Soybean MYC2-like transcription factor gene GmMYC3 and application of KASP marker thereof

Abstract

The invention discloses a soybean MYC2-like transcription factor gene GmMYC3 and application of a KASP marker of the soybean MYC2-like transcription factor gene GmMYC3. The invention relates to an application of a soybean MYC2-like transcription factor gene GmMYC3 in gene engineering modification of resistance of soybeans to defoliating pests. Through overexpression of the gene, the resistance of soybeans to prodenia litura and spodoptera litura can be remarkably improved. The gene is knocked out, so that the insect resistance of the soybean can be weakened. The invention discloses genetic variation of a GmMYC3 promoter as shown in SEQ ID NO.3 and application of a KASP marker developed by the genetic variation in soybean insect-resistant breeding. By detecting whether the genotype of deoxyribonucleotide at the position of 4451695bp of a chromosome 7 in a soybean genome Glycine max Wm82.a2.v1 to be detected is CC or TT, the insect resistance of the soybeans to be detected is determined, and the insect resistance of the soybeans to be detected with the genotype CC is higher than that of the soybeans to be detected with the genotype TT.

Description

Technical Field

[0001] The invention relates to application of soybean MYC2-like transcription factor gene GmMYC3 and KASP marker thereof, and belongs to the field of genetic engineering. Background Art

[0002] Soybean is an important food and cash crop in the world, and is also the main source of protein and oil for humans. The fall armyworm is the main leaf-feeding pest in southern my country and the Jianghuai region, causing serious economic losses to farmers. The fall armyworm has recently become one of the most destructive leaf-feeding pests in corn production in Asia and Africa. It can complete its life cycle in soybeans and may become a potential pest of soybeans in future corn-soybean composite planting. Therefore, the cultivation of insect-resistant soybean varieties has become an urgent need for soybean breeding and an important task for the development of sustainable agriculture.

[0003] MYC2-like transcription factors are core transcription factors in the plant jasmonic acid signaling pathway and are widely involved in regulating various physiological processes such as plant growth and development, stress response and defense response. In terms of growth and development, Arabidopsis AtMYC2 / 3 / 4 not only act as inhibitors of flowering and stomatal development, but also regulate seed size, quality and storage protein accumulation. Tomato LeMYC2 is a negative regulator of blue light-mediated photomorphogenesis and can promote the growth of adult tomatoes. In terms of stress response, Arabidopsis AtMYC2 impairs the salt stress tolerance of seedlings by mediating the inhibition of the expression of the antioxidant enzyme AtCAT2. PtrMYC2 of trifoliate orange promotes its cold tolerance by regulating the biosynthesis of betaine by regulating the betaine aldehyde dehydrogenase PtrBADH-1. In terms of biotic stress, Arabidopsis AtMYC2 / 3 / 4 / 5 have redundant functions in regulating the biosynthesis of glucosinolates, and the quadruple mutant atmyc2 / 3 / 4 / 5 is extremely sensitive to the beet armyworm. Maize ZmMYC2a / b plays an important role in the defense response to armyworms and fall armyworms by mediating the biosynthesis of benzoxazine and volatile terpenes. There are 22 MYC genes in soybean. The applicant previously located the soybean GmMYC3 gene through joint linkage analysis and whole genome association analysis, but the function of this gene has not yet been reported. Summary of the invention

[0004] The purpose of the present invention is to disclose the insect-resistant genetic engineering application of soybean MYC2-like transcription factor gene GmMYC3 and provide a method for using its KASP marker in molecular-assisted selection of highly insect-resistant soybean varieties.

