Novel human and monkey chimeric varicella-zoster virus as well as construction method and application thereof

Abstract

The invention discloses a novel human and monkey chimeric varicella-zoster virus, which is characterized in that the characteristic that most genomes of a monkey varicella virus SVV are similar to those of a human varicella-zoster virus VZV is ingeniously utilized, and a specific sequence of the SVV is replaced into the genomes of the VZV, so that the novel human and monkey chimeric varicella-zoster virus SVZV is constructed; in-vitro experiments prove that macaque can be infected by the human-monkey chimeric novel varicella-zoster virus, and an effective solution is provided for research and development of varicella-zoster virus related drugs and vaccines and in-vivo experiments of herpes zoster neuralgia. The invention also discloses a construction method and application of the virus.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a novel human-monkey chimeric varicella-zoster virus and a construction method and application thereof. Background Art

[0002] Varicella-zoster virus (VZV) is the pathogen that causes varicella (Varicella) and herpes zoster (HZ). VZV can be transmitted through aerosolized droplets or direct contact and infect respiratory mucosal epithelial cells. Infected T cells can transport VZV to the skin through the blood circulation, resulting in a systemic densely distributed vesicular rash commonly known as chickenpox. Chickenpox is common in children under 10 years old, with an incidence of about 1 in 140 million. For people with weakened immunity, such as the elderly, VZV can cause herpes zoster (HZ) accompanied by neuralgia, called zoster-related neuralgia (ZP), with an annual incidence of 3 to 5%.

[0003] Normally, chickenpox caused by VZV infection is a self-limiting disease that can heal itself within two weeks; however, the herpes zoster neuralgia caused by its reactivation and destruction of neurons is its greatest harm. Therefore, clarifying the VZV latent-reactivation mechanism is the key to solving herpes zoster neuralgia. At present, it is generally believed that the pathogenesis of herpes zoster is that when the body's immunity is low, the latent VZV can be reactivated and replicate progeny viruses in large quantities, along the sensory nerve fibers to the innervated skin. In this process, VZV destroys the infected DRG or TG neurons, resulting in neuronal dysfunction, ectopic discharges, and peripheral and central sensitization, causing severe neuralgia. Humans are the only host of VZV, and there is currently no perfect animal model of VZV infection, so the mechanism of VZV reactivation has not yet been clarified.

[0004] Vaccines are currently the most effective means for humans to fight viruses. Among the many human herpes viruses, VZV is the only herpes virus that has obtained a licensed vaccine. The live attenuated vaccine can effectively prevent chickenpox and herpes zoster. Although great progress has been made in VZV-related vaccines, there is currently a huge market demand for herpes zoster vaccines in my country. Preclinical animal studies of varicella vaccines and herpes zoster vaccines mainly evaluate vaccine immune responses, safety, and side effects. Humans are the only host of VZV. Due to the lack of a complete VZV infection animal model, current preclinical animal studies of vaccines cannot evaluate the preventive effect of vaccines on herpes zoster. Establishing a complete VZV animal model is the primary problem to be solved in the current research on the pathogenesis of herpes zoster and vaccine development. Summary of the invention

[0005] Based on this, the present application provides a novel human-monkey chimeric varicella-zoster virus and its construction method and application.

[0006] The first aspect of the embodiments of the present application provides a novel human-monkey chimeric varicella-zoster virus, in which a unique sequence of simian varicella virus (SVV) is inserted into the human varicella-zoster virus genome or replaces the ORF0-ORF3 region in the human varicella-zoster virus genome.

[0007] In some embodiments of the present application, the monkey varicella virus-specific sequence includes ORFC-ORFB (as shown in SEQ ID NO.1).

[0008] In some embodiments of the present application, the monkey varicella virus-specific sequence is inserted into any position in the human varicella-zoster virus genome.

[0009] In some embodiments of the present application, the monkey varicella virus-specific sequence is inserted into the ORF0-ORF3 region of the human varicella-zoster virus genome.

