Homologous gene replaced recombinant attenuated infectious hematopoietic necrosis virus and application thereof as vaccine
Patent Information
- Application Number
- CN202510159237.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-13
- Publication Date
- 2025-05-23
AI Technical Summary
The lack of effective IHN vaccines in the prior art has led to the inability to effectively prevent and control fish infectious diseases caused by infectious hematopoietic organ necrosis viruses, especially in salmon family fish, resulting in serious economic losses and threats.
Through homologous gene replacement, recombinant attenuated infectious hematopoietic organ necrosis virus was constructed. Specifically, recombinant virus strains such as IHNVJ-PU, IHNVJ-LaU and IHNVJ-LbU were formed by replacing the specific gene or fragment of the infectious hematopoietic organ necrosis virus Sn1203 strain with the corresponding gene or fragment of the BLk94 strain. These recombinant virus strains were used as vaccines to obtain recombinant attenuated viruses by co-transfection of BHK-21 cells and helper plasmids and rescued by EPC cells, and ultimately used to immunize rainbow trout.
The virility of recombinant attenuated infectious hematopoietic organ necrosis virus is significantly reduced, and it has a good immune protection effect on rainbow trout, which can effectively prevent secondary infection of IHN virus, and has potential application value in the development of infectious hematopoietic organ necrosis virus vaccine.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant attenuated infectious hematopoietic necrosis virus with homologous gene replacement and its application as a vaccine. Background Art
[0002] Infectious haematopoietic necrosis virus (IHNV) is a member of the Rhabdoviridae family. Rhabdoviridae ), NoraRhabdovirus ( Novirhabdovirus ), is a single-stranded negative-strand RNA virus with a total length of about 11 kb, containing six genes, encoding viral nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), nonstructural protein (NV) and polymerase protein (L). Based on the G protein gene sequence, IHNV worldwide can be divided into five genotypes: U, M, L, E and J.
[0003] Infectious hematopoietic necrosis (IHN) is an acute fish infectious disease caused by the infectious hematopoietic necrosis virus, which is susceptible to most salmonids. It is listed as a Class II animal disease in my country. The World Organization for Animal Health lists it as an animal disease that must be reported for import and export trade.
[0004] Due to differences in viral gene groups, host species, and environmental conditions, some IHNV strains can cause mortality rates of up to 90-100% in sick rainbow trout, which has caused huge economic losses and threats to the salmon and trout farming industry. Vaccines are an important strategy to prevent the occurrence and deterioration of viral diseases. Currently, only Canada has an IHN vaccine on the market, and no other country has an IHN vaccine available. Therefore, the invention of a safe and effective IHN vaccine is of great significance for the prevention of IHN. Summary of the invention
[0005] The purpose of the present invention is to provide a recombinant attenuated infectious hematopoietic necrosis virus with homologous gene replacement and its application as a vaccine.
[0006] In a first aspect, the present invention claims a recombinant attenuated infectious hematopoietic necrosis virus.
[0007] The recombinant attenuated infectious hematopoietic necrosis virus claimed for protection in the present invention is different from the infectious hematopoietic necrosis virus Sn1203 strain, the only difference being that a specific gene or a fragment thereof in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced with a corresponding gene or a fragment thereof in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; wherein the specific gene is the P gene or the L gene.
[0008] Among them, the cDNA sequence corresponding to the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is GenBank: MT242597.1.
[0009] In the implementation case of the present invention, the recombinant attenuated infectious hematopoietic necrosis virus is specifically any one of the following: (A1) IHNV J -P U ; The IHNV J -P U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the P gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the P gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; (A2) IHNV J -La U ; The IHNV J -La U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the 3' end part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the 3' end part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; (A3) IHNV J -Lb U ; The IHNV J -Lb U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the middle part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the middle part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain.
[0010] Furthermore, the nucleotide sequence of the P gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is shown as SEQ ID No.1 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide); the nucleotide sequence of the P gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain is shown as SEQ ID No.2 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide).
