Streptococcus zooepidemicus gene deletion strain, live vaccine and preparation method thereof

Abstract

The invention is applicable to the technical field of gene engineering, and is characterized in that a streptococcus zooepidemicus ATCC 35246 strain is used as a parent strain, and a pSET4S temperature-sensitive suicide gene knockout plasmid is utilized to knock out pyrroline-5-carboxylic acid reductase gene (proC), so that a streptococcus zooepidemicus gene deleted strain ATCC 35246 delta proC is obtained. The deletion strain has low toxicity, and when the mutant strain is used for immunizing a mouse in a large dose of viable bacteria, the titer of an antibody in the mouse can be obviously increased, and targeted immune protection is successfully established; the ATCC 35246 delta proC is convenient to prepare, low in cost and simple to culture, does not need other complex treatment when being used as a vaccine, and can be used after being adjusted to a corresponding concentration after bacteria washing. A result of an immune experiment on a mouse shows that the vaccine can effectively stimulate the immune level of an animal body and resist streptococcus zooepidemicus infection, and the deletion strain is high in safety and remarkable in immune protection effect in the mouse and has the potential of serving as a streptococcus zooepidemicus live vaccine.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a gene-deficient strain of Streptococcus zooepidemicus, a live vaccine and a preparation method thereof. Background Art

[0002] Streptococcus equi subsp. zooepidemicus (SEZ), also known as Streptococcus equi zooepidemicus, belongs to Group C Streptococcus of Lambda-Hyderabad. It is an important animal pathogen that can cause diseases in many animals such as pigs, horses, cattle, sheep, cats, mice, rabbits, etc. Infection with SEZ can lead to symptoms such as sepsis, meningitis, and arthritis. In severe cases, it can cause acute death of the host. In 1976, an outbreak of SEZ infection occurred in pigs in Ziyang, Sichuan, China, and the isolate was numbered ATCC 35246. In 2019, an outbreak of swine streptococcal disease caused by SEZ infection occurred in pigs in the United States and Canada, with a mortality rate of 30%-50%. The isolates have a high degree of homology with each other and have a genetic homology of up to 99.4% with ATCC 35246.

[0003] At present, the main means of controlling swine streptococcosis caused by SEZ are antibiotics and vaccines. However, in recent years, due to the excessive use of antibiotics, which can lead to increased bacterial resistance, my country's aquaculture industry has begun to restrict the use of antibiotics. In addition, the relevant vaccine that has been launched on the market is the localized ST171 attenuated live vaccine, which is obtained through 171 generations of passage and has the risk of reversion to virulence. In addition, this vaccine is still insufficient in terms of immune protection effect, so it is urgent to develop a new vaccine to prevent swine streptococcosis.

[0004] Therefore, developing vaccines that are more suitable for SEZ has important scientific and application value. Through this study, meaningful parameters can be provided for the development of new vaccines, thereby ensuring the smooth development of the pig industry and the health of the people. Summary of the invention

[0005] The purpose of the present invention is to provide a gene-deficient strain of Streptococcus zooepidemicus, a vaccine and a preparation method thereof. The vaccine is easy to prepare, has low cost, can effectively stimulate the immune level of the body of the immunized animal, and is very good at resisting Streptococcus zooepidemicus infection.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] The first object of the present invention is to provide a gene-deficient strain of Streptococcus zooepidemicus, wherein the gene-deficient strain of Streptococcus zooepidemicus is ATCC 35246ΔproC, which is obtained by utilizing the pSET4S temperature-sensitive suicide gene knockout plasmid, taking the Streptococcus zooepidemicus ATCC 35246 strain as the parent strain, and knocking out its pyrroline-5-carboxylate reductase gene (proC).

[0008] Furthermore, the gene-deficient strain of Streptococcus zooepidemicus is deposited in the China Center for Type Culture Collection, with the deposit number being CCTCC NO:M 20242605 and the deposit date being November 20, 2024.