[0010] In some embodiments of the present application, the monkey varicella virus-specific sequence is shown as SEQ ID NO.1.

[0011] The second aspect of the embodiments of the present application provides a method for constructing a novel human-monkey chimeric varicella-zoster virus, the method comprising the steps of replacing the ORF0-ORF3 region in the target human varicella-zoster virus with a sequence specific to the monkey varicella virus; or, inserting the target human varicella-zoster virus into a sequence specific to the monkey varicella virus.

[0012] According to a third aspect of an embodiment of the present application, a vector is provided, which comprises the genome defined in the first aspect.

[0013] The fourth aspect of the embodiments of the present application provides a virus that packages the human-monkey chimeric novel varicella-zoster virus described in the first aspect.

[0014] The fifth aspect of the embodiments of the present application provides the use of the novel human-monkey chimeric varicella-zoster virus, the vector or the cell in drug preparation.

[0015] In some embodiments of the present application, the medicament comprises a vaccine.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention cleverly utilizes the characteristic that most of the genome of non-human primate varicella-zoster virus SVV is similar to that of varicella-zoster virus VZV, introduces SVV-specific sequences into VZV, such as inserting into VZV or replacing the specific sequences of VZV, and constructs a human-monkey chimeric novel varicella-zoster virus SVZV. In vitro experiments have proved that the human-monkey chimeric novel varicella-zoster virus can infect crab-eating macaques, providing an effective solution for the development of varicella-zoster virus-related drugs and vaccines and in vivo experiments of herpes zoster neuralgia.

[0018] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0020] Figure 1 Schematic diagram of the establishment of a new human-monkey chimeric varicella-zoster virus animal model;

[0021] Figure 2 This is a highly homologous analysis diagram of monkey varicella virus and human varicella-zoster virus;

[0022] Figure 2 A is the phylogenetic tree analysis diagram of the Alphaherpesviridae family;

[0023] Figure 2 B is a comparison of the genome structures of SVV and VZV;

[0024] Figure 3 This is a diagram of the construction and identification of a new human-monkey chimeric varicella-zoster virus;

[0025] Figure 3 A is a schematic diagram of the process of constructing the human-simian chimeric virus SVZV using the BAC recombination system;

[0026] Figure 3 B is a schematic diagram of the SVZV gene structure and the position of the terminal primers designed to amplify the SVV sequence inserted into the VZV genome;

[0027] Figure 3 C is a diagram of SVZV identification by Sanger sequencing;

[0028] Figure 4 The prokaryotic sequence map of the SVZV genome is Cre-Loxp recombination;

[0029] Figure 4 A is a diagram of SVZV BAC genomic DNA transfected into ARPE-19 cell line overexpressing Cre recombinase to package SVZV virus with BAC vector sequence removed;

[0030] Figure 4 B is the genome coverage analyzed by whole genome sequencing technology of SVZV BAC DNA and SVZV virus-infected ARPE-19 cell DNA without BAC vector sequence;

[0031] Figure 5 This is a picture of the extraction and in vitro culture of cynomolgus macaque skin and DRG tissue;

[0032] Figure 5 AD shows the isolation and in vitro culture of cynomolgus macaque skin tissue

[0033] Figure 5 EH are pictures of the isolation and in vitro culture of DRG tissues in cynomolgus macaques;

[0034] Figure 6 Figure 2 shows the DRG and skin tissues of cynomolgus macaques cultured in vitro infected with VZV and SVZV. DETAILED DESCRIPTION

[0035] In the present invention, unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items. "... one or more" means selecting one or more of the listed combinations and is not a limitation on quantity.

[0036] Unless otherwise specified, the techniques used in the embodiments of the present invention all employ existing medical, organic chemistry, biochemistry, molecular biology, pharmacology and other techniques within the art.