[0011] Further, the nucleotide sequence of the L gene in the genomic RNA of the Sn1203 strain of infectious hematopoietic necrosis virus is shown in SEQ ID No.3 (the sequence is listed in the direction from 3' to 5' of RNA, wherein T represents uracil nucleotide); the nucleotide sequence of the L gene in the genomic RNA of the BLk94 strain of infectious hematopoietic necrosis virus is shown in SEQ ID No.4 (the sequence is listed in the direction from 3' to 5' of RNA, wherein T represents uracil nucleotide). Accordingly, in (A2), the 3' end of the L gene in the genomic RNA of the Sn1203 strain of infectious hematopoietic necrosis virus is divided into positions 1-2011 of SEQ ID No.3 (the sequence is listed in the direction from 3' to 5' of RNA, wherein T represents uracil nucleotide); the 3' end of the L gene in the genomic RNA of the BLk94 strain of infectious hematopoietic necrosis virus is divided into positions 1-2011 of SEQ ID No.4 (the sequence is listed in the direction from 3' to 5' of RNA, wherein T represents uracil nucleotide). In (A3), the middle part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is positions 2012-4132 of SEQ ID No.3 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide); the middle part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain is positions 2012-4132 of SEQ ID No.4 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide).
[0012] Furthermore, in (A1), the IHNV J -P U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the P gene shown in SEQ ID No.1 in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the P gene shown in SEQ ID No.2 in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain.
[0013] Furthermore, in (A2), the IHNV J -La U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the 1st to 2011th positions of the L gene shown in SEQ ID No.3 in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain are replaced by the 1st to 2011th positions of the L gene shown in SEQ ID No.4 in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain.
[0014] Furthermore, (A3) IHNV J -Lb U ; The IHNV J -Lb U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the 2012-4132th position of the L gene shown in SEQ ID No.3 in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the 2012-4132th position of the L gene shown in SEQ ID No.4 in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain.
[0015] In a second aspect, the present invention claims a method for preparing the recombinant attenuated infectious hematopoietic necrosis virus described in the first aspect above.
[0016] The method for preparing the recombinant attenuated infectious hematopoietic necrosis virus described in the first aspect above, which is claimed to be protected by the present invention, may include the following steps: co-transfecting BHK-21 cells with a recombinant plasmid containing a cDNA sequence corresponding to the genomic RNA of the recombinant attenuated infectious hematopoietic necrosis virus and an auxiliary plasmid, and then inoculating the culture supernatant into EPC cells to obtain the recombinant attenuated infectious hematopoietic necrosis virus.
[0017] Furthermore, in the recombinant plasmid, the promoter for initiating the expression of the cDNA sequence corresponding to the genomic RNA of the recombinant infectious hematopoietic necrosis virus is a T7 promoter. In the recombinant plasmid, the terminator for terminating the expression of the cDNA sequence corresponding to the genomic RNA of the recombinant infectious hematopoietic necrosis virus is a T7 terminator.
[0018] Furthermore, there are a total of 4 auxiliary plasmids: auxiliary plasmid 1 containing the cDNA sequence corresponding to the N gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain; auxiliary plasmid 2 containing the cDNA sequence corresponding to the P gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain; auxiliary plasmid 3 containing the cDNA sequence corresponding to the NV gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain; auxiliary plasmid 4 containing the cDNA sequence corresponding to the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain. In the implementation case of the present invention, the auxiliary plasmid 1 is specifically obtained by purifying the N gene PCR product of the rIHNV-Sn1203 strain and connecting it into the pHelp vector; the auxiliary plasmid 2 is specifically obtained by purifying the P gene PCR product of the rIHNV-Sn1203 strain and connecting it into the pHelp vector; the auxiliary plasmid 3 is specifically obtained by purifying the NV gene PCR product of the rIHNV-Sn1203 strain and connecting it into the pHelp vector; the auxiliary plasmid 4 is specifically obtained by purifying the L gene PCR product of the rIHNV-Sn1203 strain and connecting it into the pHelp vector.
[0019] Furthermore, when the co-transfection is performed, the mass ratio of the recombinant plasmid, the auxiliary plasmid 1, the auxiliary plasmid 2, the auxiliary plasmid 3 and the auxiliary plasmid 4 is 2.0:0.5:0.4:0.4:0.25.
