DsRNA for coleopteran insects and pesticide composition and application thereof

Abstract

The invention aims to achieve the purpose of effectively preventing and controlling phyllotreta striolata by applying dsRNA of a key gene of targeted phyllotreta striolata by using an RNAi technology. The invention discloses dsRNA for coleopteran insects as well as a pesticide composition and application of the dsRNA. The invention also discloses application of the dsRNA molecule and the pesticide composition thereof in prevention and treatment of coleopteran insects, killing of coleopteran insects or inhibition of growth of coleopteran insects. The double-target dsRNA and the dsRNA compounding scheme have the phyllotreta striolata control effect which is close to or higher than that of a traditional chemical pesticide, have the safety and the degradability of a dsRNA pesticide and can effectively solve the problems that an existing chemical pesticide is high in toxicity and high in residue.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological pesticides, and in particular, relates to dsRNA targeting coleopteran insects and a pesticide composition and use thereof. Background Art

[0002] The striped flea beetle (Phyllotreta striolata, Fabricius), belonging to the order Coleoptera, family Chrysommelidae, is an important pest widely distributed throughout the world. The host plants of the striped flea beetle are mainly cruciferous vegetables containing mustard oil, such as cabbage, radish, broccoli, etc. At present, the control method for the striped flea beetle is still spraying chemical pesticides. The indiscriminate use of highly toxic and high-residue pesticides has seriously endangered people's health and caused pollution and harm to the environment and ecology. In the past two decades, the use of chemical pesticides has led to the rapid development of flea beetle resistance, resulting in a vicious cycle of farmers using higher doses of pesticides, and the prevention and control of flea beetles has become increasingly difficult. Therefore, there is an urgent need to develop safe, effective, and green strategies to control the harm caused by flea beetles.

[0003] RNA pesticides are an effective way to control agricultural pests using RNAi technology. They are safe, green and environmentally friendly, and have high control efficiency. Studies have reported the biodegradation potential of dsRNA in three different representative agricultural soils (silt loam, loam, and clay). The half-life (DT50) of dsRNA is less than 30 h, while the DT90 is less than 35 h. Therefore, regardless of soil texture, pH, clay content, or other differences, dsRNA is unlikely to persist or accumulate in the soil. In aquatic systems, dsRNA has been shown to be rapidly degraded in the aqueous phase of water-sediment microenvironments and in sediment-only systems lacking an aqueous phase. Studies have shown that dsRNA prepared in sterile water is more stable, indicating that dsRNA is degraded by microorganisms. dsRNA sprayed on the surface of tobacco leaves showed RNAi activity against cytomegalovirus 5 days before being degraded. In addition, it was observed under a confocal microscope that dsRNA was applied to the leaf surface and rinsed after 24 hours to simulate a rainfall event, and the results showed that dsRNA was easily washed away.

[0004] The main routes of human exposure to dsRNA include accidental oral contact, skin absorption, and respiratory inhalation. The human digestive tract has a wide range of physical and biochemical barriers. These biological barriers include nucleases in saliva and the gastrointestinal tract, which together limit the ingested dsRNA from entering the blood and organs. Regarding skin absorption, the stratum corneum, the outermost layer of the skin, is a strong barrier to prevent dsRNA from being directly absorbed. If the skin is damaged, dsRNA bypasses the epidermal barrier. As a hydrophilic macromolecule, dsRNA needs to rely on a specific carrier to be transported through the lipid bilayer. The dsRNA enzymes in the human body will also quickly metabolize and remove foreign dsRNA. In addition, in the early stages of the design of dsRNA target fragments, the gene sequences of non-target organisms in the field are compared through bioinformatics analysis to avoid off-target effects in order to protect the safety of natural enemies, pollinators, and decomposers. Obviously, any dsRNA that may have adverse effects on humans needs to show consistency with the human genome sequence, and preventing off-target effects is also the ultimate guarantee for the safety of nucleic acid pesticides.

[0005] Coat protein complex 1 (COPI) is a multi-subunit complex, of which COPI-gamma (COPI-γ) subunit and ADP-ribosylation factor 1 (ADP-Ribosylation Factor 1, COPI-ARF1) are important subunits and core components of coat protein complex 1 (COPI), which covers intracellular vesicles and participates in intracellular protein trafficking.

[0006] Vesicle trafficking is a unique mode of material transport in eukaryotic cells and is essential for maintaining cell homeostasis. The formation of vesicles involves the recruitment and assembly of coat proteins. Like clathrin, COPI coat polymerizes on the cytosol surface of budding vesicles to form COPI coated vesicles, which rapidly disassemble after formation. Some subunits of COPI (such as β subunit) function as adaptor proteins and can bind to the cytoplasmic domain of membrane proteins to promote the formation of vesicles. Vesicles with COPI as coat are called COPI coated vesicles. COPⅠ coated vesicles mediate the transport of substances from the cis Golgi network (CGN) to the endoplasmic reticulum (ER) and the interior of the Golgi vesicle, such as mediating the reverse transport function of vesicles, that is, COPⅠ coated vesicles will reversely transport proteins containing dilysine motifs, Golgi glycosyltransferases, KDEL proteins, etc. in cells to specific areas within the cell. COPⅠ coated vesicles play an important role in maintaining the integrity of the endoplasmic reticulum and Golgi apparatus, regulating intracellular lipid metabolism, maintaining cell homeostasis and the growth and development of the body. COPⅠ functional defects can lead to abnormal lipid metabolism, tumors and neurological diseases. COPI-ARF1 plays a key role in the functional regulation of the intracellular membrane system, mainly involved in regulating the formation, transport and membrane exchange of vesicles. Studies have shown that knocking out COPI-ARF1 in neurons promotes the accumulation of lipid peroxides, lipid droplets, and ATP in the spinal cord and hindbrain of mice, leading to neuroinflammation, demyelination, and neurodegeneration.

