Streptococcus suis type 2 SC19 delta potD attenuated strain as well as preparation method and application thereof

Abstract

The invention discloses a streptococcus suis serotype 2 SC19 delta potD attenuated strain as well as a preparation method and application thereof, and belongs to the technical field of biological products. The streptococcus suis serotype 2 SC19 delta potD attenuated strain is obtained after a potD gene in a streptococcus suis serotype 2 SC19 strain genome is deleted, and the nucleotide sequence of the potD gene is as shown in SEQ ID No. 1. According to the invention, the potD gene in the wild streptococcus suis SC19 genome is deleted, so that the pathogenicity to animals is reduced, meanwhile, the potD gene has a certain protection effect on various serotype streptococcus suis, and animal epidemic diseases caused by the pathogen are effectively prevented and controlled.

Description

Technical Field

[0001] The present invention relates to the technical field of biological products, and in particular to an attenuated strain of Streptococcus suis type 2 SC19ΔpotD and a preparation method and application thereof. Background Art

[0002] Streptococcus suis is an important zoonotic pathogen. The main clinical symptoms caused by its infection are meningitis, arthritis, endocarditis and septic pneumonia. Streptococcus suis is mainly transmitted horizontally and can infect humans through the respiratory tract, digestive tract or skin wounds. In addition to infecting pigs, what is more serious is that Streptococcus suis can also infect humans through the digestive tract or wounds, causing meningitis, septicemia, endocarditis and deafness, and even death in severe cases.

[0003] At present, the prevention, control and treatment of Streptococcus suis and its related diseases in clinical practice mainly rely on veterinary antibiotics such as macrolides and tetracyclines. However, the long-term use of veterinary antibiotics has caused Streptococcus suis to develop varying degrees of drug resistance. The number of drug-resistant strains has continued to increase, making it difficult to completely kill them, causing repeated infections. Under conditions of impaired immune systems or environmental pressures, combined infections with multiple pathogens such as Streptococcus suis and Streptococcus pneumoniae may occur. Simultaneous infection with Streptococcus suis and Streptococcus pneumoniae can cause more severe pneumonia and sepsis. Moreover, since different pathogens may have different sensitivities to different antibiotics, combined infections will further increase the complexity and difficulty of treatment.

[0004] Vaccination is an effective preventive measure. Currently, vaccines against Streptococcus suis are mainly inactivated vaccines and attenuated vaccines. However, most of the attenuated vaccines constructed through artificial modification only have immune protection against Streptococcus suis of the same serotype. The protective effect against the combined infection of Streptococcus suis and Streptococcus pneumoniae is limited, and there is a risk of virulence reversion. Summary of the invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a type 2 Streptococcus suis SC19ΔpotD attenuated strain and its preparation method and application. The present invention reduces the pathogenicity of wild-type Streptococcus suis SC19 by deleting the potD gene in the wild-type Streptococcus suis SC19 genome; the SC19ΔpotD attenuated strain is used as a vaccine, which has a broad-spectrum immune effect, has a certain protective effect on both Streptococcus suis and Streptococcus pneumoniae infections, and can effectively prevent and control animal diseases caused by the pathogen.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect of the present invention, there is provided a Streptococcus suis type 2 SC19ΔpotD attenuated strain, which is obtained by deleting the potD gene in the genome of the Streptococcus suis type 2 SC19 strain, wherein the nucleotide sequence of the potD gene is shown in SEQ ID No. 1; specifically as follows:

[0008] .

[0009] SC19 is a highly virulent isolate of Streptococcus suis type 2. The present invention has found that after the potD gene of the SC19 strain is deleted, its biofilm-forming ability is weakened and its pathogenicity is also significantly weakened. Moreover, after continuous subculture, there is no phenomenon of virulence reversion, and it can be used as a good candidate strain for vaccine preparation.

[0010] The second aspect of the present invention provides a method for preparing the above-mentioned attenuated strain of Streptococcus suis type 2 SC19ΔpotD, comprising the following steps:

[0011] The genomic DNA of Streptococcus suis type 2 SC19 strain is used as a template to amplify the upstream homology arm and the downstream homology arm of the potD gene respectively; the upstream homology arm and the downstream homology arm of the potD gene are cloned into the pSET4s plasmid to obtain the gene-deleted recombinant plasmid pSET4sΔpotD; the gene-deleted recombinant plasmid pSET4sΔpotD is transferred into SC19 competent cells to prepare the Streptococcus suis type 2 SC19ΔpotD attenuated strain.