[0009] The second object of the present invention is to provide a method for preparing the aforementioned Streptococcus zooepidemicus gene-deficient strain ATCC35246ΔproC, comprising the following steps:

[0010] S1: Using Streptococcus zooepidemicus ATCC 35246 as a template, primer pairs ΔproC-P1 / ΔproC-P2 and ΔproC-P3 / ΔproC-P4 were used to amplify the target fragments of the upstream and downstream homology arms of the proC gene, respectively;

[0011] S2: The upstream and downstream homology arm target fragments amplified in S1 were then subjected to fusion PCR using ΔproC-P1 / ΔproC-P4 as primers, and the upstream and downstream fragments were fused using overlap extension PCR and cloned between BamHI and EcoRI of the thermosensitive suicide plasmid pSET4S of Streptococcus, generating a recombinant plasmid pSET4s-ΔproC lacking the pyrroline-5-carboxylate reductase gene (proC);

[0012] S3: The gene-deficient recombinant plasmid was transformed into the competent state of Streptococcus zooepidemicus ATCC 35246 by electroporation under the conditions of voltage of 2.3 kV, capacitance of 25 μF and resistance of 200 Ω, and the proC gene-deficient strain ATCC 35246ΔproC was obtained by spectinomycin resistance screening.

[0013] Further, the ΔproC-P1 sequence of S1 is shown in SEQ ID NO. 1: 5′-GACGGCCAGTGAATTAGCCCCTCGTATTCTTG-3′;

[0014] The ΔproC-P2 sequence is shown in SEQ ID NO. 2: 5′-GATGATGGAATAATGATCCTAAAAATAAATCAAAGGTC-3′;

[0015] The ΔproC-P3 sequence is shown in SEQ ID NO. 3: 5′-CATTATTCCATCATCACTGAGCTCCA-3′;

[0016] The sequence of ΔproC-P4 is shown in SEQ ID NO. 4: 5′-CGACTCTAGAGGATCACGCTAGTTGCTATTGTGG-3′.

[0017] Furthermore, the fragment sequence of the upstream homology arm of the proC gene described in S1 is as shown in SEQ ID NO.As shown in Figure 5: GCCCCTCGTATTCTTGTTGCGGCTCACATGGACGAGGTTGGCTTTATGGTGAGCGAGATCAAAGCAGACGGAACGCTGCGGGTTGTTGAAATTGGCGGCTGGAATCCACTAGTTGTTAGCTCACAGCGCTTTACCTTATACACTCGCACTGGCCAAGCCATTCCTGTTATTTCAGGCTCAGTTCCTCCCCATTTTCTGCGCGGAGCAAATGGTGCTGCTAGTCTACCAACTGTTTCAGATATTGTTTTTGATGGTGGCTTTACAGACAAGGCTGAAGCCGAAAGCTTTGGCATCACACCAGGAGATATTATTGTACCGCAGTCTGAAACCATTTTAACTGCCAATAAAAAGAATATCATCTCAAAGGCCTGGGACAACCGCTATGGTGTTCTCATGGTCACTGAGCTGCTAGAAGCCCTAAAAGACCAGACACTTCACAACACTCTTATTGCTGGAGCAAATGTCCAAGAAGAAGTCGGGCTTCGTGGTGCCCATGTTTCAGCCACTACATTTGATCCTGAGCTTTTCTTTGCTGTTGATTGCTCACCTGCTGGTGATATTTATGGCAATCCTGGTCGTATTGGGGATGGAACTCTGCTACGCTTTTACGATCCCGGACACATCATGCTTAAGAACATGCGAGACTTCCTATTAACTACCGCTGAAGAGGCTGGGGTAGCCTTCCAATATTATTGCGGTAAGGGCGGTACAGACGCTGGTGCTGCCCACCTCAAAAATGGCGGTATTCCTTCAACCACAATCGGTGTCTGCGCTCGCTACATTCACTCACACCAAAGCCTATACGCCTTAGATGATTTCGTAGAAGCACAGGCCTTTTTGCAAGCCATTGTCAAAAGGCTTGACCGCTCAACAGTTGATTTAATTAAGAAATACTAGGAAGGATAAGACTAAAATGCGAATCAAAGGTTCAATGAATACTCTAGCTTAACCTGTTGACCTTTGATTTATTTTTAGGATCATTATT。.