[0007] Double-stranded ribonucleases (dsRNases) in insects are an important class of enzymes that have the specificity to degrade double-stranded RNA (dsRNA). This degradation is of great significance for insects to resist the invasion of exogenous dsRNA and can protect the insects' own gene expression from interference. At the same time, dsRNases are also involved in the RNA interference (RNAi) process in insects, affecting the effect of RNAi by regulating the degradation efficiency of dsRNA.

[0008] Given the excellent safety, specificity and degradability of RNA pesticides, if RNAi technology is used, COPI-γ and COPI-ARF1 of flea beetles can be targeted, so that vesicle transport between organelles cannot be completed, disrupting the biological processes of their cells, and thus causing the death of flea beetles. However, there are currently no reports of RNA biological pesticides targeting COPⅠ of the yellow-curved striped flea beetle. Considering the severity of its harm, there is still an unmet demand for RNA pesticides targeting COPⅠ of the yellow-curved striped flea beetle. In addition, since RNA pesticides are usually double-stranded RNA, the effectiveness of RNA pesticides that enter the insect body will also be greatly reduced due to the degradation of its dsRNase. Summary of the invention

[0009] In view of the defects of the prior art, the present invention aims to utilize RNAi technology to achieve the purpose of effectively controlling the yellow striped flea beetle by administering dsRNA targeting the key genes of the yellow striped flea beetle. In addition, for the dsRNase contained in the insect body, the present invention designs an interference fragment for the conserved domain of dsRNase and administers it together with other dsRNA to improve the interference effect.

[0010] In one aspect, the present invention provides a dsRNA for coleopteran insects, wherein the dsRNA for coleopteran insects comprises any combination of a sense strand and an antisense strand selected from the following:

[0011] The nucleotide sequence is the sense strand shown in SEQ ID NO:5, and the nucleotide sequence is the antisense strand shown in SEQ ID NO:6; the nucleotide sequence is the sense strand shown in SEQ ID NO:1, and the nucleotide sequence is the antisense strand shown in SEQ ID NO:2; the nucleotide sequence is the sense strand shown in SEQ ID NO:3, and the nucleotide sequence is the antisense strand shown in SEQ ID NO:4; and, the nucleotide sequence is the sense strand shown in SEQ ID NO:7, and the nucleotide sequence is the antisense strand shown in SEQ ID NO:8.

[0012] In one aspect, the present invention provides a dsRNA for coleopteran insects, wherein the dsRNA for coleopteran insects comprises any combination of a sense strand and an antisense strand selected from the following:

[0013] The nucleotide sequence is the sense strand shown in SEQ ID NO: 1, and the nucleotide sequence is the antisense strand shown in SEQ ID NO: 2; the nucleotide sequence is the sense strand shown in SEQ ID NO: 3, and the nucleotide sequence is the antisense strand shown in SEQ ID NO: 4; and, the nucleotide sequence is the sense strand shown in SEQ ID NO: 7, and the nucleotide sequence is the antisense strand shown in SEQ ID NO: 8.

[0014] In another aspect, the present invention provides a dsRNA against Coleopteran insects, wherein the dsRNA against Coleopteran insects comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO:5 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO:6.

[0015] In another aspect, the present invention provides a dsRNA targeting Coleopteran insects, wherein the dsRNA targeting Coleopteran insects comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO: 1 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO: 2.

[0016] In another aspect, the present invention provides a dsRNA targeting Coleopteran insects, wherein the dsRNA targeting Coleopteran insects comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO:3 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO:4.

[0017] In another aspect, the present invention provides a dsRNA against Coleopteran insects, wherein the dsRNA against Coleopteran insects comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO:7 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO:8.

[0018] In another aspect, the present invention provides a method for preparing a dsRNA against a coleopteran insect as described in any embodiment herein, the method comprising the following steps:

[0019] S1: Extract total RNA from coleopteran insects;

[0020] S2: cDNA obtained by reverse transcription of total RNA;

[0021] S3: Using cDNA as a template, dsRNA is obtained by PCR amplification.

[0022] In another aspect, the present invention provides a method for preparing a dsRNA against Coleopteran insects as described in any embodiment herein, the method comprising: constructing an expression vector and using the expression vector to express the dsRNA; or, constructing an expression host cell and using the expression host cell to express the dsRNA.

[0023] In another aspect, the present invention provides a pesticide composition, comprising the dsRNA against Coleopteran insects as described in any embodiment herein, and a pesticide acceptable diluent, carrier or solubilizer.

[0024] In one or more embodiments, the dsRNA against coleopteran insects targets the COPI-γ gene and the COPI-ARF1 gene of coleopteran insects.

[0025] Preferably, the pesticide composition comprises a dsRNA having a nucleotide sequence of a sense strand as shown in SEQ ID NO: 1 and a nucleotide sequence of an antisense strand as shown in SEQ ID NO: 2 and a dsRNA having a nucleotide sequence of a sense strand as shown in SEQ ID NO: 3 and a nucleotide sequence of an antisense strand as shown in SEQ ID NO: 4.

[0026] Preferably, the pesticide composition comprises a dsRNA having a nucleotide sequence of a sense strand as shown in SEQ ID NO: 5 and a nucleotide sequence of an antisense strand as shown in SEQ ID NO: 6.

[0027] In one or more embodiments, the pesticide composition further comprises a dsRNA targeting a dsRNase gene of a coleopteran insect.

[0028] In one or more embodiments, the dsRNA targeting a dsRNase gene of a coleopteran insect comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO:7 and an antisense strand having a nucleotide sequence as shown in SEQ ID NO:8.

[0029] In one or more embodiments, the dsRNA against Coleopteran insects targets a dsRNase gene of Coleopteran insects and one or two selected from the group consisting of a COPI-γ gene and a COPI-ARF1 gene.

[0030] Preferably, the pesticide composition comprises a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 7 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 8, and a combination of one or more selected from a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 1 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 2, a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 3 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 4, and a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 5 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 6.

[0031] More preferably, the dsRNA against Coleopteran insects comprises a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 7 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 8, a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 1 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 2, and a dsRNA having a nucleotide sequence of a sense chain as shown in SEQ ID NO: 3 and a nucleotide sequence of an antisense chain as shown in SEQ ID NO: 4.