[0012] Preferably, the upstream homologous arm of the potD gene is amplified using the primer Up-potD-F shown in SEQ ID No.2 and the primer Up-potD-R shown in SEQ ID No.3; the downstream homologous arm of the potD gene is amplified using the primer Down-potD-F shown in SEQ ID No.4 and the primer Down-potD-R shown in SEQ ID No.5.

[0013] Preferably, the method for cloning the upstream homology arm and the downstream homology arm of the potD gene into the pSET4s plasmid is: the pSET4s plasmid is digested with EcoRI and BamHI restriction endonucleases respectively, and the upstream homology arm and the downstream homology arm of the potD gene are connected to the digested pSET4s plasmid.

[0014] Preferably, the gene-deficient recombinant plasmid pSET4sΔpotD is transformed into SC19 competent cells by electroporation; the electroporation voltage is 2500V, the resistance is 500 ohms, and the electroporation time is 5ms.

[0015] The third aspect of the present invention provides the use of the above-mentioned attenuated strain of Streptococcus suis type 2 SC19ΔpotD in the preparation of attenuated vaccines.

[0016] In the above application, the attenuated vaccine has a broad-spectrum immune activity and can prevent or treat infections caused by Streptococcus suis type 2 SC19, Streptococcus suis type 2 P1 / 7 and / or Streptococcus pneumoniae D39.

[0017] The fourth aspect of the present invention provides a broad-spectrum Streptococcus suis vaccine, wherein the broad-spectrum Streptococcus suis vaccine uses the above-mentioned attenuated strain of Streptococcus suis type 2 SC19ΔpotD as an active ingredient.

[0018] Furthermore, the broad-spectrum Streptococcus suis vaccine also contains an adjuvant; an adjuvant is a type of substance that can non-specifically change or enhance the body's specific immune response to antigens and play an auxiliary role. The adjuvant can induce the body to produce a long-term, efficient specific immune response, improve the body's protective ability, and at the same time reduce the amount of immune substances used and reduce the production cost of the vaccine. The adjuvants that can be used in the present invention include, but are not limited to: aluminum adjuvants, oil emulsion adjuvants, propolis adjuvants, liposome adjuvants, small peptide adjuvants, etc.

[0019] Beneficial effects of the present invention:

[0020] The present invention deletes the potD gene in the genome of Streptococcus suis type 2 SC19 by homologous recombination, so that the mutant strain has a weakened ability to form bacterial biofilms, significantly weakens its pathogenicity to mice, has a good immune protection effect on Streptococcus suis type 2 strain SC19, and is a good candidate strain for preparing vaccines. Compared with the prior art, the attenuated strain of Streptococcus suis type 2 SC19ΔpotD provided by the present invention has the following beneficial effects:

[0021] (1) Safety: The gene-deleted strain lacks key virulence genes, which reduces the pathogenicity of the vaccine strain and the risk of residual in animals, making it safer for animals and humans.

[0022] (2) Immunogenicity: Animal experiments (such as monitoring of antibody levels in animal immunization tests, results of virus protection tests, etc.) have shown that the SC19ΔpotD attenuated strain can effectively stimulate the body to produce a specific immune response.

[0023] (3) Broad spectrum: After immunizing the body with the attenuated strain SC19ΔpotD, it has a certain protective effect against infections with Streptococcus suis and Streptococcus pneumoniae, and can be used for the prevention and treatment of combined infections with Streptococcus suis and Streptococcus pneumoniae.

[0024] At present, there is no commercially available effective gene-deficient vaccine against Streptococcus suis type 2 in China. The development of this vaccine can effectively prevent Streptococcus suis type 2 infection and reduce the economic losses to the breeding industry caused by the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The amplification results of the upstream and downstream homology arms of the target gene potD, where M is the marker of DL2000; 1 is the upstream homology arm; 2 is the downstream homology arm.

[0026] Figure 2The double enzyme digestion identification results of the potD gene deleted recombinant plasmid pSET4s-ΔpotD, where M: DL2000 marker; 1-4: double enzyme digestion identification results of pSET4s-ΔpotD.

[0027] Figure 3 The nucleic acid results of PCR verification of the gene-deficient strain SC19ΔpotD, where M: DL5000 marker; 1: SC19; 2-7: PCR identification of suspected strains to screen out the target strains; 6-7: successfully constructed SC19ΔpotD.