[0005] GmMYC3 is highly expressed in soybean leaves, flowers and pods, and can quickly respond to the feeding induction of the main soybean pest Spodoptera litura. The up-regulation fold in the resistant parent soybean KF No.1 is much greater than that in the susceptible parent soybean NN 1138-2. This gene encodes a nuclear localization protein and shows transcriptional activation activity in yeast. GmMYC3 cloned from KF No.1 and NN 1138-2 was introduced into soybean as a target gene, which can significantly improve the accumulation of soybean trypsin inhibitor and resistance to Spodoptera litura. On the contrary, knocking out this gene in soybean can weaken the insect resistance of soybean. Overexpression of GmMYC3 also shows resistance to the omnivorous pest of corn and soybean, Spodoptera frugiperda. In addition, there is a genetic variation in the promoter region of this gene between the resistant and susceptible parent soybeans, which is closely linked to soybean insect resistance. KASP markers have been developed for this variation, which can be used for molecular marker-assisted selection breeding.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The soybean MYC2-like transcription factor gene GmMYC3 is used in genetically engineering soybean resistance to leaf-feeding pests. The coding region sequences of the soybean MYC2-like transcription factor gene GmMYC3 in the resistant parent soybean KF No.1 and the susceptible parent soybean NN 1138-2 are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0008] As a preferred embodiment of the present invention, the leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.

[0009] As a preferred embodiment of the present invention, overexpression of the GmMYC3 gene can significantly improve the resistance of soybean to Spodoptera litura and Spodoptera frugiperda. On the contrary, knocking out the GmMYC3 gene can weaken the insect resistance of soybean.

[0010] Use of an expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 described in claim 1 in improving soybean resistance to leaf-feeding pests.

[0011] As a preferred embodiment of the present invention, the leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.

[0012] The application of the KASP marker developed for the genetic variation of the GmMYC3 gene promoter of the present invention in soybean insect-resistant breeding, the KASP molecular marker primer sequence: the upstream primer F1 is 5'-gaaggtgaccaagttcatgctGCACGAACCACTATTATCTTTTTAATCTTC-3' (SEQ ID NO.6), the upstream primer F2 is 5'-gaaggtcggagtcaacggattGCACGAACCACTATTATCTTTTTAATCTTT-3' (SEQ ID NO.7) and the downstream primer R is 5'-ACCAGACAGGATCAAAGATACTTT-3' (SEQ ID NO.8).

[0013] As a preferred embodiment of the present invention, the GmMYC3 promoter region located at the 4451695bp position of chromosome 7 in the soybean genome Glycine max Wm82.a2.v1 undergoes a C to T substitution between the resistant and susceptible parental soybeans. This genetic variation is closely linked to the insect resistance of soybeans, and the insect resistance of the tested soybeans with the CC genotype is higher than that of the tested soybeans with the TT genotype.

[0014] Beneficial Effects

[0015] GmMYC3 encodes a key transcription factor in the plant jasmonic acid signal transduction pathway. Through expression pattern analysis, it was found that GmMYC3 was mainly expressed in soybean leaves, flowers and pods. After induction by Spodoptera litura, its expression was rapidly upregulated in leaves, and the upregulation fold in the resistant parent soybean KF No.1 was much greater than that in the susceptible parent soybean NN 1138-2. Subcellular localization and yeast transcriptional activity analysis showed that GmMYC3 was a nuclear-localized transcription factor with transcriptional activity. Through insect non-selective feeding experiments, it was confirmed that this gene not only positively regulates soybean resistance to the main pest Spodoptera litura, but also shows resistance to the omnivorous pest of corn and soybean, Spodoptera frugiperda. At the same time, overexpression of GmMYC3 can increase the accumulation of defense-related substances trypsin inhibitor. Therefore, GmMYC3 can be used as a target for regulating soybean resistance to Spodoptera litura and Spodoptera frugiperda, and can be used for insect resistance modification of soybean. The KASP marker was developed based on the genetic variation of the GmMYC3 promoter region in the two parental soybeans. This molecular marker can effectively distinguish resistant and susceptible soybean varieties and is of great value in soybean insect-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1Agarose gel electrophoresis after PCR cloning of GmMYC3. 1: The target fragment size in the resistant parent soybean KF No.1 is 1401 bp, 2: The target fragment size in the susceptible parent soybean NN 1138-2 is 1395 bp; M: Marker DL2000Plus. Figure 2 Tissue expression pattern of GmMYC3 in the resistant parent soybean KF No. 1 (n=3). Error bars represent ±SE.

[0017] Figure 3 GmMYC3 can respond quickly to Spodoptera litura stress induction. Changes in the expression of GmMYC3 in the resistant parent soybean KF No.1 and the susceptible parent soybean NN 1138-2 after simulated insect induction (W+OS) treatment for 0.5, 4 and 8 h (n=3). Two-tailed t test: **, P<0.01; ns, not significant. Error bars represent ±SE.