[0037] The first aspect of the embodiments of the present application provides a novel human-monkey chimeric varicella-zoster virus, in which a monkey varicella virus-specific sequence is inserted into the human varicella-zoster virus genome or replaces the ORF0-ORF3 region in the human varicella-zoster virus genome.

[0038] In some embodiments of the present application, the monkey varicella virus-specific sequence includes ORFC-ORFB.

[0039] In some embodiments of the present application, the monkey varicella virus-specific sequence is inserted into any position in the human varicella-zoster virus genome.

[0040] In some embodiments of the present application, the monkey varicella virus-specific sequence is inserted into the ORF0-ORF3 region of the human varicella-zoster virus genome.

[0041] In some embodiments of the present application, the monkey varicella virus-specific sequence is shown as SEQ ID NO.1.

[0042] The second aspect of the embodiments of the present application provides a method for constructing a novel human-monkey chimeric varicella-zoster virus, the method comprising the steps of replacing the ORF0-ORF3 region in the target human varicella-zoster virus with a sequence specific to the monkey varicella virus; or, inserting the target human varicella-zoster virus into a sequence specific to the monkey varicella virus.

[0043] According to a third aspect of an embodiment of the present application, a vector is provided, which comprises the genome defined in the first aspect.

[0044] A fourth aspect of the embodiments of the present application provides a cell that packages the human-monkey chimeric novel varicella-zoster virus described in the first aspect.

[0045] The fifth aspect of the embodiments of the present application provides the use of the novel human-monkey chimeric varicella-zoster virus, the vector or the cell in drug preparation.

[0046] In some embodiments of the present application, the medicament comprises a vaccine.

[0047] In the present application, the monkey varicella virus-specific sequence is shown in SEQ ID NO.1, or the nucleotide sequence has more than 70% similarity with SEQ ID NO.1.

[0048] Example 1 Construction and identification of a novel human-monkey chimeric varicella-zoster virus

[0049] This embodiment provides a novel human-monkey chimeric varicella-zoster virus and a method for constructing the same, and an animal model constructed Figure 1 As shown, the principle is to replace the ORF0-ORF3 region in the human varicella zoster virus VZV with the monkey varicella virus SVV-specific sequence ORFC-ORFB.

[0050] like Figure 2 As shown, the genome structures of monkey varicella virus SVV and human varicella zoster virus VZV are highly similar. This example utilizes this feature to construct a human-monkey chimeric varicella zoster virus (SVZV) and achieve effective infection of experimental animals.

[0051] The construction method is as follows:

[0052] 1. Obtain the targeting fragment sequence

[0053] (1) Obtaining 400 bp homology arms upstream and downstream of the target region + SVV-specific sequence ORFC-ORFB. In this embodiment, the final sequence structure obtained by PCR using DNA from SVV and VZV infected cell samples as templates is 400 bp_homology (VZV ORF71) + SVVORFC-ORFB + 400 bp_homology (VZV ORF4), and the sequence is shown in SEQ ID NO.4.

[0054] (2) Obtaining the galK gene containing 400 bp homology arms upstream and downstream of the target region + em7 promoter (as shown in SEQ ID NO.2). In this embodiment, the final sequence structure obtained by PCR using the em7 promoter-galK plasmid and VZV infected cell sample DNA as templates is 400bp_homology (VZV ORF71) + em7 promoter-galK + 400bp_homology (VZV ORF4), and the sequence is shown in SEQ ID NO.3.

[0055] 2. Preparation of electrocompetent cells

[0056] (1) Prepare 250 ml LB medium, 1000 ml ultrapure water, 500 ml 10% glycerol, and a 500 ml centrifuge bottle. Sterilize by high pressure and store at 4°C.

[0057] (2) Streak the SW102 strain onto a non-resistant solid LB culture plate and culture it at 32°C overnight to activate the SW102 strain; then pick out a single clone of bacteria and inoculate it into 5 ml of non-resistant culture medium and culture it at 32°C overnight.