[0028] Figure 4 The results of the genetic stability study of the gene-deficient strain SC19ΔpotD are shown in Figure 1. M: Marker of DL2000; 1: wild strain SC19; 2: SC19ΔpotD.

[0029] Figure 5 are the bacterial chain lengths of the wild strain SC19 and the gene-deficient strain SC19ΔpotD.

[0030] Figure 6 Shown are the growth curves of the wild strain SC19 and the gene-deficient strain SC19ΔpotD.

[0031] Figure 7 These are the biofilm test results of the wild strain SC19 and the gene-deficient strain SC19ΔpotD.

[0032] Figure 8 These are the results of colony counts in mouse tissues and organs of the wild strain SC19 and the gene-deficient strain SC19ΔpotD.

[0033] Fig. 9 The results are for the determination of mouse serum antibody titer.

[0034] Fig.10 This is the immune protective effect of the attenuated vaccine of the gene-deficient strain SC19ΔpotD on mice infected with Streptococcus SC19.

[0035] Fig.11 This is the immune protective effect of the attenuated vaccine of the gene-deleted strain SC19ΔpotD on mice infected with Streptococcus P1 / 7.

[0036] Fig.12 This is the immune protective effect of the attenuated vaccine of the gene-deleted strain SC19ΔpotD against mice infected with Streptococcus pneumoniae D39. DETAILED DESCRIPTION

[0037] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0038] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0039] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out in accordance with conventional test methods or the operating instructions recommended by the supplier. Among them:

[0040] The wild-type strain SC19 of Streptococcus suis type 2 is numbered MNPY00000000.1 in GenBank. Streptococcus suis P1 / 7 is described in the document “Serotype distribution and production of muramidase-released protein, extracellular factor and suilysin by field strains of Streptococcus suis isolated in the United States.” Veterinary Microbiology 156(3-4):290-296.” Streptococcus pneumoniae D39 is described in the document “Genome sequence of Avery's virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6.” Journal of Bacteriology, 189(1), 38-51.”

[0041] Example 1: Construction of the Streptococcus suis type 2 potD gene-deficient recombinant plasmid pSET4sΔpotD

[0042] 1. Amplification of upstream and downstream homology arms of potD gene:

[0043] Using the genome of wild-type strain SC19 of Streptococcus suis type 2 as a template, the upstream and downstream homologous arm fragments on both sides of the potD gene were amplified according to the primers Up-potD-F / Up-potD-R and Down-potD-F / down-potD-R in Table 1, and the upstream and downstream homologous arms of the potD gene were connected and recovered.

[0044] Table 1: Primers for construction of gene deletion strains

[0045]

[0046] Reaction system: 2×Taq Master PCR Mix 25μL, DNA template 1μL, Forward primer (20μM) 1μL, Reverse primer (20μM) 1μL, ddH 2 Add HO to 50 μL.

[0047] Reaction procedure: 95℃5min, 94℃1min, 55℃30s, 72℃1min, 30 cycles, 72℃10min. The PCR product was recovered and purified according to the instructions of the PCR product purification kit of BIOMIGA. 2μL was taken for concentration detection. The results are as follows: Figure 1 , and successfully amplified upstream and downstream homology arms with a size of 1000 bp.

[0048] 2. Knockout plasmid extraction and enzyme digestion:

[0049] Extraction of pSET4s plasmid: After activating, streaking and expanding the stored pSET4s bacterial solution, extract the plasmid according to the instructions of the plasmid extraction kit, and take 5 μL for 1% agarose gel electrophoresis detection. The extracted plasmid pSET4s was double-digested: EcoRI and BamHI; digestion procedure: 37°C, 30 min; digestion system: pSET4s plasmid 34 μL, EcoRI 1 μL, BamHI 1 μL, 10×cutsmart buffer 4 μL.

[0050] 3. Connect the plasmid digestion products to the upstream and downstream homology arms:

[0051] The pSET4s double-enzyme digestion product was recovered, and then the amplified potD gene upstream and downstream homology arm fragments were inserted into the pSET4s plasmid after enzyme digestion.

[0052] Ligation system: pSET4s digestion product (≈100ng) 2μL, upstream homology arm recovery product (about 8ng) 1μL, downstream homology arm recovery product (about 8ng) 1μL, 2×ClonExpress Mi 10μL, ddH 2Add HO to 20 μL.