[0032] More preferably, the dsRNA against Coleopteran insects comprises a dsRNA whose nucleotide sequence of the sense chain is as shown in SEQ ID NO: 7 and whose nucleotide sequence of the antisense chain is as shown in SEQ ID NO: 8, and a dsRNA whose nucleotide sequence of the sense chain is as shown in SEQ ID NO: 5 and whose nucleotide sequence of the antisense chain is as shown in SEQ ID NO: 6.

[0033] In one or more embodiments, the concentration of the dsRNA against Coleopteran insects in the pesticide composition is 1 to 5000 mg / L.

[0034] Preferably, the concentration of the dsRNA for Coleopteran insects in the pesticide composition is 10 to 3000 mg / L. More preferably, the concentration of the dsRNA for Coleopteran insects in the pesticide composition is 50 to 3000 mg / L. Further preferably, the concentration of the dsRNA for Coleopteran insects in the pesticide composition is 500 to 2000 mg / L.

[0035] Preferably, the pesticide composition comprises 0.01-0.5% (w / v) Tween. More preferably, the pesticide composition comprises 0.01-0.2% (w / v) Tween. More preferably, the Tween is selected from one or more of Tween 20, Tween 21, Tween 40, Tween 60, Tween 61, Tween 80, Tween 81, and Tween 85.

[0036] In another aspect, the present invention provides use of the dsRNA against coleopteran insects as described in any embodiment herein in controlling coleopteran insects, wherein the dsRNA against coleopteran insects is used to kill coleopteran insects or inhibit the growth of coleopteran insects.

[0037] In another aspect, the present invention provides use of the pesticide composition as described in any embodiment herein in controlling coleopteran insects, wherein the pesticide composition is used to kill coleopteran insects or inhibit the growth of coleopteran insects.

[0038] In another aspect, the present invention provides a method for controlling coleopteran insects, the method comprising using the dsRNA against coleopteran insects as described in any embodiment herein.

[0039] In another aspect, the present invention provides a method for controlling coleopteran insects, the method comprising using the pesticide composition as described in any embodiment herein.

[0040] Preferably, the coleopteran insect is a Chrysomelidae insect. More preferably, the Chrysomelidae insect is a yellow flea beetle.

[0041] The dsRNA targeting coleopteran insects provided by the present invention has the following beneficial effects compared with the prior art:

[0042] 1. A dsRNA targeting the COPⅠ-γ and COPⅠ-ARF1 genes on chromosome 5 of the yellow-curved striped flea beetle was designed, and a dsRNA targeting the dsRNase gene on chromosome 8 of the yellow-curved striped flea beetle was designed. The dsRNA has a significant expression inhibition rate and lethality rate of the corresponding target genes of the yellow-curved striped flea beetle.

[0043] 2. Based on the single-target dsRNA targeting the COPⅠ-γ and COPⅠ-ARF1 genes of the yellow striped flea beetle, a dual-target dsRNA that simultaneously targets COPⅠ-γ and COPⅠ-ARF1 was designed. The single-target dsRNA and dual-target dsRNA were further compounded with dsRNase and administered separately, which further improved the expression inhibition rate and lethality of the corresponding target genes of the yellow striped flea beetle.

[0044] 3. The dual-target dsRNA and dsRNA compound scheme of the present invention have a control effect on yellow flea beetles that is close to or higher than that of traditional chemical pesticides, and at the same time has the safety and easy degradability of dsRNA as a biological pesticide, which can effectively overcome the problems of high toxicity and high residue of existing chemical pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 It is a schematic diagram of the PCR amplification process of the combined targets of the yellow-banded flea beetle coat protein complex 1-γ (COPⅠ-γ) and the yellow-banded flea beetle coat protein complex 1-ARF1 (COPⅠ-ARF1).

[0046] Figure 2 This is the result of agarose gel electrophoresis of dsRNA synthesis products.

[0047] Figure 3 This is the mortality result of yellow striped flea beetle after microinjection of dsRNA.

[0048] Figure 4 is the expression result of the target gene of the yellow flea beetle after microinjection of dsRNA. Figure 4 A in the figure is the expression result of COPI-γ gene; Figure 4 B in the figure is the expression result of COPⅠ-ARF1 gene; Figure 4 C in the figure is the expression level of dsRNase gene.

[0049] Figure 5 This is the statistical result of the mortality of yellow flea beetles after injection of dsRNA in indoor biological testing. Figure 5 A in the figure is the mortality statistics of yellow striped flea beetle after microinjection of dsCOPⅠ-γ and / or dsRNase; Figure 5 B in it is the statistical result of the mortality rate of Phyllotreta striolata after microinjection of dsCOPⅠ-ARF1 and / or dsRNase; Figure 5 C in it is the statistical result of the mortality rate of Phyllotreta striolata after microinjection of dsCOPⅠ-γ&ARF1 and / or dsRNase.

[0050] Figure 6 It is the result of the expression levels of dsCOPⅠ-γ gene and dsCOPⅠ-ARF1 gene of Phyllotreta striolata after injection of dsRNA in the indoor bioassay.

[0051] Figure 7 It is the schematic diagram of the plot planning for the field control experiment of adult Phyllotreta striolata.

[0052] Figure 8 It is the graph of the reduction rate of adult Phyllotreta striolata in the field control experiment of adult Phyllotreta striolata. Detailed implementation mode

[0053] Example 1: Design of RNA interference target

[0054] The 1st, 2nd, and 3rd targets in this example are derived from the 5th chromosome of Phyllotreta striolata (GenBank accession number: OU900098.1); the 4th target is derived from the 8th chromosome of Phyllotreta striolata (GenBank accession number: OU900101.1).