[0020] Furthermore, in the method, after transfecting BHK-21 cells, the step of incubating at 37° C. for 7 h and then culturing at 15° C. for 6 days is also included. The culture supernatant is then inoculated into a monolayer of EPC cells, and when a cytopathic effect is observed, the recombinant attenuated infectious hematopoietic necrosis virus is harvested.
[0021] In a third aspect, the present invention claims protection for any of the following biological materials: (B1) an in vitro animal cell or recombinant bacterium containing the recombinant attenuated infectious hematopoietic necrosis virus described in the first aspect above; (B2) a vector containing the genomic RNA or cDNA of the recombinant attenuated infectious hematopoietic necrosis virus described in the first aspect above; (B3) A vaccine containing the recombinant attenuated infectious hematopoietic necrosis virus as described in the first aspect above.
[0022] In a fourth aspect, the present invention claims protection for any of the following applications: (C1) Use of the recombinant attenuated infectious hematopoietic necrosis virus described in the first aspect above or the biological material described in the third aspect above in the preparation of a product for preventing and / or treating diseases caused by infectious hematopoietic necrosis virus infection; (C2) Use of the recombinant attenuated infectious hematopoietic necrosis virus described in the first aspect or the biological material described in the third aspect in the preparation of a product for inhibiting infectious hematopoietic necrosis virus infection.
[0023] Wherein, the product may be a vaccine or a medicine.
[0024] In one embodiment of the present invention, the infected object is rainbow trout.
[0025] The present invention uses the IHNV subgroup JC model strain Sn1203 (wtIHNV J ) Complete genome cDNA plasmid pIHNV J The P, M, G, NV, and L genes were replaced with the genotype U model strain BLk94 (wtIHNV U ) to obtain the corresponding gene fragment, and obtain the plasmid pIHNV J , pIHNV J -M / G / NV U , pIHNV J -P U , pIHNV J -M U , pIHNV J -La U and pIHNV J -Lb U The above target plasmid and auxiliary plasmid were co-transfected into cells, and the recombinant chimeric virus rIHNV was successfully harvested J , rIHNV J -M / G / NV U , rIHNV J -P U , rIHNV J -M U , rIHNV J -La U and rIHNV J -Lb U The recombinant virus was used to infect rainbow trout and its virulence was similar to that of wtIHNV. J Compared with the previous infection, the recombinant virus rIHNV was found to be significantly lower. J -P U , rIHNV J -La U and rIHNV J -LbU It has a good immune protection effect on rainbow trout and can be used in the research and development of attenuated vaccines for infectious hematopoietic necrosis disease, with potential application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 Schematic diagram of partial gene replacement in the recombinant virus genome (5'-3' sequence of the whole genome cDNA. Since the virus is a single-stranded RNA virus, the sequence of the cDNA shown in the figure is exactly opposite to the direction of the genome RNA).
[0027] Figure 2 Figure 2 is a graph showing the cytopathic effect of the recombinant virus on EPCs. Negative Control is a negative control without inoculation of the recombinant virus.
[0028] Figure 3 The titer of the rescued recombinant virus in EPC cells.
[0029] Figure 4 is the cumulative mortality of rainbow trout infected with the recombinant virus.
[0030] Figure 5 is the cumulative mortality of rainbow trout secondary infection with LN15.
[0031] Figure 6 is the relative protection rate of the recombinant chimeric virus against rainbow trout. DETAILED DESCRIPTION
[0032] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0034] The cDNA sequence corresponding to the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain involved in the following examples is GenBank: MT242597.1.
[0035] The nucleotide sequence of the P gene in the genomic RNA of the Sn1203 strain of infectious hematopoietic necrosis virus involved in the following embodiments is shown in SEQ ID No.1 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide); the nucleotide sequence of the P gene in the genomic RNA of the BLk94 strain of infectious hematopoietic necrosis virus is shown in SEQ ID No.2 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide).
[0036] The nucleotide sequence of the L gene in the genomic RNA of the Sn1203 strain of infectious hematopoietic necrosis virus involved in the following embodiments is shown in SEQ ID No.3 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide); the nucleotide sequence of the L gene in the genomic RNA of the BLk94 strain of infectious hematopoietic necrosis virus is shown in SEQ ID No.4 (the sequence is listed in the direction from 3' to 5' of RNA, where T represents a uracil nucleotide).