[0018] The fragment sequence of the downstream homology arm of the proC gene is as shown in SEQ ID NO.As shown in Figure 6: CCATCATCACTGAGCTCCAAGCTCATTACCTAAGACTAGCTCAAGACAGCCCCAAATACCTATTCTTTCTAAAAAGGATATGTCATTCTGAGCTCACGTTTGAAATAACAAAATCGCATGCAGTGACATGACTTAGCCTGTTACTACATGCGGTTTTTTGCATTTTTAGAAAAAATAGTTTCATTCAAAGCCCTTGCTCTAGACCTCTTTGTGTTAAGACGACTTACATGTGTTTACTAACCCAGGCTCTAATCATGGCATACAGATTGAAAACAATCAACGGAAGATTATACCCAAAAAGCTCTTTGATCGTCATATTTGGAAAGAATATCGCTAGCACAACAAAGAGAACAGCAAATAGACAAAAACAGTAAGCCTGTGTTTTCTGACGAATCGCTCGATTACGCTCATCATAGCTATTAATCAGATATTCTCGTAAAGACGTTGGCTCTGTAAGCACATAATAGCAAAGACATGACGCAATCAATAGTATAGGCCCCAGGATAAAAAGGAGAAAGCCCGTTTGATGATTCCCTTGAATAATCAAAAAAATCCCATAAGTCCCTACCAACACACCGATTGTCAGTAAAGAATGACCAAGTCTCTTATACATTTTCTCCCAACGCTGATACTTTTTTTCAATCCAATGATCATTTTTCATTCATTTATCCCTTCATCACTCAAGCAGTACTACTGAAGATAAGGCAGCAAAAGCATGATAAGAACAGCTAGTGCATTATTCAAAAAATGAATCAATATCGTGTATTCGACCTTCTTTGTTTTATGGAAAACAAAGCCTAACACCAGCCCCATACCGCCATAGATAAACCAACTGCCAAAATCTGTTGGCACATGAATCAAGCCAAACATGATACTGCTAAAAATCAAGCCCAGATAAGACTCTGCACCAAAGAGCTTCCCATAAAGCAGCCCTCGAAAAGCAATTTCTTCCACAATTGGTGCCACAATAGCAACTAGCGT。.

[0019] The third object of the present invention is to provide the use of the aforementioned Streptococcus zooepidemicus gene-deficient strain ATCC 35246ΔproC in the preparation of medicines for preventing Streptococcus zooepidemicus infection.

[0020] The fourth object of the present invention is to provide a live attenuated vaccine for preventing zooepidemic streptococci, wherein the vaccine uses the aforementioned zooepidemic streptococcus gene-deficient strain ATCC 35246ΔproC as an active ingredient.

[0021] A fifth object of the present invention is to provide a method for preparing the attenuated live vaccine for preventing zooepidemic streptococcus as described above, comprising the following steps:

[0022] a. Inoculate a single colony of the Streptococcus zooepidemicus gene-deficient strain ATCC 35246ΔproC in THB medium and culture until the bacterial solution OD 600 The value is 0.6-0.8;

[0023] b. Take out the culture obtained in step a, wash it with sterile phosphate buffer and dilute the bacterial solution to a concentration of 5×10 8 CFU / mL to obtain the attenuated live vaccine for preventing zooepidemic streptococcus.

[0024] Furthermore, the vaccine does not require any other complicated treatment before use and can be used after washing and adjusting to a corresponding concentration.

[0025] The beneficial effects of the present invention are

[0026] The proC gene-deficient strain of Streptococcus zooepidemicus provided by the present invention, namely ATCC 35246ΔproC, is substantially non-toxic and has excellent safety. Immunizing mice with a large dose of live bacteria of the mutant strain has substantially no infection damage to the mice, and can significantly increase the antibody titer in the mice, thereby successfully establishing targeted immune protection.