[0058] (3) The next morning, the activated bacteria were preserved and transferred to 250 ml LB medium and cultured at 32°C without antibiotics. During the culture period, the bacterial solution was taken regularly to measure the OD600 value.

[0059] (4) When the bacteria are in the exponential growth phase (OD600 is around 0.6), quickly place them in a 42°C water bath for heat stimulation to induce recombinase expression (30-50 minutes); then cool them in a 0°C ice-water mixture for 30 minutes.

[0060] (5) After cooling, transfer the bacterial solution to the cold 500 ml centrifuge bottle prepared in step 1 and centrifuge to collect the bacterial cells at a speed of 2500 rpm, a centrifugation time of 10 minutes, and a temperature of 4 °C.

[0061] (6) After obtaining the bacterial cells, use a pipette to absorb the excess culture medium and add 100 ml of sterilized ddH 2 After resuspending the cells, ddHO was used2 Add 0 to 350 ml and centrifuge again at a speed of 2500 rpm, a centrifugal time of 10 minutes and a temperature of 4 °C.

[0062] (7) Discard the supernatant and repeat steps (i) to (vi) above once more.

[0063] (8) Add 10% glycerol for washing, and centrifuge again for washing at a speed of 2500 rpm, a centrifugal time of 10 minutes, and a temperature of 4°C.

[0064] (9) After adding glycerol, aliquot and freeze quickly with liquid nitrogen and store at -80°C.

[0065] 3. Electroporation of Targeting Fragment Sequence

[0066] First round of targeting: Replacement of VZV ORF0-ORF3 with the galK gene

[0067] (1) Before electroporation, blow dry the tube and place it in a 0℃ ice-water mixture to precool it.

[0068] (2) Take out the competent medium prepared in step 2 and add the targeting fragment (competent medium: targeting fragment DNA = 100 μL: 12-15 μL), gently blow evenly and add it to the electroporation cup.

[0069] (3) Place the electroporation cup in the electroporation groove and perform electroporation. The electroporation conditions are: 2.5KV, 25mF, 200Ω, 4.9-5.0ms.

[0070] (4) After completion, quickly add 0.9 mL of pre-thawed SOC medium, mix well, then aspirate and quickly place in a 1.5 mL EP tube and culture on a shaker at 32°C for one hour.

[0071] (5) The bacterial suspension was plated on a culture medium containing galactose and cultured at 32°C overnight.

[0072] Second round of targeting: Replacement of the galK gene with ORFC-ORFB

[0073] Steps (1-3) are basically the same as steps (1-3) of the first round of shooting.

[0074] (4) After completion, quickly add 0.9 mL of pre-thawed SOC medium, mix well, then aspirate and quickly place in a 1.5 mL EP tube and culture on a shaker at 32°C for 4.5 hours.

[0075] (5) The bacterial suspension was spread on a culture medium containing 2-deoxy-D-galactose (DOG) and cultured at 32°C overnight.

[0076] 4. Transfect cells to produce viruses

[0077] (1) Use QIAGEN large-scale extraction kit to extract VZV BAC genomic DNA.

[0078] (2) ARPE-19 cells were plated in a six-well plate, and the viral BAC genome was transfected when the cell density reached 50%.

[0079] (3) After obtaining the recombinant virus, the virus is amplified in large quantities using ARPE-19 and preserved.

[0080] (4) PCR and agarose gel electrophoresis

[0081] The PCR reaction system is as follows:

[0082]

[0083] The primer sequences are as follows (SEQ ID No.5-6):

[0084] SVZV-FP:ATGAAAAAAGTGTCTGTCTGTCTGT

[0085] SVZV-RP:ATCTTTGCAATTCCGTCTCTGATTC

[0086] PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at Tm value of 56°C for 30 sec, extension at 72°C for 35 sec, for a total of 35 cycles; extension at 72°C for 10 min, and detection of PCR amplification effect by 2% agarose gel.