[0053] The connection procedure is: 37°C, 30 min, place in an ice water bath after inversion, cool for 5 min, and store at -20°C.

[0054] 4. Transform the ligation product into competent E. coli cells and screen positive clones:

[0055] Take 10 μL of the cooled reaction solution after ligation, add it to 100 μL of E. coli competent cells, mix well, place on ice for 30 minutes, treat at 42℃ for 90 seconds, and ice bath for 2 minutes. Add 900 μL of LB medium and incubate at 30℃ for 10 minutes to recover. Shake in a shaker at 30℃ for 90 minutes, take 100 μL of bacterial solution and evenly spread it on a plate containing antibiotics, and culture it in a 30℃ incubator overnight. Pick several clones on the plate for colony PCR amplification, and identify the products by double enzyme digestion. The electrophoresis results of the recombinant plasmid are as follows: Figure 2 As shown. At the same time, the plasmid was sent to Sangon Biotech Co., Ltd. for sequencing. The sequencing results showed that the present invention successfully constructed a recombinant vector (pSET4sΔpotD) with a potD gene deletion.

[0056] Example 2: Construction and identification of gene-deleted strain SC19ΔpotD

[0057] 1. Electroporation of potD gene-deficient recombinant plasmid pSET4sΔpotD:

[0058] Add 10 μL of the potD gene-deficient recombinant plasmid pSET4sΔpotD prepared in Example 1 to the SC19 competent cells, mix gently, and place on ice for 2 minutes; transfer the mixed solution to a cooled electric shock cup and place on ice for 2 minutes; electric shock: voltage 2500 V, resistance 500 ohms, time 5 ms; immediately after the electric shock, add THB culture medium, mix well and transfer to an EP tube; preheat at 30°C for 10 minutes, and culture on a shaker at 37°C for 2 to 3 hours; take 100 μL of the cultured bacterial solution and spread it on a THB plate containing 100 μg / mL spectinomycin, culture at 37°C for 2 days, and observe the results.

[0059] 2. Screening and identification of attenuated strain of Streptococcus suis type 2 SC19ΔpotD:

[0060] (1) Pick a single colony grown in step 1 and place it in THB liquid medium (containing 100 μg / mL spectinomycin) and culture it at 37°C overnight;

[0061] (2) Dilute the bacterial solution and spread it on THB solid medium (containing spectinomycin) (100 μg / mL) and culture at 37°C for 12 h;

[0062] (3) Select a single colony that has grown, place it in THB liquid medium (without spectinomycin), culture it at 30°C overnight, transfer it to new THB liquid medium (without spectinomycin) at a ratio of 1:5 and continue culturing at 30°C, and transfer the culture three times;

[0063] (4) After continuous culture, the bacterial solution was graded and spread on THB solid medium (without spectinomycin) and cultured at 37°C overnight;

[0064] (5) Perform colony PCR screening using primers for the target gene potD until the mutant strain SC19ΔpotD lacking the potD gene is selected.

[0065] The primers used for PCR identification of deletion bacteria are as follows:

[0066] potD-F: CAAGAAATGGCTCGTTTGACACAT;

[0067] potD-R: TAAAGGCATAGGCTTTCAGCAAA.

[0068] Reaction system: 2×Taq Master PCR Mix 10μL, DNA template 1μL, forward primer (20μM) 1μL, reverse primer (20μM) 1μL, ddH 2 O 7 μL.

[0069] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 90 s, 35 cycles, extension at 72°C for 10 min, and cooling at 16°C.

[0070] PCR identification results Figure 3 As shown, the results showed that the wild strain could amplify a band of 2000 bp in size, while the mutant strain SC19ΔpotD could not amplify a band of the same size as the wild strain. Therefore, it was preliminarily determined that the deletion strain was a mutant strain with a deletion of the potD gene.

[0071] The potD gene deletion mutant identified by PCR was further subjected to genome resequencing (Sangon Biotechnology), and the results showed that the potD gene was deleted in the mutant strain SC19ΔpotD.

[0072] The above results prove that the present invention successfully constructed the potD gene deletion strain SC19ΔpotD.

[0073] Example 3: Genetic stability of gene-deleted strain SC19ΔpotD

[0074] The potD gene-deficient strain SC19ΔpotD of Streptococcus suis type 2 constructed in Example 2 was continuously passaged for 30 generations, and then the potD gene-deficient strain SC19ΔpotD after continuous passage was intraperitoneally challenged with mice; the wild-type strain SC19 of Streptococcus suis type 2 was used as a control. Single colonies were immediately isolated and purified from the organ tissues of the mice after death, and the expression of the potD gene was detected by PCR.