[0037] Example 1. Construction and application of recombinant attenuated infectious hematopoietic necrosis virus 1. Experimental Materials Epithelioma papulosum cyprini cells (EPC) were cultured at 25°C in MEM medium containing 10% fetal bovine serum (FBS), 100 U / ml penicillin and 100 μg / mL streptomycin (MEM growth medium).
[0038] Genogroup U model strain BLk94 (wtIHNV U ) was kindly provided by Gael Kurath, Researcher at the Western Fisheries Research Center, U.S. Geological Survey.
[0039] Subgroup JC genotype type strain Sn1203 (wtIHNV J ) was isolated and preserved in our laboratory. The Genbank accession number of this strain is MT242597.1.
[0040] Specific pathogen-free rainbow trout (6.58 ± 1.03 g) were purchased from Benxi Aigmorin Industrial Co., Ltd. (triploid rainbow trout eyed eggs were sourced from Spain), cultured in a circulating water system at 15 °C, and fed once daily.
[0041] 2. Experimental Methods 1. Recombinant chimeric virus full-length cDNA cloning In this example, a total of 6 recombinant chimeric virus full-length cDNA plasmids were constructed, and the P, M, G, NV, and L genes in the IHNV Sn1203 isolate were replaced individually or in combination with the P, M, G, NV, and L genes in the IHNV BLk94 isolate, and the corresponding full-length cDNA plasmids were named pIHNV J , pIHNV J -M / G / NV U , pIHNV J -P U , pIHNV J -M U , pIHNV J -La U , pIHNV J -Lb U The gene replacement part is as follows Figure 1 As shown, the red part represents the gene fragment of the Sn1203 isolate and the green part represents the gene fragment of the BLk94 isolate.
[0042] The full-length cDNA plasmid pIHNV of the two J-type and U-type strains was used J (Plasmid structure: The full-length cDNA sequence of IHNV-Sn1203 strain was cloned into the pBluescript SK vector. The plasmid is “pIHNV-Sn1203” described in “Zhao JZ, Xu LM, Zhang Z-Y, et al. Recovery of recombinant infectious hematopoietic necrosis virus strain Sn1203 using the mammalian cell line BHK21[J]. Journal of Virological Methods, 2019, 265: 84–90.”) and pIHNV U(Plasmid structure: The full-length cDNA sequence of the IHNV-blk94 strain was cloned into the pBluescript SK vector. The plasmid is described in “Zhao JZ, Liu M, Xu LM, et al. A chimeric recombinant infectious hematopoieticnecrosis virus induces protective immune responses against infectious hematopoietic necrosis and infectious pancreatic necrosis in rainbow trout[J]. Molecular Immunology, 2019, 116: 180–190.” “pIHNV-Blk94”) as a template, and the vector fragment and the replacement gene fragment were PCR amplified using KOD FX Neo (KFX-201, TOYOBO, Osaka, Japan). The amplification primers are shown in Table 1.
[0043] Table 1. Amplification primers
[0044] The amplified product was digested with Dpn I to remove the template and purified using EZNA™ gel&PCR Clean Up Kit (D2000-02, Omega, Georgia, USA). The vector fragment and the replacement fragment were reacted at 50°C for 15 minutes using In-Fusion®Snap Assembly Master Mix (Cat#639649, TaKaRa, San Jose, USA). The ligation product was transformed into E. coli competent cells DH5α, and a single colony was randomly inoculated in 1 ml LB medium and shaken at 37°C at 180 rpm for 12-16 hours. The colony was sequenced and identified by Arrow Gene (Harbin, China). After the identification was correct, the plasmid was extracted.
[0045] Plasmid pIHNV J It is a plasmid containing the full-length cDNA of IHNV Sn1203 isolate. The promoter used to initiate cDNA transcription is T7, and the terminator is T7.
[0046] Recombinant plasmid pIHNV J -M / G / NV U To insert plasmid pIHNV JThe plasmid obtained by replacing the M gene, G gene and NV gene in the full-length cDNA of the IHNV Sn1203 isolate with the M gene, G gene and NV gene in the IHNV BLk94 isolate.