[0087] Result identification:

[0088] First, if Figure 3 As shown in A, a galK shuttle sequence (sequence shown in SEQ ID NO.2) containing 400 bp homologous sequences upstream and downstream of SVVORFC-ORFB (sequence shown in SEQ ID NO.1) (respectively, named A / B segments) and carrying an em7 promoter was synthesized by gene synthesis.

[0089] Afterwards, the linear galK shuttle was electroporated into the VZV BAC DH10B strain SW102, and the positive strain containing galK was screened in a medium containing galactose and marked as SW102-galK.

[0090] Next, the 400bp homologous A / B segments upstream and downstream of ORFC-ORFB were synthesized again by gene synthesis, introduced into the SW102-galK strain, and positive strains were screened in a medium containing 2-deoxy-galactose (2-Deoxy-D-galactose, DOG) (clones with galK will use DOG as a carbon source, produce substances that are harmful to themselves, and cannot continue to grow; while recombinant clones do not use DOG to produce toxic effects and can grow). Figure 3 As shown in C, the positive strain was identified by PCR and further confirmed by Sanger sequencing and named as pOka-SVV_ORFC-ORFB.

[0091] Finally, after extracting BAC genomic DNA, pOka-SVV_ORFC-ORFB BAC genomic DNA was transfected into ARPE-19 cells by liposome transfection to package the virus. After transfecting ARPE-19 with pOka-SVV_ORFC-ORFB BAC genomic DNA, VZV recombinant virus was successfully produced and GFP was expressed. Extract the genomic DNA of ARPE-19 cells infected with VZV recombinant virus. Figure 3 As shown in B, primers (SEQ ID No. 5-6) located in the TRL and TRS of the VZV genome were designed to specifically amplify the inserted SVV sequence. PCR amplification and Sanger sequencing showed that the pOka-SVV_ORFC-ORFB virus had been successfully inserted into the ORFC-ORFB sequence of SVV and was named SVZV ( Figure 3 C). Thus, the present embodiment obtains a recombinant virus, SVZV, in which the ORF0-ORF3 (ie, 0-2460 bp) sequence of VZV is replaced with the SVV-specific sequence ORFC-ORFB (ie, 0-3315 bp).

[0092] Example 2 Optimization of SVZV and infection of macaques

[0093] like Figure 4 As shown in B, the present embodiment uses the pOka-GFP-Luc strain (GenBank ID, PP054841, https: / / www.ncbi.nlm.nih.gov / nuccore / PP054841), whose BAC DNA contains the same-direction Loxp sequences on both sides of the CMV-GFP to prokaryotic partial sequence. Therefore, the Cre enzyme-Loxp recombination system can be used to remove the prokaryotic partial sequence used to amplify the SVZVBAC DNA to obtain a more streamlined SVZV recombinant virus.

[0094] 1. Experimental Methods

[0095] 1.1 Construction of ARPE-19 cell line overexpressing Cre enzyme:

[0096] (I) The Cre enzyme sequence was synthesized by gene synthesis and constructed into the lentiviral circular RNA expression vector PCDH-Puro to obtain PCDH-Cre-Puro, and the lentivirus was packaged using the second-generation lentiviral packaging system.

[0097] (ii) When infected with PCDH-Cre-Puro lentivirus, the density of ARPE-19 cells is about 70%. Polybrene is added to the PCDH-Cre-Puro lentivirus supernatant to a final concentration of 6 μg / mL, mixed and added to the ARPE-19 cells to be infected.

[0098] (III) 24 hours after lentiviral infection, the viral supernatant was replaced with fresh culture medium.

[0099] (IV) Three days after lentiviral infection, puromycin can be added to the culture medium to screen positive cells (the lowest lethal concentration of puromycin for ARPE-19 cells has been determined to be 2 μg / mL in the early stage). Since puromycin kills cells quickly, positive cells can generally be obtained after 4 days of screening; during the screening period, if the culture medium turns yellow, it should be replaced with fresh culture medium in time. Finally, the ARPE-19-Cre cell line was obtained.