[0075] The results are as follows Figure 4 As shown, after continuous passage, the potD gene deletion strain SC19ΔpotD did not show gene recovery, indicating that the gene deletion strain SC19ΔpotD has good genetic stability.

[0076] Example 4: Changes in bacterial chain length in the gene-deleted strain SC19ΔpotD

[0077] 1. Bacterial culture:

[0078] The wild strain SC19 and the gene-deficient strain SC19ΔpotD constructed in Example 2 were cultured in THB liquid culture medium at 37°C and 220 rpm on a shaker. An appropriate amount of the cultured bacterial solution was taken, and a small amount of the bacterial solution was dipped with a sterile inoculation loop and evenly smeared on a clean glass slide to ensure that the smear was thin and uniform for easy observation.

[0079] 2. Drying and fixing:

[0080] Allow the smear to dry naturally or blow dry with a hair dryer on cold air, then fix it by passing it quickly over the flame of an alcohol lamp several times to firmly attach the bacteria to the slide.

[0081] 3. Dyeing:

[0082] The smears were stained using the Gram stain method.

[0083] Initial staining: Add drops of crystal violet stain, stain for 1-2 minutes, then gently rinse with clean water.

[0084] Mordanting: Add iodine solution, let it act for 1-2 minutes, then rinse with clean water.

[0085] Decolorization: Use 95% ethanol solution for decolorization. The decolorization time is generally 20-30 seconds, until the outflowing ethanol has no obvious color, and then rinse with clean water immediately.

[0086] Re-dyeing: Add safranin dye solution, re-dye for 1-2 minutes, then rinse with clean water and dry with absorbent paper.

[0087] 4. Microscope observation and measurement:

[0088] Place the stained smear under a microscope for observation. First use a low-power microscope to find the field of view where the bacteria are located, then switch to a high-power microscope or oil objective for careful observation. Observe the morphology and chain arrangement of Streptococcus suis SC19, and use tools such as an eyepiece micrometer or image analysis software to measure the length of the bacterial chain. Randomly select multiple fields of view and different bacterial chains for measurement to obtain more accurate data.

[0089] The results are as follows Figure 5 As shown, there was no significant change in the gene deletion strain SC19ΔpotD compared with the wild-type strain SC19.

[0090] Example 5: Growth curve of gene-deficient strain SC19ΔpotD

[0091] Equal amounts of wild strain SC19 and gene deletion strain SC19ΔpotD constructed in Example 2 were inoculated into THB liquid medium and cultured in a shaking incubator at 37°C and 220 rpm. 1 mL of bacterial solution was taken into a cuvette every 1 h and the OD values ​​were read using a spectrophotometer. 600 The absorbance value was recorded and the bacterial growth curve in vitro was drawn.

[0092] The results are as follows Figure 6 As shown, before 4 hours, there was no significant difference in growth rate between the gene-deficient strain SC19ΔpotD and the wild-type strain SC19. After 4 hours, a difference appeared between the two. After reaching the stable period, at around 10 hours, the wild-type strain SC19 was slightly faster than the gene-deficient strain SC19ΔpotD.

[0093] Example 6: Biofilm experiment of gene-deleted strain SC19ΔpotD

[0094] 1. Bacterial culture and biofilm formation:

[0095] The wild-type strain SC19 and the gene-deficient strain SC19ΔpotD constructed in Example 2 were inoculated into THB liquid medium and cultured at 37°C and 220 rpm in a shaker until the logarithmic growth phase. 100 μL of the cultured bacterial solution was inoculated into a 24-well plate and cultured at 37°C for 24-48 hours.

[0096] 2. Staining and fixation:

[0097] After the culture is completed, discard the culture medium and rinse gently with PBS three times to remove unattached bacteria and impurities. Add 200μL of methanol solution to each well for fixation, discard the methanol solution after 15 minutes, and air dry. After fixation, rinse once with PBS, air dry, add 200μL of 0.1% crystal violet to each well for staining for 15-20 minutes to fully stain the bacteria and extracellular polymers in the biofilm. After staining, rinse slowly with PBS three times to remove unbound crystal violet dye, and decolorize the stained biofilm with 95% ethanol solution after air drying. Generally, decolorize for 1-5 minutes until the ethanol solution no longer changes color to remove excess crystal violet dye to make the staining results more accurate.