[0047] Recombinant plasmid pIHNV J -P U To transfer plasmid pIHNV J The plasmid obtained by replacing the P gene (SEQ ID No. 1, wherein T represents thymidine deoxynucleotide) in the full-length cDNA of the IHNV Sn1203 isolate with the P gene (SEQ ID No. 2, wherein T represents thymidine deoxynucleotide) in the IHNV BLk94 isolate.
[0048] Recombinant plasmid pIHNV J -M U To insert plasmid pIHNV J The plasmid obtained after the M gene in the full-length cDNA of the IHNV Sn1203 isolate was replaced with the M gene in the IHNV BLk94 isolate.
[0049] Recombinant plasmid pIHNV J -La U To transfer plasmid pIHNV J The plasmid obtained by replacing the 5' end part of the L gene in the full-length cDNA of the IHNV Sn1203 isolate (positions 1-2011 of SEQ ID No.3, wherein T represents thymidine deoxynucleotide) with the 5' end part of the L gene in the IHNV BLk94 isolate (positions 1-2011 of SEQ ID No.4, wherein T represents thymidine deoxynucleotide).
[0050] Recombinant plasmid pIHNV J -Lb U To transfer plasmid pIHNV J The plasmid obtained by replacing the middle part of the L gene in the full-length cDNA of the IHNV Sn1203 isolate (positions 2012-4132 of SEQ ID No.3, wherein T represents thymidine deoxynucleotide) with the middle part of the L gene in the IHNVBLk94 isolate (positions 2012-4132 of SEQ ID No.4, wherein T represents thymidine deoxynucleotide).
[0051] 2. Rescue of recombinant chimeric viruses The recombinant viral cDNA plasmid pIHNV constructed in step 1 J , pIHNV J -M / G / NV U , pIHNV J -PU , pIHNV J -M U , pIHNV J -La U , pIHNV J -Lb U and their auxiliary plasmids (pN, pP, pL, pNV) were transfected into BHK-21 cells respectively.
[0052] Among them, the auxiliary plasmids pN, pP, pL, and pNV are the pIH-N, pIH-P, pIH-L, and pIH-NV plasmids in the article "Zhao JZ, Xu LM, Zhang ZY, et al. Recovery of recombinant infectious hematopoietic necrosis virus strain Sn1203 using the mammalian cell line BHK21 [J]. Journal of Virological Methods, 2019, 265: 84–90." The structure is as follows: the PCR products of the N, P, L, and NV genes of the rIHNV-Sn1203 strain were purified and connected to the pHelp vector. The PCR primers are as follows (5'-3'): IHN-F: GGTACCAAACACGATAATACCATGACAAGCGCACTCAGAGAGACGT; IHN-R: GCTAGCTCGGATCTTAGGTCATCAGCGGAATGAATCGGAGTCTCCTGGCT.
[0053] IHP-F: GGTACCAAACACGATAATACCATGTCAGATGGAGAAGGAGAACA; IHP-R: GCTAGCTCGGATCTTAGGTCACTATTGACCTTGCTTCATGCGCTTCT.
[0054] IHL-F: GGTACCAAACACGATAATACCATGGACTTCTTCGATCTTGACATAGA; IHL-RGCTAGCTCGGATCTTAGGTCACTATTGTTCGCCTAGTGGA.
[0055] IHNv-F: GGTACCAAACACGATAATACCATGGACCACTGTGACACAAACACGA; IHNv-R:GCTAGCTCGGATCTTAGGTCACTATCTGGGATAAGCAAGAAAGTCT.
[0056] During transfection, the recombinant viral cDNA plasmid was 2 μg, and the auxiliary plasmids pN, pP, pL, and pNV were 0.5, 0.4, 0.25, and 0.4 μg, respectively. BHK-21 cells expressing T7 RNA polymerase were seeded in 6-well plates and transfected when the cells were 80-90% confluent. One hour before transfection, the medium in the 6-well plate was replaced with fresh DMEM growth medium. Plasmids and PolyJet™ in vitro DNA transfection reagent (SL100688, SignaGen, Maryland, USA) were diluted with 50 μL high-glucose DMEM, and the diluted PolyJet was immediately added to the diluted plasmid. After incubation at room temperature for 15 minutes, it was added to the 6-well plate. After incubation at 37°C for 7 hours, it was cultured at 15°C for 6 days. The cell culture supernatant was inoculated in a monolayer of EPC cells, and the recombinant virus rIHNV was harvested after the cytopathic effect was observed. J , rIHNV J -M / G / NV U , rIHNV J -P U , rIHNV J -M U , rIHNV J -La U , rIHNV J -Lb U .