[0018] Figure 4 Subcellular localization of GmMYC3-GFP fusion protein in Arabidopsis protoplasts. 35S:GFP vector was used as a control. Scale bar = 10 μm.

[0019] Figure 5 Transcriptional activity assay of full-length, N-terminal and C-terminal GmMYC3 in yeast. pGBKT7(BD) vector was used as control. -Trp, nutrient-deficient medium lacking tryptophan; -Trp / -His / -Ade, nutrient-deficient medium lacking tryptophan, histidine and adenine.

[0020] Figure 6 PCR and qRT-PCR detection of GmMYC3 transgenic soybean. (A) Overexpression of 35S:GmMYC3 KFNo.1 PCR detection of soybean. The target fragment size in the resistant parent soybean KF No.1 is 1135bp. M: Marker DL2000 Plus; P1: positive plasmid pBA002-GmMYC3 KFNo.1 ; CK: wild type WT; 1-6: different 35S:GmMYC3 KFNo.1 Transgenic plants. (B) Overexpression of 35S:GmMYC3 NN1138-2 PCR detection of soybean. The target fragment size in the resistant parent soybean NN 1138-2 is 1129 bp. M: Marker DL2000 Plus; P2: positive plasmid pBA002-CmMYC3 NN1138-2 ; CK: wild type WT; 1-6: different 35S:GmMYC3 NN1138-2Transgenic plants. (C) Relative expression levels of GmMYC3 in wild-type WT and GmMYC3-overexpressing soybean (n=3). Two-tailed t test: **, P<0.01; ***, P<0.001. Error bars represent ±SE. (D) Sequences of wild-type WT and two types of GmMYC3 homozygous mutants KO1 and KO2. The targeting sites target1, target2, and target3 are highlighted in green, yellow, and blue, respectively. PAM, protospacer adjacent motif; underline: insertion; dash: deletion.

[0021] Figure 7 GmMYC3 positively regulates soybean resistance to Spodoptera litura. (A) Wild type WT, overexpression of 35S:GmMYC3 KF No.1 、35S:CmMYC3 NN 1138-2 The size of larvae of the knockout and knockout soybean lines after feeding with Spodoptera litura for 2 days. Scale bar = 1 cm. (B) The average larval weight of Spodoptera litura after feeding with Spodoptera litura for 2 days. OE4 and OE28 represent two lines overexpressing 35S:GmMYC3 KF No.1 strains, OE17, OE25, OE27, OE37, and OE38 represent five strains overexpressing 35S:CmMYC3 NN 1138-2 Lines, KO1 and KO2 represent two knockout mutants. The n of WT, OE4, OE28, OE17, OE25, OE27, OE37, OE38, KO1 and KO2 soybeans are 33, 30, 33, 30, 33, 27, 33, 29, 20 and 15, respectively. Two-tailed t test: *, P < 0.05; ***, P < 0.001. Error bars represent ± SE.

[0022] Figure 8 GmMYC3 overexpression soybean is resistant to fall armyworm. (A) Wild type WT and overexpression 35S:GmMYC3 KF No.1 The size of larvae of Spodoptera frugiperda fed with OE28 soybean for 4 days. Scale bar = 1 cm. (B) Average larval weight of Spodoptera frugiperda fed for 2 and 4 days (n = 50). Two-tailed t test: ***, P < 0.001; ns, not significant. Error bars represent ± SE.

[0023] Fig. 9 Quantitative analysis of trypsin inhibitor content in transgenic soybean leaves (n=3). Two-tailed t test: *, P<0.05; ns, not significant. Error bars represent ±SE.