[0055] Target 1: Coat protein complex I-γ (COPⅠ-γ) of Phyllotreta striolata

[0056] Sense strand (490 bp):

[0057] GAUAAAGUUGUUGUACAAGUUUUUAUCGUUUUUGCUAAGUAUGCUGCUGUAAUAAGUGGCUCUGUCUCUGACUUCAUCGUCAGAGUCCAUUUGGCAUCUGGCUAGUAAUACUUGAAUAUUUUCUAACAAAUCGGGACACGAGGCUCCGAAUUGGGCCAUGGCAGAAACAGCGGCUGCUCUUAUAGAAGGGCACUCUAAGAUGACGCGGUUGUAAAUGAAACGGAUAUAUCUGGAAGGUUGUUUGGUUUUCGGUCCUUCUCUACCAAGCAGAUGCAAUAUUCUAACAGCUAAAGAAACGUGUUCGCAAUCUUCAAUAAACUCGCACAGAUGAGCCAAACCCGAUUCUUUAGCUUCAGGAUUAUCCUCGAUAAUGGUGAUUAUGGUGUCCGCAAUGGAAGCUUUGUAUUCCAAACCGCCUUCAUCUCUUAGCAUGGCCGAUAAAAAGUUCAUGAGAGUGUUGUGCUUUCGAGGGAAUUUAAGAGCCAGCGCU (SEQ ID NO: 1)

[0058] Antisense strand (490 bp):

[0059] AGCGCUGGCUCUUAAAUUCCCUCGAAAGCACAACACUCUCAUGAACUUUUUAUCGGCCAUGCUAAGAGAUGAAGGCGGUUUGGAAUACAAAGCUUCCAUUGCGGACACCAUAAUCACCAUUAUCGAGGAUAAUCCUGAAGCUAAAGAAUCGGGUUUGGCUCAUCUGUGCGAGUUUAUUGAAGAUUGCGAACACGUUUCUUUAGCUGUUAGAAUAUUGCAUCUGCUUGGUAGAGAAGGACCGAAAACCAAACAACCUUCCAGAUAUAUCCGUUUCAUUUACAACCGCGUCAUCUUAGAGUGCCCUUCUAUAAGAGCAGCCGCUGUUUCUGCCAUGGCCCAAUUCGGAGCCUCGUGUCCCGAUUUGUUAGAAAAUAUUCAAGUAUUACUAGCCAGAUGCCAAAUGGACUCUGACGAUGAAGUCAGAGACAGAGCCACUUAUUACAGCAGCAUACUUAGCAAAAACGAUAAAAACUUGUACAACAACUUUAUCC (SEQ ID NO: 2)

[0060] Target 2: Phyllotreta striolata coat protein complex I-ARF1 (COPⅠ-ARF1)

[0061] Sense strand (490 bp):

[0062] CCUUCGUAGAGACCGUCUCCGCUGGUGGCGCACGUGGCCUGUAUGUACCAGUUACGGUUGCGCAACGAAUGUAAUCCGAGCUUAUCGGUGAUUUCGGCGGCGUUCAUGGCGUUCGGCAAAUCCUGCUUGUUGGCGAAUAUCAGAAGAACGGCGUCCCGGAGCUCGUCUUCGGCCAGCAUGCGCAUCAGCUCGUCUUUGGCCUCGGUGAUACGCUCCCUGUCGUUGCUGUCGACUACGAAGAUUAGGCCCUGCGUAUUUUGAAAAUAGUGUCUCCACAAUGGCCUAAUUUUAUCCUGACCACCGACAUCCCACACAGUAAAGCUGAUAUUCUUAUAUUCUACAGUCUCGACAUUAAAACCAAUAGUUGGGAUGGUUGUUACAAUUUCUCCUAAUUUUAGUUUAUAUAAAAUUGUGGUUUUACCAGCAGCAUCUAAACCUACCAUCAAUAUCCUCAUUUCCUUUUUGCCGAAGAGGCCUUUAAAUAAAUUAG (SEQ ID NO: 3)

[0063] Antisense strand (490 bp):

[0064] CUAAUUUAUUUAAAGGCCUCUUCGGCAAAAAGGAAAUGAGGAUAUUGAUGGUAGGUUUAGAUGCUGCUGGUAAAACCACAAUUUUAUAUAAACUAAAAUUAGGAGAAAUUGUAACAACCAUCCCAACUAUUGGUUUUAAUGUCGAGACUGUAGAAUAUAAGAAUAUCAGCUUUACUGUGUGGGAUGUCGGUGGUCAGGAUAAAAUUAGGCCAUUGUGGAGACACUAUUUUCAAAAUACGCAGGGCCUAAUCUUCGUAGUCGACAGCAACGACAGGGAGCGUAUCACCGAGGCCAAAGACGAGCUGAUGCGCAUGCUGGCCGAAGACGAGCUCCGGGACGCCGUUCUUCUGAUAUUCGCCAACAAGCAGGAUUUGCCGAACGCCAUGAACGCCGCCGAAAUCACCGAUAAGCUCGGAUUACAUUCGUUGCGCAACCGUAACUGGUACAUACAGGCCACGUGCGCCACCAGCGGAGACGGUCUCUACGAAGG (SEQ ID NO: 4)

[0065] Target 3: Phyllotreta striolata coat protein complex I-γ & ARF1 (COPⅠ-γ & ARF1)

[0066] Sense strand (490 bp):

[0067] UCUCUACCAAGCAGAUGCAAUAUUCUAACAGCUAAAGAAACGUGUUCGCAAUCUUCAAUAAACUCGCACAGAUGAGCCAAACCCGAUUCUUUAGCUUCAGGAUUAUCCUCGAUAAUGGUGAUUAUGGUGUCCGCAAUGGAAGCUUUGUAUUCCAAACCGCCUUCAUCUCUUAGCAUGGCCGAUAAAAAGUUCAUGAGAGUGUUGUGCUUUCGAGGGAAUUUUCCGAGCUUAUCGGUGAUUUCGGCGGCGUUCAUGGCGUUCGGCAAAUCCUGCUUGUUGGCGAAUAUCAGAAGAACGGCGUCCCGGAGCUCGUCUUCGGCCAGCAUGCGCAUCAGCUCGUCUUUGGCCUCGGUGAUACGCUCCCUGUCGUUGCUGUCGACUACGAAGAUUAGGCCCUGCGUAUUUUGAAAAUAGUGUCUCCACAAUGGCCUAAUUUUAUCCUGACCACCGACAUCCCACACAGUAAAGCUGAUAUUCUUAUAUUCUACAG (SEQ ID NO: 5)