[0027] The preparation method of the proC gene-deficient strain of Streptococcus zooepidemicus of the present invention is simple, can be prepared in a short time, is simple to culture, and does not require other complicated treatments as a vaccine, and can be used after washing the bacteria and adjusting to a corresponding concentration. The proC gene-deficient strain has the potential to be used as a live vaccine for animals against Streptococcus zooepidemicus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the PCR identification result after proC gene knockout;

[0029] Figure 2 are the growth curves of ATCC 35246 strain and ΔproC deletion strain;

[0030] Figure 3 This is a graph showing the survival rate test results of mice infected with the ΔproC deletion strain;

[0031] Figure 4 The results of the bacterial load test in the blood and organs of mice infected with the ΔproC deletion strain are shown in Figure 1. Figure 4 A: Detection of bacterial load in blood and various organs after tail vein infection; Figure 4 B: Detection of bacterial load in blood and various organs after subcutaneous injection;

[0032] Figure 5 This is a diagram showing the evaluation results of the protective effect of ΔproC-deficient strain immunized mice. Figure 5 A: Antibody titer detection; Figure 5 B: Survival rate test; Figure 5 C: Bacterial load detection in blood and various organs.

[0033] The gene-deficient strain of Streptococcus zooepidemicus, classified as Streptococcus equi subsp.zoepidemicusATCC35246ΔproC; deposited in China Center for Type Culture Collection; the deposit address is China Center for Type Culture Collection, Wuhan University, Wuhan, China; the deposit number is CCTCC NO:M 20242605; the deposit date is November 20, 2024. DETAILED DESCRIPTION

[0034] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0036] Unless otherwise specified, the raw materials and chemical reagents used in the examples are conventional commercial products, and the technical means used are conventional means known to those skilled in the art.

[0037] Unless otherwise specified, the materials, reagents and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0038] The proC gene-deficient strain provided in one embodiment of the present invention was deposited in the China Center for Type Culture Collection (Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province) on November 20, 2024, with a deposit number of CCTCC NO: M 20242605 and a classification name of Streptococcus equi subsp. zooepidemicus ATCC 35246ΔproC.

[0039] Specific implementation cases:

[0040] Example 1 Construction of proC gene deletion mutant ΔproC

[0041] 1.1 Construction of recombinant plasmid pSET4S-ΔproC

[0042] Using Streptococcus zooepidemicus ATCC 35246 strain as a template, the primer pairs ΔproC-P1 / ΔproC-P2 and ΔproC-P3 / ΔproC-P4 shown in SEQ ID NO.1-SEQ ID NO.4 were used to amplify nearly 1000 bp target fragments of the upstream and downstream homologous arms of the proC gene shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0043] PCR reaction system: 25 μL of 2× Prime STAR HS Premix, 2 μL of 10 μmol / L upstream and downstream primers, 1 μL of template, and ddH2O to make up to 50 μL.

[0044] PCR reaction conditions: 95°C for 5 min; 98°C for 10 s, 55°C for 15 s, 72°C for 1 min / kb, 30 cycles; 72°C for 10 min.

[0045] Then, the amplified fragment was subjected to fusion PCR with ΔproC-P1 / ΔproC-P4 as primers to obtain the connection product of the upstream and downstream homology arms; after 1.5% agarose gel electrophoresis, the product was recovered using a gel recovery kit; the gel recovery product and the temperature-sensitive suicide plasmid pSET4S were simultaneously double-digested with restriction endonucleases BamHⅠ and EcoRⅠ, and then transformed into Escherichia coli DH5α after ligation with a rapid recombinase, and after screening with 100 μg / mL spectinomycin resistance, suspected colonies were picked for expansion culture, and after plasmids were extracted with a kit, the extracted plasmids were subjected to PCR and sequencing identification, and the gene deletion recombinant plasmid identified as positive was named pSET4S-ΔproC;