[0024] Fig.10Development of GmMYC3 KASP marker. (A) Genotyping of 50 soybean materials with KASP marker. The green origin near the Y-axis and the orange origin near the X-axis represent soybean materials carrying the T allele variant site and the C allele variant site, respectively, and the black dots near the origin represent the blank control (NTC) without template DNA. (B) The number of soybean materials carrying the T and C allele variant sites. (C) The weight of larvae of Spodoptera litura fed on 50 soybean materials for 7 days was evaluated to verify the effectiveness of the KASP marker. Error bars represent ±SE. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0026] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0027] Example 1 Cloning, expression pattern, protein sublocalization and transcriptional activation activity analysis of soybean MYC2-like transcription factor GmMYC3 gene

[0028] 1) Cloning of soybean GmMYC3 gene

[0029] The resistant parent soybean KF No.1 and the susceptible parent soybean NN 1138-2 of the soybean recombinant inbred line population were used as the sample. The leaves were taken and ground with a mortar. The leaves were added into a 1.5 mL EP tube containing lysis solution. After sufficient shaking, the total RNA was extracted using an RNA extraction kit (Shanghai Pudi). The quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by a spectrophotometer. The obtained total RNA was used as a template and the reverse transcription kit (TaKaRa PrimerScript TM RT reagent kit, Japan) was used for reverse transcription to obtain the first-chain cDNA, followed by PCR amplification. The PCR program was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 90 s, for a total of 35 cycles, and finally incubation at 72°C for 5 min, followed by constant temperature at 12°C to obtain cDNA of KF No.1 and NN 1138-2.

[0030] Specific primers were designed using the coding sequence of GmMYC3 (Glyma.07G051500) in the soybean database Phytozome v13 as a template. The gene was amplified from the cDNA of soybean parents KF No.1 and NN 1138-2 by PCR reaction, and the PCR product was connected with the T vector to construct T-GmMYC3. KF No.1 and T-GmMYC3 NN 1138-2The recombinant vector was sequenced to obtain the complete CDS sequence of the soybean GmMYC3 gene. The target fragment size in KF No.1 was 1401 bp, and the target fragment size in NN 1138-2 was 1395 bp ( Figure 1 ). The coding sequences of GmMYC3 genes in KF No.1 and NN 1138-2 are shown in SEQ ID NO.1 and SEQ ID NO.2, and the corresponding amino acid sequences are shown in SEQ ID NO.4 and SEQ ID NO.5. The specific primer sequences required for the PCR reaction are F: atggaggatttaatcatatctcc and R: tcactgatccaacctcatcag.

[0031] 2) Tissue expression analysis of GmMYC3

[0032] The resistant parent soybean KF No.1 was used for tissue expression analysis of GmMYC3. Leaves, stems and roots were sampled at the V3 stage, flowers were sampled at the peak flowering stage, and pods and seeds were sampled 15 days after flowering. Total RNA was extracted from all samples. The extraction of total RNA was the same as 1), reverse transcribed into cDNA, and the expression level of GmMYC3 gene in different soybean tissues was determined by fluorescence quantitative PCR reaction (Real-time RT-PCR). The GmMYC3 fluorescence quantitative primer sequences were F: tggtctcgaggtcgatgtgaa and R: gacatgctagcgtgatgaacc. The soybean Tubulin gene was used as an internal reference, and the primer sequences were F: ggagttcacagaggcagag and R: cacttacgca tcacatagca.

[0033] GmMYC3 is highly expressed in leaves, flowers, and pods, whereas it is expressed at lower levels in seeds, roots, and stems ( Figure 2 ).

[0034] 3) Expression analysis of GmMYC3 under the induction of Spodoptera litura stress

[0035] Two soybean parents, KF No.1 and NN 1138-2, from the V3 stage were used for Spodoptera litura induction. Spodoptera litura induction was simulated by wounding the leaves and immediately applying oral secretions (OS) of Spodoptera litura larvae to the wounded surface (W+OS). Total RNA was extracted from the leaves of treated plants and control plants that were not induced at the same time points at 0.5, 4 and 8 h after W+OS treatment. The extraction of total RNA was the same as 1). The total RNA from the leaves of the above-mentioned induced group and control group was used as a template, reverse transcribed into cDNA, and Real-time RT-PCR was performed. The sequences of the GmMYC3 fluorescence quantitative primers and the primer sequences of the internal reference gene Tubulin were the same as 2).

[0036] GmMYC3 can respond quickly to feeding induction by Spodoptera litura, and the up-regulation fold in the resistant parent soybean KF No.1 is much greater than that in the susceptible parent soybean NN 1138-2 ( Figure 3 ).