[0068] Antisense strand (490 bp):

[0069] CUGUAGAAUAUAAGAAUAUCAGCUUUACUGUGUGGGAUGUCGGUGGUCAGGAUAAAAUUAGGCCAUUGUGGAGACACUAUUUUCAAAAUACGCAGGGCCUAAUCUUCGUAGUCGACAGCAACGACAGGGAGCGUAUCACCGAGGCCAAAGACGAGCUGAUGCGCAUGCUGGCCGAAGACGAGCUCCGGGACGCCGUUCUUCUGAUAUUCGCCAACAAGCAGGAUUUGCCGAACGCCAUGAACGCCGCCGAAAUCACCGAUAAGCUCGGAAAAUUCCCUCGAAAGCACAACACUCUCAUGAACUUUUUAUCGGCCAUGCUAAGAGAUGAAGGCGGUUUGGAAUACAAAGCUUCCAUUGCGGACACCAUAAUCACCAUUAUCGAGGAUAAUCCUGAAGCUAAAGAAUCGGGUUUGGCUCAUCUGUGCGAGUUUAUUGAAGAUUGCGAACACGUUUCUUUAGCUGUUAGAAUAUUGCAUCUGCUUGGUAGAGA (SEQ ID NO: 6)

[0070] Target 4: Striped flea beetle double-stranded ribonuclease dsRNase (Double-stranded Ribonuclease, dsRNase)

[0071] Sense strand (476 bp):

[0072] GAUGGAUGAAUUGUACAACAACGAUGUCCAACGGCAAACUAUUAACAGGCAAUUGGGUUUACCUGAAGAAGAUACUAGUUACGUUAAACCGCAUGGUACGCGUUAUUUAGCUAGAGGUCAUUUAACAGCCAAAGCGGAUUUCAUGUACAAUGCUGAACAGCAAGCCACUUUUCACUACAUUAACUCGGCGCCACAAUGGCAAUCUUUCAAUGCACGCAACUGGUUUUACUUGGAGAGAAACCUCAGGAAUUUCGUUGCCGAGAAAUACAUCGACGUACUAGUGUACACAGGAACUUACGGAGCAUUAACUCUACCUCACGCAUCAACCGGCGAGGAGACGGACGUUUACUUCUACUUCGACUCGAACGGUGAAAGGUUCGUUCCAAUUCCGGAGCUGUUCUGGAAAGUGGCCUACGAUCCGGUCCAUAGAGCAGGUGUAGCGGUAAUCGGAUUGAAUAAUCCCUAUCAAACAGACA (SEQ ID NO: 7)

[0073] Antisense strand (476 bp):

[0074] UGUCUGUUUGAUAGGGAUUAUUCAAUCCGAUUACCGCUACACCUGCUCUAUGGACCGGAUCGUAGGCCACUUUCCAGAACAGCUCCGGAAUUGGAACGAACCUUUCACCGUUCGAGUCGA AGUAGAAGUAAACGUCCGUCUCCUCGCCGGUUGAUGCGUGAGGUAGAGUUAAUGCUCCGUAAGUUCCUGUGUACACUAGUACGUCGAUGUAUUUCUCGGCAACGAAAUUCCUGAGGUUUC UCUCCAAGUAAAACCAGUUGCGUGCAUUGAAAGAUUGCCAUUGUGGCGCCGAGUUAAUGUAGUGAAAAGUGGCUUGCUGUUCAGCAUUGUACAUGAAAUCCGCUUUGGCUGUUAAAUGAC CUCUAGCUAAAUAACGCGUACCAUGCGGUUUAACGUAACUAGUAUCUUCUUCAGGUAAACCCAAUUGCCUGUUAAUAGUUUGCCGUUGGACAUCGUUGUUGUACAAUUCAUCCAUC (SEQ ID NO: 8)

[0075] GFP (used as a control later, as the yellow flea beetle does not contain related genes)

[0076] Sense strand (416 bp):

[0077] AAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCACGUGACCACCCUGACCUACGGCGUGCAGCGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAA (SEQ ID NO: 19)

[0078] Antisense strand (416 bp):

[0079] UUCACCUUGAUGCCGUUCUUCUGCUUGUCGGCCAUGAUAUAGACGUUGUGGCUGUUGUAGUUGUACUCCAGCUUGUGCCCCAGGAUGUUGCCGUCCUCCUUGAAGUCGAUGCCCUUCAGCUCGAUGCGGUUCACCAGGGUGUCGCCCUCGAACUUCACCUCGGCGCGGGUCUUGUAGUUGCCGUCGUCCUUGAAGAAGAUGGUGCGCUCCUGGACGUAGCCUUCGGGCAUGGCGGACUUGAAGAAGUCGUGCUGCUUCAUGUGGUCGGGGUAGCGGCUGAAGCGCUGCACGCCGUAGGUCAGGGUGGUCACGUGGGUGGGCCAGGGCACGGGCAGCUUGCCGGUGGUGCAGAUGAACUUCAGGGUCAGCUUGCCGUAGGUGGCAUCGCCCUCGCCCUCGCCGGACACGCUGAACUU (SEQ ID NO: 20)

[0080] Example 2: Synthesis of dsRNA for interference

[0081] Amplification of single target gene fragments

[0082] Snap Gene 17.0 software was used to design flea beetle target amplification primers, and a T7 promoter sequence was added to the 5' end to obtain the primer sequences shown in Table 1 (T7 promoter sequence is represented by lowercase letters).

[0083] Total RNA was extracted from the yellow beetle, and cDNA was obtained by reverse transcription. Then, PCR amplification was performed using cDNA as a template according to the procedure in Table 2. The PCR product was purified and recovered after 1% agarose gel electrophoresis.