[0046] 1.2 Screening and identification of ΔproC deletion strains

[0047] Place the recombinant plasmid, competent state and electroporation cup on ice for 5 minutes, take 1.5 μg of recombinant plasmid, add 100 μL of Streptococcus zooepidemicus competent state and gently transfer to the electroporation cup with a size of 1 mm, and place it in an ice bath for 30 minutes. Take out the electroporation cup, wipe off the condensed water, and put it into the electroporator. Use the GenePulser Xcell electroporation system to electroporate to Streptococcus zooepidemicus ATCC 35246 competent state under the electroporation conditions of 2.3 kV, 200 Ω, and 25 μF, and then suspend the transformed bacteria in 3 mL of THB liquid culture medium and culture at 28°C and 180 r / min for 3 hours.

[0048] The bacteria were spread on THB plates containing 100 μg / mL spectinomycin resistance, and continued to be cultured in a 28°C incubator for 24 hours. A single colony was picked and inoculated into THB liquid culture medium containing spectinomycin resistance. After overnight culture at 28°C and 180 r / min with shaking, the bacteria were transferred into THB liquid culture medium containing spectinomycin resistance and cultured at 37°C overnight. The bacterial liquid was streaked on THB solid plates containing spectinomycin resistance and cultured in a 37°C incubator overnight. A single colony was picked and transferred into THB liquid culture medium, and the plates were left to stand in a 28°C incubator. After continuous subculture for 3-5 generations, the plates were evenly spread on THB plates containing spectinomycin resistance and those without spectinomycin resistance, and cultured in a 37°C incubator overnight.

[0049] Then, the colonies that only grew on THB plates without spectinomycin resistance were selected and cultured in THB liquid medium at 37°C and 180 rpm for 5-6 h. PCR identification and Sanger sequencing were performed using P1 / P4 primers to verify the gene deletion ( Figure 1 Finally, a mutant strain, namely, a ΔproC deletion strain (ie, Streptococcus equi subsp. zooepidemicus ATCC 35246ΔproC with a preservation number of CCTCC NO: M 20242605) was obtained.

[0050] The primers used to construct the strains are shown in Table 1:

[0051] Table 1: Primers for knockout strains

[0052]

[0053] Example 2 Determination of growth curve of proC gene deletion strain of Streptococcus zooepidemicus

[0054] Comparison of the growth of Streptococcus zooepidemicus ATCC 35246 strain and its gene-deficient strain ATCC 35246ΔproC. First, the Streptococcus zooepidemicus ATCC 35246 strain and its gene-deficient strain ATCC 35246ΔproC were cultured in THB liquid medium at 37°C and 180 r / min shaking until the logarithmic phase (OD value was 0.6-0.8), and the bacterial pellet was resuspended after centrifugation at 7000 r / min, and the OD value was adjusted. 600 =1.0, inoculate Streptococcus zooepidemicus ATCC 35246 and its gene deletion strain ATCC 35246ΔproC in sterile 5mL THB liquid medium at an inoculation ratio of 1:100. Aspirate 100μL from each and measure OD with a spectrophotometer 600 The reading at this time is recorded as 0h, and the OD of the culture is monitored every 1h using a spectrophotometer. 600 , continuous detection for 8 hours, the test was repeated 3 times. Figure 2 As shown, the results showed that the growth rate of the gene-deficient strain ATCC 35246ΔproC was not affected compared with the wild-type strain of Streptococcus zooepidemicus ATCC 35246, thus ensuring that the gene-deficient strain can be used for large-scale growth.

[0055] Example 3 Biosafety Evaluation of the ProC Gene Deleted Strain of Streptococcus Zooepidemicus

[0056] The gene-deficient strain of Streptococcus zooepidemicus ATCC 35246ΔproC was cultured in THB liquid medium at 37°C and 180 r / min shaking until the logarithmic phase (OD value was 0.6-0.8), and then washed three times with sterile phosphate buffer (i.e., sterile PBS) at 7000 r / min for 10 min, and then the bacterial pellet was thoroughly resuspended with an appropriate amount of sterile PBS to adjust the OD 600 =1.0, the bacterial liquid content is 5×10 8 CFU / mL, ready for subsequent animal infection experiments.