[0037] 4) Subcellular localization of soybean GmMYC3 protein

[0038] Design specific primers and perform PCR reaction from T-GmMYC3 KFNo.1 The coding sequence of GmMYC3 without a stop codon was amplified on the vector and fused to the N-terminus of green fluorescent protein (GFP) in the pAN580 vector. The vector has a 35S promoter, which can strongly induce the expression of the target gene GmMYC3 in the receptor. The fusion construct 35S:GmMYC3-GFP and the empty control 35S:GFP were transformed into Arabidopsis protoplasts for transient expression, and the GFP signal was observed using a laser confocal microscope. The primer sequences for constructing the vector are F:atggaggatttaatcatatctcc and R:ctgatccaacctcatcaga.

[0039] GFP signal showed that GmMYC3 was localized in the nucleus, while the fluorescent signal of the empty control was distributed throughout the cell ( Figure 4 ), indicating that GmMYC3 is a nuclear-localized transcription factor.

[0040] 5) Analysis of soybean GmMYC3 transcriptional activation activity

[0041] Matchmarker GAL4 Two-Hybrid System 3 (Clontech, USA) was used to analyze the transcriptional activity of GmMYC3. Specific primers were designed and PCR reaction was performed to obtain the transcriptional activity of GmMYC3 from T-GmMYC3. KFNo.1The full-length coding sequence, N-terminal sequence and C-terminal sequence of GmMYC3 were amplified on the vector and fused with the GAL4 DNA BD in the pGBKT7 (BD) vector. The primer sequences for constructing the vector were F-full length: atggaggatttaatcatatctcc and R-full length: tcactgatccaacctcatcag, FN-terminal: atggaggatttaatcatatctcc and RN-terminal: cggagtctcgcgtccgagaat, FC-terminal: ataacccctccagatccggtt and RC-terminal: tcactgatccaacctcatcag. The construct and the empty control BD were transformed into the yeast strain Y2HGold for plate selection, and the plates were one-deficient medium lacking tryptophan (-Trp) and three-deficient medium lacking tryptophan, histidine and adenine (-Trp / -His / -Ade).

[0042] Compared with BD used as a negative control, GmMYC3 showed transcriptional activation activity in yeast, and its transcriptional activation domain was located at the N-terminus ( Figure 5 ).

[0043] Example 2 Genetic Engineering Application of Soybean MYC2-like Transcription Factor Gene GmMYC3

[0044] 1) Construction of plant expression vector of soybean GmMYC3 gene

[0045] When constructing a gene overexpression vector, specific primers were designed and PCR reactions were performed to express the gene from T-GmMYC3 KF No.1 and T-GmMYC3 NN1138-2 The coding sequence of GmMYC3 containing the complete ORF was amplified from the vector and inserted into the pBA002 vector under the drive of the 35S promoter to obtain the recombinant vector pBA002-GmMYC3. KFNo.1 and pBA002-CmMYC3 NN1138-2. The specific primer sequences required for the PCR reaction are the same as those in step 1 of Example 1). For CRISPR / Cas9 gene editing, specific primers for three target sites were designed for GmMYC3 using CRISPR-P software. The three targets were respectively integrated into three sgDNA expression cassettes and finally connected to the pGmUbi-Cas9-4XsgR vector (Zhang et al., Plant Biotechnology Journal, 2019, 217: 1-12). The three pairs of target site primers were F1: ggctctcatgaacttctttg and R1: caaagaagttcatgagagcc, F2: accaaagaggaagacgaaga and R2: tcttcgtcttcctctttggt, F3: acatgaacttctttgtgggaa and R3: ttcccacaaagaagttcatgt. All constructs used for soybean transformation were introduced into Agrobacterium tumefaciens strain EHA105.

[0046] 2) Overexpression of GmMYC3 and creation of gene-edited soybean

[0047] The soybean cultivar GP03-8-23 was transformed using the cotyledon node transformation method. The soybean leaf axils that had grown for 5-6 days were wounded, and the GmMYC3 overexpression and gene editing vectors obtained in step 1) were inoculated into the wounds of the soybean leaf axils, and placed at 25°C for co-cultivation for 4-5 days. Then they were washed with sterilized ultrapure water and Wish-Liquid, respectively, placed in a SIM medium without glufosinate, and cultured at 26°C for 15 days to induce budding. After 15 days, it was replaced with a SIM medium with 6 mg / L glufosinate added. Then, subculture was performed in a cycle of 15 days, and the dose of glufosinate was gradually reduced. When the buds of the explants grew to about 6 cm, they were transferred to a rooting medium and continued to be cultured for about 10 days to induce roots. When the root system is well grown, it can be transplanted.