[0084] Table 1: Primers for amplification of dsCOPⅠ-γ, dsCOPⅠ-ARF1 and dsRNase

[0085]

[0086] Table 2: PCR amplification program

[0087]

[0088] Amplification of dual target gene fragments

[0089] Snap Gene 17.0 software was used to design flea beetle target amplification primers, and a T7 promoter sequence (taatacgactcactatagg) was added to the 5′ end to obtain the primer sequences shown in Table 3 .

[0090] Total RNA of the yellow beetle was extracted and reverse transcribed to obtain cDNA. Then, cDNA was used as a template and PCR amplification was performed according to the procedure in Table 2. The amplification process is as follows: Figure 1 As shown, the PCR products were purified and recovered by 1% agarose gel electrophoresis.

[0091] Table 3: dsCOPⅠ-γ&ARF1 amplification primers

[0092]

[0093] In vitro transcription of dsRNA

[0094] The purified PCR product was used as a template and an in vitro transcription kit was used to perform in vitro transcription to synthesize dsRNA. The components of the dsRNA synthesis solution system were prepared as shown in Table 4.

[0095] After the PCR product was incubated at 37°C for 2h, 50µL DNaseI was added and digested at 37°C for 1h. After the DNaseI digestion was completed, 10µL proteinase K was added for digestion for 30min. After the proteinase K digestion was completed, the dsRNA was replaced into water using a 100kD Merck ultrafiltration tube to obtain a solution including four target dsRNAs and a control dsRNA (i.e., dsGFP, dsRNA targeting GFP), and the sequences of each dsRNA are shown in Example 1. The concentration of each dsRNA sample was determined by Nanodrop and detected by 1.5% agarose gel electrophoresis.

[0096] The electrophoresis results are as follows Figure 2 As shown ("M" represents Marker; "1" represents dsCOPⅠ-γ; "2" represents dsCOPⅠ-ARF1; "3" represents dsCOPⅠ-γ&ARF1; "4" represents dsRNase; "5" represents dsGFP), the band lengths of the five samples are all close to 500 bp, but slightly less than 500 bp, indicating that dsRNA of the correct band length was recovered.

[0097] Table 4: dsRNA synthesis solution system components

[0098]

[0099] Example 3: Single-target dsRNA microinjection

[0100] Through microinjection technology, the dsRNA or siRNA solution prepared in advance can be directly introduced into adults, pupae, larvae or embryos using a microinjection instrument, so that the sample can be directly introduced into the cells and hemolymph of the insect.

[0101] Newly emerged adults of yellow-curved striped flea beetles (age <12 h) were selected for the test. Each dsRNA solution obtained in Example 2 was loaded into a microinjector and injected into the abdomen of the test insect. Each flea beetle was injected with 200 nL dsRNA at a concentration of 500 ng / µL. On the 5th day after injection, 3 flea beetles were collected from each group as a sample, and 3 parallel replicates were made for each sample. The collected flea beetle samples were quickly placed in a centrifuge tube in liquid nitrogen and stored in a -80 ℃ refrigerator.

[0102] According to the different target dsRNAs injected, the mice were divided into dsCOPⅠ-γ group, dsCOPⅠ-ARF1 group, dsCOPⅠ-γ& ARF1 group and dsRNase group. A negative control group was also set up, in which dsGFP solution of the same concentration and volume was injected instead of the target dsRNA solution.

[0103] RNA was extracted from the samples of the yellow-curved flea beetle and reverse transcribed into cDNA. The Actin gene of the yellow-curved flea beetle was used as the internal reference gene, and the mRNA expression levels of the target genes (COPⅠ-γ, COPⅠ-ARF1 and dsRNase) were detected by RT-qPCR. The qPCR primer sequences of the target genes and internal reference genes are shown in Table 5.

[0104] Table 5: qPCR primers for the yellow flea beetle

[0105]

[0106] The microinjection results showed that compared with the control group, the dsRNA of the four targets had significant protective effects against flea beetles ( Figure 3 , P<0.05). On the 5th day after injection, the mortality of flea beetles increased significantly, which were 46.4% (dsCOPⅠ-ARF1 group), 41.3% (dsCOPⅠ-γ group), 42.8% (dsCOPⅠ-γ&ARF1 group), and 25% (dsRNase group). On the 9th day after injection, the mortality of dsCOPⅠ-ARF1 group reached 86.1%, 74.2%, and 83% in dsCOPⅠ-γ&ARF1 group. On the 11th day after injection, the mortality of dsCOPⅠ-γ group reached 93.5%, 100% in dsCOPⅠ-ARF1 group, 100% in dsCOPⅠ-γ&ARF1 group, and 68% in dsRNase group.

[0107] RT-qPCR results ( Figure 4 , *** indicates significant difference by T test P < 0.05) showed that 5 days after microinjection, the mRNA expression levels of the three single-target genes (COPⅠ-γ, COPⅠ-ARF1, dsRNase) were significantly downregulated, among which the expression level of the target gene COPⅠ-γ in the dsCOPⅠ-γ group was downregulated by 70.1% ( Figure 4 , A); the expression level of the target gene COPⅠ-ARF1 in the dsCOPⅠ-ARF1 group was downregulated by 83.3% ( Figure 4 , B); the expression level of the target gene dsRNase in the dsRNase group was downregulated by 80.1% ( Figure 4 , C).

[0108] The above results show that directly injecting dsRNA into adult flea beetles through microinjection technology can effectively control flea beetles with a high mortality rate by inducing RNAi.