[0057] C57BL / 6JGpt mice aged 6-7 weeks were randomly divided into a wild-type strain infection group and a deletion strain infection group. The wild-type strain ATCC 35246 and its gene deletion strain ATCC 35246ΔproC were used at a concentration of 5×10 7 The concentration of CFU / mouse was used to infect mice by tail vein injection. The mortality of mice was recorded and observed for seven consecutive days, and the survival rate curve was drawn.

[0058] To detect the bacterial load, 6-7 week-old C57BL / 6JGpt mice were randomly divided into a wild-type strain infection group and a deletion strain infection group. Streptococcus zooepidemicus ATCC 35246 and its gene deletion strain ATCC 35246ΔproC were used at a concentration of 5×10 7The concentration of CFU / mouse was determined. Mice were infected by tail vein injection. 24 hours after infection, blood and visceral tissues were collected from the mice. The blood was diluted in multiples and then coated on THB plates. The tissues were added with PBS and ground into tissue homogenate. The tissues were diluted in multiples and then coated on THB plates. The tissues were cultured in a 37°C incubator overnight. After obvious colonies grew, they were counted and statistically analyzed.

[0059] The results showed that mice infected with Streptococcus zooepidemicus ATCC 35246 strain via tail vein injection all died within 24-36 hours, while all mice infected with ATCC 35246ΔproC survived after 7 days ( Figure 3 ). 24 hours after infection, the bacterial load in the blood and various tissues and organs of the mice was detected, and it was found that compared with the mice infected with ATCC 35246 strain, the bacterial load in various tissues and organs of the mice infected with ATCC35246ΔproC was significantly reduced ( Figure 4 A). This indicates that the strain Streptococcus zooepidemicus ATCC 35246 constructed by the present invention has good biosafety.

[0060] Example 4 Preparation of live vaccine using proC gene-deficient strain of Streptococcus zooepidemicus and evaluation of immune effect

[0061] 4.1 Safety testing of ΔproC live vaccine

[0062] 6-7 week old C57BL / 6JGpt mice were immunized on day 0, day 7 and day 14. ATCC 35246ΔproC was resuspended in PBS, and the amount of bacteria for the first immunization was 5×10 7 CFU / mouse, the second and third immunizations maintained the same bacterial load. Mice were immunized by subcutaneous injection (100 μL / mouse). At the same time, the control group mice were subcutaneously injected with PBS solution. Seven days after the third immunization, the mice were autopsied, the bacterial load in the blood and organs was measured, and its safety was evaluated.

[0063] The results showed that the mice were in normal condition during the immunization period. The bacterial load test found that there was basically no bacterial colonization in the blood and various tissues and organs of the immunized mice. These results show that ATCC 35246ΔproC immunization did not cause infection damage to mice and is very safe as a live vaccine ( Figure 4 B).

[0064] 4.2 Evaluation of the immune protection effect of ΔproC live vaccine

[0065] At various time points after immunization, blood was collected from mice to prepare serum, and the antibody titer produced was tested by ELISA. The results showed that high levels of antibodies ( Figure 5A) Mice were infected with ATCC 35246 strain, and 5×10 5 CFU / mouse, the results showed that ΔproC live bacteria immunization successfully protected mice against infection with ATCC 35246 strain, and the survival rate was significantly increased ( Figure 5 B). 21 days after infection with ATCC 35246, the amount of ATCC 35246 colonization in the immunized mice was significantly lower than the infection amount ( Figure 5 C). These results indicate that ΔproC live bacteria can successfully establish immunity in mice and produce immune protection against Streptococcus zooepidemicus ATCC 35246.