[0057] Recombinant virus rIHNV J The rescued virus has a genomic RNA that is identical to the genomic RNA of the Sn1203 virus strain.
[0058] Recombinant virus rIHNV J -M / G / NV U The only difference between the genomic RNA of the Sn1203 virus strain and the genomic RNA of the Sn1203 virus strain is that the M gene, G gene and NV gene in the genomic RNA of the Sn1203 virus strain are replaced by the M gene, G gene and NV gene in the genomic RNA of the BLk94 virus strain, respectively.
[0059] Recombinant virus rIHNV J -P UThe only difference between the genomic RNA of the Sn1203 virus strain and the genomic RNA of the Sn1203 virus strain is that the P gene (SEQ ID No.1, wherein T represents a uracil nucleotide) in the genomic RNA of the Sn1203 virus strain is replaced by the P gene (SEQ ID No.2, wherein T represents a uracil nucleotide) in the genomic RNA of the BLk94 virus strain.
[0060] Recombinant virus rIHNV J -M U The only difference between the genomic RNA of the Sn1203 virus strain and the genomic RNA of the Sn1203 virus strain is that the M gene in the genomic RNA of the Sn1203 virus strain is replaced by the M gene in the genomic RNA of the BLk94 virus strain.
[0061] Recombinant virus rIHNV J -La U The only difference between the genomic RNA of the Sn1203 virus strain and the genomic RNA of the Sn1203 virus strain is that the 3' end part of the L gene in the genomic RNA of the Sn1203 virus strain (positions 1-2011 of SEQ ID No.3, wherein T represents a uracil nucleotide) is replaced by the 3' end part of the L gene in the genomic RNA of the BLk94 virus strain (positions 1-2011 of SEQ ID No.4, wherein T represents a uracil nucleotide).
[0062] Recombinant virus rIHNV J -Lb U The only difference between the genomic RNA of the Sn1203 virus strain and the genomic RNA of the Sn1203 virus strain is that the middle part of the L gene in the genomic RNA of the Sn1203 virus strain (positions 2012-4132 of SEQ ID No.3, wherein T represents a uracil nucleotide) is replaced by the middle part of the L gene in the genomic RNA of the BLk94 virus strain (positions 2012-4132 of SEQ ID No.4, wherein T represents a uracil nucleotide).
[0063] 3. Determination of the titer of recombinant chimeric virus EPC cells were pre-seeded in a 96-well plate and cultured at 20°C for 12 h to form a monolayer of cells. The virus in the culture dish (the recombinant virus prepared in step 2) was diluted 10 times, ranging from 10 -1 Up to 10 -8 100 μl of the diluted sample was inoculated into each well, and each well was repeated 8 times. After incubation at 15°C for 7 days, the cytopathic effect of each well was examined. The TCID of each strain was calculated using the Reed-Muench method. 50 .
[0064] 4. Virus expansion and cultivation After the EPC cells were digested with trypsin, an appropriate amount of MEM growth medium was added and the cells were counted and diluted to 4.5×10 5 100 mL of the diluted cell solution was transferred to a 2000 mL spinner flask and cultured at 25 °C for 5 days. The rotation speed was 17 rpm for the first 24 hours and 25 rpm thereafter. After 5 days, the old culture medium was discarded and replaced with 200 mL of MEM maintenance medium. The virus solution obtained in step 2 was diluted to 100 TCID 50 / 0.1mL dose was inoculated into the EPC cell monolayer confluent spinner flask, cultured at 15°C, and after more than 80% of the cells were detached, the virus solution was collected and stored in a -80°C refrigerator. The virus titer was determined as described in step 3.