[0048] First, the extracted soybean DNA was tested by PCR using specific primers to determine whether it was positively transformed soybean. The overexpression soybean detection primer sequences were F:gctcctacaaatgccatcattgc and R:tcggttttctccctcttttcttc. See the PCR detection gel image for details. Figure 6 AB. Real-time RT-PCR results showed that GmMYC3 was expressed in soybean 35S:GmMYC3 overexpressing plants compared with wild type WT. KF No.1 and 35S:CmMYC3 NN 1138-2 The expression levels in Figure 6C). The sequences of fluorescent quantitative primers for GmMYC3 and soybean internal reference gene Tubulin are the same as those in step 2 of Example 1). For gene-edited soybean, specific primers were designed to perform PCR amplification near the target site, and the gel-recovered products were sequenced and analyzed. The sequences of primers for gene-edited soybean detection are F: atcttaatccggaacccacc and R: acttaacgtgctgtacgaggtt. The PCR sequencing results are shown in Figure 6 D.

[0049] 3) GmMYC3 gene positively regulates soybean resistance to Spodoptera litura

[0050] Indoor insect assays were conducted in an air-conditioned room at 26°C and 30% relative humidity with a photoperiod of 12 h light / 12 h dark. 250 mL tissue culture jars were used to feed 3rd instar Spodoptera litura larvae of uniform size. Wild-type WT, overexpressing 35S:GmMYC3 KF No.1 、35S:CmMYC3 NN 1138-2 The leaves of the knockout and KO transgenic soybean lines were fed to Spodoptera litura. Four larvae were placed in each culture tank, with no less than 15 replicates. Fresh leaves were replaced every two days, and the larvae were weighed on the second day of feeding. The average larval weight of each tank was calculated, and the average larval weight of Spodoptera litura was used as the resistance identification index. Compared with the wild type WT, 35S:GmMYC3 KF No.1 and 35S:GmMYC3 NN 1138-2 Overexpression of soybean significantly reduced the larval weight of Spodoptera litura, while knockout KO transgenic soybean promoted larval growth ( Figure 7 ). The results showed that GmMYC3 positively regulates soybean resistance to Spodoptera litura and that GmMYC3 KF No.1 and GmMYC3 NN 1138-2 The CDS may have similar resistance functions.

[0051] 4) Overexpression of GmMYC3 improves soybean resistance to Spodoptera frugiperda

[0052] Except for Spodoptera litura, 35S:GmMYC3 KFNo.1 OE28 overexpressing soybeans were also tested for resistance to fall armyworm indoors. Considering the cannibalistic behavior of fall armyworm, single second-instar larvae were raised individually in 30 mL transparent plastic containers under the same rearing conditions as Spodoptera litura. Larval weights were measured on days 2 and 4 after feeding, with 50 replicates. Compared with wild-type WT, 35S:GmMYC3 KFNo.1 Overexpression of OE28 in soybean significantly reduced the larval weight of Spodoptera frugiperda ( Figure 8 ), indicating that GmMYC3 may confer broad-spectrum resistance to leaf-feeding pests.

[0053] 5) GmMYC3 overexpression promotes the synthesis of trypsin inhibitor

[0054] The content of trypsin inhibitor, a defense substance, in the leaves of transgenic soybean was detected by ELISA kit (Nanjing Maibo). KFNo.1 and 35S:GmMYC3 NN1138-2 The trypsin inhibitor content in overexpressed soybeans was significantly increased, but the trypsin inhibitor content in knockout soybeans was similar to that in WT ( Fig. 9 ). These results suggest that GmMYC3 improves soybean resistance to Spodoptera litura and Fall Armyworm by promoting the synthesis of trypsin inhibitors.