[0100] 1.2pOka-SVV_ORFC-ORFB BAC genomic DNA transfection ARPE-19-Cre cell line:

[0101] (A) ARPE-19-Cre cell line was seeded in a 6-well plate, and pOka-SVV_ORFC-ORFB BAC genomic DNA was transfected when the cell density reached 80%.

[0102] (ii) Five days after transfection, green fluorescence can be observed under a fluorescence microscope or by adding luciferase substrate and observing the fluorescence signal on a small animal live imaging system.

[0103] (III) After obtaining the recombinant virus, the virus was amplified in large quantities using ARPE-19 and preserved.

[0104] 2. Experimental results

[0105] like Figure 4As shown, 5 days after SVZV BAC genomic DNA was transfected into the ARPE-19 cell line that overexpressed Cre recombinase, the cytopathic effect caused by the packaged SVZV virus-infected cells can be observed under a fluorescence microscope, and some diseased cells emit green fluorescence while some cells do not. The virus contained in the cells that do not emit green fluorescence is the recombinant virus (red circle) from which CMV-GFP and prokaryotic partial sequences have been removed. The genome coverage analyzed by whole genome sequencing technology of SVZV BAC DNA and SVZV virus-infected ARPE-19 cell DNA with BAC vector sequences removed further proves the above results. So far, this patent uses the Cre enzyme-Loxp recombination system to remove the prokaryotic partial sequence used to amplify SVZV BAC DNA to obtain a more streamlined SVZV recombinant virus.

[0106] like Figure 5 As shown in FIG. 1 , in order to prove whether SVZV can infect macaques, the present embodiment separates and collects skin tissue and dorsal root ganglion tissue (DRG) from a ten-year-old adult cynomolgus macaque and cultures them in vitro. The skin tissue and dorsal root ganglion tissue of the cynomolgus macaque cultured in vitro were infected with VZV and SVZV, respectively. The results are shown in FIG. Figure 6 As shown, it was shown that SVZV can successfully infect cynomolgus macaque skin tissue and dorsal root ganglion tissue.

[0107] The above-mentioned embodiments are only preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by technicians in this field on the basis of the present invention shall fall within the scope of protection required by the present invention.

Claims

1. A novel human-monkey chimeric varicella-zoster virus, characterized in that: The monkey varicella virus-specific sequence is inserted into the human varicella-zoster virus genome or replaces the ORF0-ORF3 region in the human varicella-zoster virus genome.

2. The human-monkey chimeric novel varicella-zoster virus according to claim 1, characterized in that: The monkey varicella virus-specific sequence includes ORFC-ORFB.

3. The human-monkey chimeric novel varicella-zoster virus according to claim 1, characterized in that: The monkey varicella virus-specific sequence is inserted into any position in the human varicella-zoster virus genome.

4. The human-monkey chimeric novel varicella-zoster virus according to claim 3, characterized in that: The monkey varicella virus-specific sequence is inserted into the ORF0-ORF3 region of the human varicella-zoster virus genome.

5. The human-monkey chimeric novel varicella-zoster virus according to claim 1, characterized in that: The monkey varicella virus-specific sequence is shown in SEQ ID NO.

1.

6. The method for constructing a novel human-monkey chimeric varicella-zoster virus according to any one of claims 1 to 5, characterized in that: The method comprises the steps of replacing the ORF0-ORF3 region in the target human varicella zoster virus with a sequence specific to monkey varicella virus; or inserting the target human varicella zoster virus into a sequence specific to monkey varicella virus.

7. A vector comprising the genome according to any one of claims 1 to 5.

8. A cell comprising the human-monkey chimeric novel varicella-zoster virus according to any one of claims 1 to 5.

9. Use of the human-monkey chimeric novel varicella-zoster virus according to any one of claims 1 to 5, the vector according to claim 7 or the cell according to claim 8 in the preparation of a drug.

10. The use according to claim 9, characterized in that: The medicaments include vaccines.

Images