[0065] 5. Infection test of recombinant chimeric virus on rainbow trout A total of 270 rainbow trout were randomly divided into 9 groups, with 30 trout in each group. J , wtIHNV U , rIHNV J , rIHNV J -M / G / NV U , rIHNV J -P U , rIHNV J -M U , rIHNV J -La U , rIHNV J -Lb U A total of 8 virus strains were diluted to 10 6 TCID 50 / 0.1mL, 10μl was injected intraperitoneally, and the control group was injected with the same amount of PBS in the same way. The number of deaths of rainbow trout was recorded until 21 days after infection, and the cumulative mortality percentage caused by each strain was calculated.
[0066] 6. Secondary infection experiment on rainbow trout using the virulent IHNV strain LN15 The IHNV genogroup J strong strain LN15 (described in "Xu L, Zhao J, Liu M, et al. Phylogeography and evolution of infectious hematopoietic necrosis virus in China. Molecular phylogenetic sand evolution, 2019, 131: 19-28.") was diluted to 10 6 TCID 50 / 0.1mL, and the rainbow trout that survived 21 days after the virus attack in step 5 were infected again, and 10μl of the above LN15 virus dilution was injected intraperitoneally for each tail. At the same time, 30 rainbow trout of the same specifications as in step 5 and not infected with the virus in step 5 were intraperitoneally injected with an equal amount of the above LN15 virus dilution. The number of deaths of rainbow trout was recorded until 21 days after infection, and the cumulative mortality percentage caused by each strain was calculated. Then the relative protection rate of the recombinant chimeric virus on rainbow trout was calculated. Vaccine protection rate = (incidence of the control group - incidence of the vaccine group) / incidence of the control group × 100%.
[0067] 3. Results and Analysis 1. Rescue of recombinant chimeric viruses like Figure 2 Shown is a diagram of the cytopathic effect produced after the recombinant virus was inoculated into the EPC cell line, indicating that the recombinant virus was successfully rescued.
[0068] 2. Determination of recombinant chimeric virus titer like Figure 3 The titers of the recombinant viruses in each group were 10 6.8 , 10 6.2 , 10 7.33 , 10 5.7 , 10 6.42 , 10 7.0 and 10 6.62 TCID 50 / 0.1mL (from left to right), and the virus titer of each group of recombinant viruses was not significantly different from that of the wtSn1203 group, indicating that the recombinant virus prepared by the present invention has an in vitro proliferation activity similar to that of the wild virus.
[0069] 3. Lethality of recombinant chimeric viruses to rainbow trout like Figure 4 In the experiment of recombinant virus infection on rainbow trout, the mortality rate of rainbow trout caused by wild virus BLk94 of U gene group was less than 10%, and the gene replacement recombinant virus rIHNV-La U The highest mortality rate in the group was less than 20%, while the mortality rate of rainbow trout caused by wild-type virus wtSn1203 of J gene group was 40%. This result shows that the virulence of the recombinant virus to rainbow trout is significantly reduced compared with the wild-type virus wtSn1203.
[0070] 4. Mortality of rainbow trout infected with recombinant virus after secondary challenge like Figure 5 The mortality rate of rainbow trout infected with LN15 strain was as high as 100% after infection with the recombinant virus, while the mortality rate of rainbow trout infected with the recombinant virus after infection with LN15 strain was reduced to varying degrees. J -P U , rIHNV J-La U and rIHNV J -Lb U The mortality rate in the group was lower, among which rIHNV J -P U The cumulative mortality rate was the highest, at 30%.
[0071] 5. Protective effect of recombinant chimeric virus on rainbow trout Calculate the relative protection rate of the recombinant chimeric virus against rainbow trout. Figure 6 . It shows that the recombinant chimeric virus rIHNV J -P U , rIHNV J -La U , rIHNV J -Lb U It produced a good immune protection effect on immunized rainbow trout, with relative protection rates reaching 70%, 84% and 80% respectively.
[0072] Based on the mortality rate of the first challenge and the protection rate of the second infection, it can be seen that the recombinant virus with better effect screened out by the present invention is rIHNV J -P U , rIHNV J -La U and rIHNV J -Lb U .
[0073] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.