[0055] Example 3 Development and application of KASP markers for soybean MYC2-like transcription factor GmMYC3 gene

[0056] The resistant and susceptible parent soybeans of the recombinant inbred line population underwent a C to T substitution (Seq ID NO.3) in the GmMYC3 promoter region at position 4451695bp on chromosome 7 of the soybean Glycine max Wm82.a2.v1 genome (https: / / phytozome-next.jgi.doe.gov). The genotype of the resistant parent KF No.1 was CC, and the genotype of the susceptible parent NN 1138-2 was TT. To target this genetic variation, three pairs of primers were designed using Polymarker (http: / / polymarker.tgac.ac.uk), including upstream primer F1: gaaggtgaccaagttcatgctGCACGAACCACTATTATCTTTTTAATCTTC, upstream primer F2: gaaggtcggagtcaacggattGCACGAACCACTATTATCTTTTTAATCTTT and downstream primer R: ACCAGACAGGATCAAAGATACTTT, where F1 and F2 contained FAM and HEX fluorescent linker sequences (lowercase letters), respectively.

[0057] The genomic DNA of 50 soybean materials to be tested was extracted (Table 1). The genomic DNA was used as a template and KASP-labeled special primers were used to perform PCR amplification in an ABI9700 real-time fluorescence quantitative PCR instrument. The experimental setting was a 5.07 μL reaction system (2.5 μL template [5-50 ng DNA], 2.5 μL V4.02×Kaspar mix [LGC Group] and 0.07 μL primer mixture [12 μM each allele-specific primer and 30 μM common primer]); the PCR cycle included 94°C activation for 15 min; 94°C denaturation for 20 sec, 61-55°C annealing for 1 min (0.6°C was reduced for each cycle, 10 cycles); 94°C denaturation for 20 sec, 55°C annealing for 1 min, 26 cycles. After the PCR was completed, the instrument performed genotyping on the 50 soybean materials to be tested according to the fluorescence signal. Fig.10 AC shows that the KASP primer can effectively separate the two genotypes, where the dots close to the Y axis are T allele mutation sites, genotype TT, 23 copies, and the average weight of the Spodoptera litura larvae fed by them is 305.23g; the dots close to the X axis are C allele mutation sites, genotype CC, 27 copies, and the average weight of the Spodoptera litura larvae fed by them is 187g; the dots close to the origin of the XY axis are blank controls. Consistent with the results of the resistant and susceptible parent soybeans, the insect resistance of the tested soybeans with CC genotype is significantly higher than that of the tested soybeans with TT genotype.

[0058] Table 1 Names and numbers of soybean materials used for KASP genotyping

[0059]

[0060] Note: The above 50 soybean materials appear in publicly published literature (Liu, H., Che, Z., Zeng, X. et al. (2016). Identification of single nucleotide polymorphisms in soybean associated with resistance to common cutworm (Spodoptera litura Fabricius). Euphytica, 209: 49-62).

Claims

1. Application of soybean MYC2-like transcription factor gene GmMYC3 in genetically engineered soybean resistance to leaf-feeding pests. The coding region sequences of the soybean MYC2-like transcription factor gene GmMYC3 in the resistant parent soybean KF No.1 and the susceptible parent soybean NN 1138-2 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. The use according to claim 1, characterized in that the leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.

3. The use according to claim 1, Features Overexpression of the GmMYC3 gene can significantly improve soybean resistance to Spodoptera litura and Spodoptera frugiperda. Conversely, knocking out the GmMYC3 gene can weaken soybean's insect resistance.

4. Use of an expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 described in claim 1 in improving soybean resistance to leaf-feeding pests.

5. The use according to claim 4, characterized in that the leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.

6. Application of the KASP marker developed for the genetic variation of the GmMYC3 gene promoter according to claim 1 in soybean insect-resistant breeding, wherein the KASP molecular marker primer sequences are: upstream primer F1 is SEQ ID NO.6, upstream primer F2 is SEQ ID NO.7 and downstream primer R is SEQ ID NO.

8.

7. The use according to claim 6, Features The GmMYC3 promoter region located at position 4451695bp on chromosome 7 in the soybean genome Glycine max Wm82.a2.v1 underwent a C to T substitution between the resistant and susceptible parental soybeans. This genetic variation is closely linked to soybean insect resistance, and the insect resistance of the tested soybeans with the CC genotype is higher than that of the tested soybeans with the TT genotype.

Images