[0109] Example 4: Indoor test of yellow striped flea beetle adults

[0110] In order to further verify the interference effect of dsRNA, the dsRNA parent drugs (dsCOPⅠ-γ, dsCOPⅠ-ARF1, dsCOPⅠ-γ&ARF1 and dsRNase) obtained in Example 2 were prepared into 500 mg / L solutions using sterile water. Then dsRNase was compounded with the other three target RNAs. According to the different dsRNA in the solution, they were divided into dsCOPⅠ-γ group, dsCOPⅠ-ARF1 group, dsCOPⅠ-γ&ARF1 group, dsRNase group, dsCOPⅠ-γ+dsRNase group, dsCOPⅠ-ARF1+dsRNase group and dsCOPⅠ-γ&ARF1+dsRNase group. Among them, the total concentration of dsRNA in the compound groups (dsCOPⅠ-γ+dsRNase group, dsCOPⅠ-ARF1+dsRNase group and dsCOPⅠ-γ&ARF1+dsRNase group) was 500 mg / L, and the concentration of a single dsRNA in each group was 250 mg / L. In addition, 500 mg / L dsGFP solution was used as a negative control.

[0111] Fresh cabbage leaves were taken, rinsed with clean water, made into leaf discs with a diameter of 5 cm, and dried. The leaf discs were treated by the leaf dipping method, that is, the leaf discs were soaked in the dsRNA solutions of each group or the solutions of each control group, and taken out after being fully soaked for 4 seconds, and placed in a cool and ventilated place to dry naturally for feeding flea beetles.

[0112] Fifteen healthy and active flea beetles raised indoors were selected from each group and placed in a plastic wide-mouth bottle with a leaf disc pre-treated by the leaf dipping method, sealed with a rubber band and a breathable gauze, and cultured on a plant culture rack at 25±2℃ with alternating light and dark for 12 hours each, as a sample. Four parallel replicates were made for each sample.

[0113] Lethal effect determination

[0114] The survival rate of flea beetles was investigated on the 1st, 3rd, 5th, 7th, 9th and 11th days after the above culture. The death standard is: the test insect is placed in the culture dish, and after the insect body is lightly touched, if no movement or other reaction is observed within 10 seconds, it is considered dead; survival rate (%) = number of surviving insects / total number of insects × 100%; mortality rate (%) = (1-number of surviving insects / total number of insects) × 100%.

[0115] like Figure 5As shown, on the first day after the start of culture, except for the dsRNase group, the mortality rate of each dsRNA group was significantly higher than that of the negative control group (dsGFP group); from the third day after the start of culture, the mortality rate of each dsRNA group including the dsRNase group was significantly higher than that of the negative control group (dsGFP group); on the 11th day after the start of culture, the mortality rates of each single-use group (dsCOPⅠ-γ group, dsCOPⅠ-ARF1 group, dsCOPⅠ-γ&ARF1 group, dsRNase group) were as follows: 96.7% ( Figure 5 , C), 89.3% in dsCOPⅠ-ARF1 group ( Figure 5 , B), 86.7% in dsCOPⅠ-γ group ( Figure 5 , A), 53.3% in dsRNase group ( Figure 5 , A~C).

[0116] It is worth noting that within the first 11 days after the start of culture, before reaching the highest mortality rate, the mortality rates of the compound groups (dsCOPⅠ-γ+dsRNase group, dsCOPⅠ-ARF1+dsRNase group and dsCOPⅠ-γ&ARF1+dsRNase group) were significantly higher than those of the dsRNA single-use groups (dsCOPⅠ-γ group, dsCOPⅠ-ARF1 group, dsCOPⅠ-γ&ARF1 group and dsRNase group). The results showed that after compounding with dsRNase, the mortality rate of each dsRNA against the yellow striped flea beetle increased, and the action time to reach the same mortality rate was significantly reduced.

[0117] Determination of target gene expression inhibition effect

[0118] On the 5th day after the start of the above culture, the mRNA expression level of the target gene (COPⅠ-γ and COPⅠ-ARF1) was determined by RT-qPCR according to the method of Example 3. The test result data were statistically analyzed by ANOVA test using Prism10 software, and the significance between groups was analyzed by multiple comparisons.

[0119] like Figure 6As shown in the figure, compared with the negative control group (dsGFP group), the expression levels of COPI-γ gene or COPI-ARF1 gene in other groups were significantly decreased. In addition, the expression level of COPI-γ gene or COPI-ARF1 in each compound group (dsCOPⅠ-γ+dsRNase group, dsCOPⅠ-ARF1+dsRNase group and dsCOPⅠ-γ&ARF1+dsRNase group) was significantly lower than that in each dsRNA single use group (dsCOPⅠ-γ group, dsCOPⅠ-ARF1 group and dsCOPⅠ-γ&ARF1 group). The results showed that after compounding with dsRNase, the silencing efficiency of each target dsRNA on the target gene was significantly improved.

[0120] From the results of the above indoor bioassays, it can be seen that the single-target dsCOPⅠ-γ and dsCOPⅠ-ARF1 and the dual-target dsCOPⅠ-γ&ARF1 can significantly reduce the expression of the target gene and effectively kill the yellow-curved striped flea beetle, among which the dual-target dsCOPⅠ-γ&ARF1 has the best effect. After the three target dsRNAs are further compounded with dsRNase, the inhibitory effect on the expression of the target gene and the lethality of the yellow-curved striped flea beetle are significantly improved. It can be seen that COPⅠ-ARF1 and COPⅠ-γ are effective targets for flea beetle prevention and control.

[0121] Example 5: Field test on control of adult yellow flea beetles

[0122] Experimental site and grouping: The experimental site is located in the Guiyi Technology Vegetable Base in Pudong New District, Shanghai. Brassica rapa var. chinensis (L.) Kitam is planted all year round in the experimental site, with a row spacing of 20 cm and a plant spacing of 15 cm. Figure 7 The experimental site is planned to have several experimental areas, with protective rows and water channels around the experimental areas; each experimental area contains three small areas with an area of ​​48 m 2 There are 27 plots in total. During the experiment, the yellow striped flea beetle caused serious damage. The land in the experimental plot was leveled and formed into ridges, which was convenient for drainage and irrigation, and the soil was sandy loam. The experiment was divided into 9 groups according to the scheme shown in Table 6, and each group corresponded to 1 plot.