Claims
1. A recombinant attenuated infectious hematopoietic necrosis virus, characterized in that: The recombinant attenuated infectious hematopoietic necrosis virus is different from the infectious hematopoietic necrosis virus Sn1203 strain only in that a specific gene or a fragment thereof in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced with a corresponding gene or a fragment thereof in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; The specific gene is a P gene or an L gene.
2. The recombinant attenuated infectious hematopoietic necrosis virus according to claim 1, characterized in that: The recombinant attenuated infectious hematopoietic necrosis virus is any of the following: (A1) IHNV J -P U ; The IHNV J -P U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the P gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the P gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; (A2) IHNV J -La U ; The IHNV J -La U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the 3' end part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the 3' end part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; (A3) IHNV J -Lb U ; The IHNV J -Lb U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the middle part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is replaced by the middle part of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain.
3. The recombinant attenuated infectious hematopoietic necrosis virus according to claim 1 or 2, characterized in that: The nucleotide sequence of the P gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is shown in SEQ ID No. 1; the nucleotide sequence of the P gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain is shown in SEQ ID No. 2; and / or The nucleotide sequence of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain is shown in SEQ ID No.3; the nucleotide sequence of the L gene in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain is shown in SEQ ID No.
4.
4. The recombinant attenuated infectious hematopoietic necrosis virus according to claim 3, characterized in that: In (A2), the IHNV J -La U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the 1st to 2011th positions of the L gene shown in SEQ ID No. 3 in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain are replaced by the 1st to 2011th positions of the L gene shown in SEQ ID No. 4 in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain; In (A3), the IHNV J -Lb U Compared with the infectious hematopoietic necrosis virus Sn1203 strain, the only difference is that the 2012-4132th positions of the L gene shown in SEQ ID No.3 in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain are replaced by the 2012-4132th positions of the L gene shown in SEQ ID No.4 in the genomic RNA of the infectious hematopoietic necrosis virus BLk94 strain.
5. A method for preparing the recombinant attenuated infectious hematopoietic necrosis virus according to any one of claims 1 to 4, comprising the following steps: co-transfecting BHK-21 cells with a recombinant plasmid containing a cDNA sequence corresponding to the genomic RNA of the recombinant attenuated infectious hematopoietic necrosis virus and an auxiliary plasmid, and then inoculating the culture supernatant into EPC cells to obtain the recombinant attenuated infectious hematopoietic necrosis virus.
6. The method according to claim 5, characterized in that: In the recombinant plasmid, the promoter for initiating the expression of the cDNA sequence corresponding to the genomic RNA of the recombinant infectious hematopoietic necrosis virus is the T7 promoter.
7. The method according to claim 5 or 6, characterized in that: There are four auxiliary plasmids in total: auxiliary plasmid 1 containing the cDNA sequence corresponding to the N gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain; auxiliary plasmid 2 containing the cDNA sequence corresponding to the P gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain; auxiliary plasmid 3 containing the cDNA sequence corresponding to the NV gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain; auxiliary plasmid 4 containing the cDNA sequence corresponding to the L gene in the genomic RNA of the infectious hematopoietic necrosis virus Sn1203 strain.
8. Any of the following biological materials: (B1) an in vitro animal cell or recombinant bacterium containing the recombinant attenuated infectious hematopoietic necrosis virus according to any one of claims 1 to 4; (B2) a vector containing the genomic RNA or cDNA of the recombinant attenuated infectious hematopoietic necrosis virus according to any one of claims 1 to 4; (B3) A vaccine containing the recombinant attenuated infectious hematopoietic necrosis virus according to any one of claims 1 to 4.
9. Any of the following applications: (C1) Use of the recombinant attenuated infectious hematopoietic necrosis virus according to any one of claims 1 to 4 or the biological material according to claim 8 in the preparation of a product for preventing and / or treating diseases caused by infectious hematopoietic necrosis virus infection; (C2) Use of the recombinant attenuated infectious hematopoietic necrosis virus according to any one of claims 1 to 4 or the biological material according to claim 8 in the preparation of a product for inhibiting infectious hematopoietic necrosis virus infection.
10. The use according to claim 9, characterized in that: The product is a vaccine or a medicine.