[0098] 3. Observation and quantification:

[0099] The morphology, structure and distribution of the biofilm in the 24-well plate after decolorization were observed. The absorbance value at a wavelength of 595 nm was measured using an ELISA reader to quantitatively analyze the amount of the biofilm.

[0100] The results are as follows Figure 7 As shown, by comparing with the wild strain SC19, it was found that the biofilm formation ability of the attenuated strain of Streptococcus suis type 2 SC19ΔpotD was significantly weakened.

[0101] Example 7: Colony counting experiment of gene deletion strain SC19ΔpotD

[0102] The wild strain SC19 and the gene deletion strain SC19ΔpotD constructed in Example 2 were inoculated in THB liquid medium, cultured at 37°C, 220 rpm in a shaking incubator, and transferred after 12 h. 8 The mice were challenged with the drug at a dose of CFU. After 24 hours, the mouse tissues and organs were collected in a sterile environment, and the tissue and organ samples were homogenized. 100 μL of the 1:10 sample homogenate was taken with a 100 μL micropipette, and slowly injected into a sterile test tube containing 900 μL of diluent along the tube wall. The test tube was shaken to mix it evenly to make a 1:100 sample homogenate. Select the sample homogenate with the appropriate dilution. When diluting it 10 times in increments, take 10 μL of the sample and drop it into the sterile THB solid culture medium. Repeat 3 times for each dilution. At the same time, take 10 μL of blank dilution as a blank control. After the dilution solidifies, turn the solid culture medium over and culture it at 36℃±1℃ for 48h±2h. After the culture is completed, remove the culture medium, observe it with the naked eye, record the dilution multiple and the corresponding number of colonies, and the colony count is expressed in colony forming units (CFU).

[0103] The results are as follows Figure 8 As shown, the bacterial colonization level of the gene-deficient strain SC19ΔpotD in tissues and organs was significantly lower than that of the wild-type strain SC19.

[0104] Example 8: Virulence experiment of gene-deleted strain SC19ΔpotD (LD 50 )

[0105] 80 female mice weighing 18-20 g and in similar physiological state were randomly divided into 10 groups, with 8 mice in each group. Five groups were injected intraperitoneally with 1.5×10 9 , 1×10 9 , 4×10 8 , 2.5×10 8 and 1×10 8 CFU of wild strain SC19; the other five groups were injected intraperitoneally with a dose of 2.5×10 9 , 1×10 9 , 5×10 8 , 2.5×10 8 and 1×10 8 CFU of the gene deletion strain SC19ΔpotD constructed in Example 2.

[0106] The mice were observed for 7 days after inoculation, and the status of the mice was recorded every 12 hours. The number of dead and alive mice within 7 days was recorded, and the LD of the wild strain SC19 and the gene deletion strain SC19ΔpotD was calculated. 50 .

[0107] The results are shown in Table 2.

[0108] Table 2: Toxicity test results

[0109]

[0110] The results showed that when infected with the same dose of wild strain SC19 and gene-deficient strain SC19ΔpotD, the number of surviving mice infected with the gene-deficient strain SC19ΔpotD was significantly higher than that infected with the wild strain SC19.

[0111] The LD of the gene-deleted strain SC19ΔpotD was calculated. 50 1.5×10 9 CFU, compared with wild strain (LD 50 =4×10 8 The LD50 of the mutant strain increased by about 3.75 times compared with that of the mutant strain CFU, indicating that the virulence of the gene-deficient strain SC19ΔpotD decreased.

[0112] Example 9: Antibody titers in intramuscularly immunized mice

[0113] The dose was 2.5 × 10 8The CFU gene-deficient strain SC19ΔpotD and PBS buffer were used to immunize mice by intramuscular route, and the serum was collected for 7 weeks. The antibody level was detected by indirect ELISA method. Fig. 9 , antibody levels showed an upward trend during the period of 7-28 days and stabilized after 28 days.

[0114] In the antibody titer test on the 21st day, the highest antibody titer in the tested mouse serum reached 1:25600, indicating that the attenuated strain SC19ΔpotD has a good immune effect.

