strain according to any one of claims 1 to 5 in producing plasmids; Preferably, the plasmid is a plasmid containing a tandem repeat sequence such as polyA.

8. A method for preparing a plasmid containing a polyA sequence, the method comprising: include: The engineered Escherichia coli strain according to any one of claims 1 to 5 is used to ferment and prepare a plasmid containing a polyA sequence.

9. The method according to claim 8, in, The fermentation conditions are: culturing at 28-32°C for 12h-72h.

10. The method according to claim 8 or 9, in, The polyA sequence length is 24nt-144nt, preferably 90nt-120nt.

Images