[0066] In summary, ATCC 35246ΔproC can successfully establish immunity in mice and has a good immune protection against infection with the same type of Streptococcus zooepidemicus.

[0067] It can be seen that the highly virulent strain of Streptococcus zooepidemicus ATCC 35246 is transformed into a low-virulence strain after the proC gene is deleted. The use of its live bacteria to immunize mice has good safety, can effectively establish immune protection in mice, and help mice resist infection from its parental strain. It has the potential to be used as a live bacterial vaccine for Streptococcus zooepidemicus infection.

[0068] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gene-deficient strain of Streptococcus zooepidemicus, characterized in that: The gene-deficient strain of Streptococcus zooepidemicus is ATCC35246ΔproC, which is obtained by using pSET4S temperature-sensitive suicide gene knockout plasmid, taking Streptococcus zooepidemicus ATCC35246 strain as the parent strain, and knocking out its pyrroline-5-carboxylate reductase gene (proC).

2. The gene-deficient Streptococcus zooepidemicus strain according to claim 1, characterized in that: The gene-deficient strain of Streptococcus zooepidemicus is deposited in the China Center for Type Culture Collection, with the deposit number being CCTCC NO:M 20242605 and the deposit date being November 20, 2024.

3. A method for preparing the gene-deficient Streptococcus zooepidemicus strain ATCC 35246ΔproC according to claim 1, characterized in that: The following steps are involved: S1: Using Streptococcus zooepidemicus ATCC 35246 as template, primer pairs ΔproC-P1 / ΔproC-P2 and ΔproC-P3 / ΔproC-P4 amplified the target fragments of the upstream and downstream homology arms of the proC gene, respectively; S2: The upstream and downstream homology arm target fragments amplified in S1 were then subjected to fusion PCR using ΔproC-P1 / ΔproC-P4 as primers, and the upstream and downstream fragments were fused using overlap extension PCR and cloned into the Streptococcus thermosensitive suicide plasmid Between BamHI and EcoRI of pSET4S, a recombinant plasmid lacking the pyrroline-5-carboxylate reductase gene (proC) was generated pSET4s-ΔproC; S3: The gene-deficient recombinant plasmid was transformed into the competent state of Streptococcus zooepidemicus ATCC 35246 by electroporation under the conditions of voltage of 2.3 kV, capacitance of 25 μF and resistance of 200 Ω, and the proC gene-deficient strain ATCC 35246ΔproC was obtained by spectinomycin resistance screening.

4. The method according to claim 3, characterized in that The ΔproC-P1 sequence of S1 is shown in SEQ ID NO.1, the ΔproC-P2 sequence is shown in SEQ ID NO.2; the ΔproC-P3 sequence is shown in SEQ ID NO.3, and the ΔproC-P4 sequence is shown in SEQ ID NO.

4.

5. The method according to claim 3, characterized in that: S1 The target fragment sequence of the upstream homology arm of the proC gene is shown in SEQ ID NO.5, and the target fragment sequence of the downstream homology arm of the proC gene is shown in SEQ ID NO.

6.

6. Use of the Streptococcus zooepidemicus gene-deficient strain ATCC 35246ΔproC according to claim 1 in the preparation of a medicine for preventing Streptococcus zooepidemicus infection.

7. A live attenuated vaccine for preventing zooepidemic streptococci, characterized in that: The vaccine uses the gene-deficient strain of Streptococcus zooepidemicus ATCC 35246ΔproC described in claim 1 as an active ingredient.

8. A method for preparing a live attenuated vaccine for preventing zooepidemic streptococci as claimed in claim 7, characterized in that: The following steps are involved: a. Inoculate a single colony of the Streptococcus zooepidemicus gene-deficient strain ATCC 35246ΔproC in THB medium and culture until the bacterial solution OD 600 The value is 0.6-0.8; b. Take out the culture obtained in step a, wash it with sterile phosphate buffer and dilute the bacterial solution to a concentration of 5×10 8 CFU / mL to obtain the attenuated live vaccine for preventing zooepidemic streptococcus.

Images