[0115] Example 10: Immunoprotective experiment of gene-deleted strain SC19ΔpotD

[0116] Thirty female mice weighing 18-20 g and in similar physiological state were randomly divided into 6 groups, with 5 mice in each group. Groups 1-3 were used as immune groups (SC19ΔpotD), and 2.5×10 8 CFU: The gene-deficient strain SC19ΔpotD constructed in Example 2; Groups 4-6 were used as the control group (Control), and an equal volume of PBS was injected intraperitoneally.

[0117] 21 days after immunization, the same dose (5×10 8 CFU) of wild-type Streptococcus suis SC19 in one group and four groups in the control group; the same dose (5×10 8 CFU) of Streptococcus suis P1 / 7 challenge group and 5 groups of the control group; the same dose (1×10 7 CFU) of Streptococcus pneumoniae D39 challenge immunization group and 6 groups in the control group.

[0118] The mice were observed for 10 days after infection, and the status of the mice was recorded every day. The number of surviving mice was counted, and the survival rate of the mice was calculated.

[0119] And evaluate the cross-immune protection effect of the mutant strains.

[0120] The results are as follows Figure 10-12 As shown, for the experimental mice in the control group, all died within 2 days after the SC19 challenge, while the mice in the immunized group still survived within 10 days. The experimental mice in the control group all died within 3 days after the P1 / 7 challenge, while the mice in the immunized group still survived within 10 days. The experimental mice in the control group all died within 5 days after the Streptococcus pneumoniae D39 challenge, while the survival rate of the mice in the immunized group was still 40% within 10 days.

[0121] The above results show that mice with the gene-deficient strain SC19ΔpotD in muscle immunity can resist infection with the same serotype (SC19 and P1-7) and Streptococcus pneumoniae (D39), with the former immune protection rate being 100% and the latter being 40%, showing cross-immune protection. The attenuated vaccine prepared using the gene-deficient strain SC19ΔpotD has a broad-spectrum immune activity and can be used for the prevention and treatment of combined infection with Streptococcus suis and Streptococcus pneumoniae.

[0122] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An attenuated strain of Streptococcus suis type 2 SC19ΔpotD, characterized in that: The potD gene is deleted in the genome of Streptococcus suis type 2 SC19 strain, and the nucleotide sequence of the potD gene is shown in SEQ ID No.

1.

2. The method for preparing the attenuated strain of Streptococcus suis type 2 SC19ΔpotD according to claim 1, characterized in that: The following steps are involved: Using genomic DNA of Streptococcus suis type 2 SC19 strain as a template, respectively amplifying the upstream homology arm and the downstream homology arm of the potD gene; cloning the upstream homology arm and the downstream homology arm of the potD gene into the pSET4s plasmid to obtain the gene-deleted recombinant plasmid pSET4sΔpotD; The gene-deleted recombinant plasmid pSET4sΔpotD was transferred into SC19 competent cells to prepare the attenuated strain of Streptococcus suis type 2 SC19ΔpotD.

3. The preparation method according to claim 2, characterized in that: The upstream homology arm of the potD gene was amplified using the primer Up-potD-F shown in SEQ ID No.2 and the primer Up-potD-R shown in SEQ ID No.3; the downstream homology arm of the potD gene was amplified using the primer Down-potD-F shown in SEQ ID No.4 and the primer Down-potD-R shown in SEQ ID No.

5.

4. The preparation method according to claim 2, characterized in that: The method for cloning the upstream homology arm and the downstream homology arm of the potD gene into the pSET4s plasmid is as follows: the pSET4s plasmid is digested with EcoRI and BamHI restriction endonucleases respectively, and the upstream homology arm and the downstream homology arm of the potD gene are connected to the digested pSET4s plasmid.

5. The preparation method according to claim 2, characterized in that: The gene-deficient recombinant plasmid pSET4sΔpotD was transformed into SC19 competent cells by electroporation; the electroporation voltage was 2500V, the resistance was 500 ohms, and the electroporation time was 5ms.

6. Use of the attenuated strain of Streptococcus suis type 2 SC19ΔpotD according to claim 1 in the preparation of attenuated vaccines.

7. The use according to claim 6, characterized in that: The vaccine can prevent or treat infections caused by Streptococcus suis type 2 SC19, Streptococcus suis type 2 P1 / 7 and / or Streptococcus pneumoniae D39.

8. A broad-spectrum Streptococcus suis vaccine, characterized in that: The broad-spectrum Streptococcus suis vaccine uses the attenuated strain of Streptococcus suis type 2 SC19ΔpotD described in claim 1 as an active ingredient.

Images