[0123] Table 6: Field control groups for yellow flea beetle adults

[0124]

[0125] Preparation of the pesticide composition: dsCOPⅠ-γ, dsCOPⅠ-ARF1, dsCOPⅠ-γ&ARF1 and dsRNase obtained in Example 2 were diluted with sterile water to 500 mg / L solution, and then dsRNase was compounded with the other three target RNAs. According to the different dsRNA in the solution, they were divided into dsCOPⅠ-γ group, dsCOPⅠ-ARF1 group, dsCOPⅠ-γ&ARF1 group, dsRNase group, dsCOPⅠ-γ+dsRNase group, dsCOPⅠ-ARF1+dsRNase group and dsCOPⅠ-γ&ARF1+dsRNase group. Among them, the total concentration of dsRNA in the compound groups (dsCOPⅠ-γ+dsRNase group, dsCOPⅠ-ARF1+dsRNase group and dsCOPⅠ-γ&ARF1+dsRNase group) was 500 mg / L, and the concentration of a single dsRNA in each group was 250 mg / L. In addition, 500 mg / L dsGFP solution was used as a negative control. Dilute pyridabenz with sterile water to a concentration of 500 mg / L as a positive control, and dilute dsGFP with sterile water to a concentration of 500 mg / L as a negative control. Finally, add 0.1% (w / v) Tween-20 to the diluted solutions to prepare the pesticide compositions.

[0126] When the adult yellow striped flea beetle was observed to be infesting, the first application of pesticide was carried out with a 3WBD-16L backpack electric sprayer, and the second application was carried out 3 days later. The number of applications and the date of application were recorded for each application. No pesticides for the prevention and control of other pests and diseases were applied during the experiment. When applying pesticides, the corresponding preparations should be sprayed around the test area of ​​each dsRNA. Both the drug belts and the canals can confine the flea beetles to the square test area to prevent them from escaping. Seven days after the first drug treatment, 5 plants were randomly selected at each point in each plot according to the five-point sampling method to investigate the number of live adults, so as to calculate the adult reduction rate of each group relative to the negative control group. The test result data were statistically analyzed by ANOVA test using Prism10 software, and the significance between groups was analyzed by multiple comparisons.

[0127] The statistical results of the field control experiment are as follows: Figure 8As shown in the figure, there were significant differences in the reduction rate of adults in different groups (P<0.05). The reduction rate of the negative control dsGFP group was only (5.2±1.1)%, indicating that it had no significant interference effect on flea beetles; the reduction rate of the positive control pyridamole group reached (81.3±2.5)% (marked B), confirming the insecticidal efficacy of traditional chemical agents. In the single-target group, the reduction rate of the dsCOPI-γ group was (62.1±3.4)% (marked D), the dsCOPⅠ-ARF1 group was (68.7±2.9)% (marked CD), and the dsRNase group was (43.6±2.7)% (marked E). It can be seen that dsRNA targeting COPI-γ, COPⅠ-ARF1 or dsRNase has a significant control effect on yellow striped flea beetles. The dual-target group had better effects, with the reduction rate of the dsCOPI-γ&ARF1 group reaching (86.5±2.1)% (marked AB). In the combined group, the reduction rate of the dsCOPI-γ&ARF1+dsRNase group reached (92.4±1.8)% (marked A), which was the highest value among all groups.

[0128] In summary, the low reduction rate of the dsGFP group verifies the effectiveness of the negative control in the experimental system and excludes the influence of nonspecific interference. As a positive control, the high reduction rate of pyraclostrobin provides an effect reference for confirming the gene interference method. The dsRNA of the present invention for three targets (COPI-γ, COPⅠ-ARF1 and dsRNase) has excellent flea beetle control effect, and at the same time has the safety and easy degradability of dsRNA pesticides, which can effectively overcome the problems of high toxicity and high residue of existing chemical pesticides. Among them, the control effects of the dsCOPⅠ-γ&ARF1 scheme of the dual-target group and the three schemes of dsCOPⅠ-γ+dsRNase, dsCOPⅠ-ARF1+dsRNase, and dsCOPⅠ-γ&ARF1+dsRNase in the compound group are close to those of the traditional chemical pesticide pyraclostrobin at the same concentration (500 mg / L), among which, in particular, the dsCOPⅠ-γ&ARF1+dsRNase scheme has the best effect and is better than pyraclostrobin.

Claims

1. A dsRNA for Coleopteran insects, characterized in that: The dsRNA targeting Coleopteran insects comprises a sense strand with a nucleotide sequence as shown in SEQ ID NO:5 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO:

6.

2. A method for preparing the dsRNA targeting coleopteran insects as claimed in claim 1, characterized in that: The method comprises the following steps: S1: Extract total RNA from coleopteran insects; S2: cDNA obtained by reverse transcription of total RNA; S3: Using cDNA as a template, dsRNA is obtained by PCR amplification.

3. A pesticide composition, characterized in that: The pesticide composition comprises the dsRNA targeting coleopteran insects as claimed in claim 1, and a diluent, carrier or solubilizer acceptable to pesticides.

4. The pesticide composition according to claim 3, characterized in that The pesticide composition also includes a dsRNA targeting a dsRNase gene of a coleopteran insect.

5. The pesticide composition according to claim 3, characterized in that The dsRNA targeting the dsRNase gene of Coleopteran insects comprises a sense strand with a nucleotide sequence as shown in SEQ ID NO:7 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO:

8.

6. The pesticide composition according to claim 3, characterized in that The concentration of the dsRNA targeting coleopteran insects in the pesticide composition is 1-5000 mg / L.

7. Use of the dsRNA for controlling coleopteran insects according to claim 1, characterized in that: The dsRNA targeting coleopteran insects is used to kill coleopteran insects or inhibit the growth of coleopteran insects.

8. Use of the pesticide composition according to any one of claims 3 to 6 in controlling coleopteran insects, characterized in that: The pesticide composition is used for killing coleopteran insects or inhibiting the growth of coleopteran insects.

9. A method for controlling coleopteran insects, characterized in that: The method comprises using the dsRNA against coleopteran insects as claimed in claim 1.

10. A method for controlling coleopteran insects, characterized in that: The method comprises using the pesticide composition according to any one of claims 3 to 6.

Images