Cotton verticillium wilt resistant gene and screening method thereof

Abstract

The cotton verticillium wilt resistant gene comprises GhPR6-5b, the nucleotide sequence table of the GhPR6-5b is shown in a sequence table 1, the cotton verticillium wilt resistant gene further comprises GhWRKY75, and the nucleotide sequence table of the GhWRKY75 is shown in a sequence table 2. According to the invention, the cotton verticillium wilt resistance gene GhPR6-5b is screened and cloned through family analysis and transcriptome data analysis for the first time, and the upstream disease-resistant transcription factor GhWRKY75 of the GhPR6-5b is screened through a yeast one-hybrid technology.

Description

Technical Field

[0001] The invention relates to the technical field of cotton resistance to Verticillium wilt, and in particular to a cotton resistance to Verticillium wilt gene and a screening method thereof. Background Art

[0002] Cotton is not only the main raw material of the textile industry, but also an important source of vegetable oil and vegetable protein. It is a dual-purpose crop for food, cotton and oil. It plays a pivotal role in promoting the development of the national economy and is also an important economic crop in the world. Cotton fiber is a natural fiber. Compared with chemical fiber, it has excellent characteristics such as good moisture absorption and breathability, close to the human body, and green and degradable. Compared with wool and silk, cotton fiber is cheap, so cotton fiber is friendly, environmentally friendly, and cost-effective. With the increasing improvement of the living standards of the Chinese people, the demand for high-quality cotton textiles is also increasing. my country is the world's largest cotton textile country, accounting for 40% of the world's total cotton textile use, and exported textile clothing accounts for 1 / 4 of the global market. Therefore, cotton production plays a pivotal role in my country.

[0003] Cotton is threatened by many diseases during its planting and production, the most important of which is Verticillium wilt. Before infecting cotton, Verticillium wilt exists in the form of hyphae, spores or microsclerotia in the soil or on the diseased remains of plants. Under suitable temperature and humidity conditions, microspores or spores germinate to form germ tubes or hyphae. After the hyphae invade through the root tip, they grow toward the top cells and enter the duct. The spores reproduce in the duct and produce a large number of hyphae. After the hyphae germinate, a large number of spores are produced, and they move toward the top with the transpiration of the host plant, constantly invading the stems and leaves of the plant and other tissues, and eventually causing the plant to show symptoms such as wilting, chlorosis, yellowing, and tissue necrosis. During the entire infection process of Verticillium wilt, the pathogen is in the vascular system of the host plant for most of the time, so it is difficult to prevent and control, and the destructive power is great. Verticillium wilt is also called "cotton cancer". The cotton grown worldwide is mainly upland cotton, accounting for more than 90% of the global cotton planting area. However, upland cotton generally lacks immunity or high resistance to Verticillium wilt, so it has always been a difficult problem for breeders to discover Verticillium wilt resistance genes, analyze the molecular mechanism of cotton resistance to Verticillium wilt, and cultivate high-yield and high-quality Verticillium wilt-resistant varieties. This is the shortcoming of the existing technology. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a cotton Verticillium wilt resistance gene and a screening method thereof in view of the deficiencies in the prior art. The present invention screens and clones the cotton Verticillium wilt resistance gene GhPR6-5b through gene family analysis and transcriptome data analysis, screens the upstream disease resistance transcription factor GhWRKY75 of GhPR6-5b through yeast single hybridization technology, and verifies that GhWRKY75 and GhPR6-5b are positively involved in cotton Verticillium wilt resistance through virus-mediated gene silencing technology.

[0005] This scheme is achieved through the following technical measures: a cotton wilt resistance gene, the cotton wilt resistance gene includes GhPR6-5b, the nucleotide sequence table of GhPR6-5b is shown in Sequence Table 1, and the coding protein sequence of GhPR6-5b is shown in Sequence Table 3.

[0006]

[0007] Sequence Listing 1

[0008]

[0009] Sequence Listing 3

[0010] Preferably, the cotton Verticillium wilt resistance gene further comprises GhWRKY75, the nucleotide sequence of GhWRKY75 is shown in Sequence Table 2, and the protein encoding sequence of GhWRKY75 is shown in Sequence Table 4.

[0011]

[0012] Sequence Listing 2

[0013]

[0014] Sequence Listing 4

[0015] A method for screening cotton Verticillium wilt resistance genes comprises the following steps:

[0016] a. Based on the whole gene family analysis, PR6 gene family members were discovered in tetraploid upland cotton, sea island cotton, diploid Raymond cotton and Asiatic cotton. The target gene GhPR6-5b was obtained by using the transcriptome sequencing data analysis induced by Verticillium wilt and the transcriptome data analysis of lesion-like mutants;

[0017] b. Virus-induced gene silencing was used to silence the GhPR6-5b gene in TM-1 and H7124, respectively, to verify that the GhPR6-5b gene is positively involved in cotton Verticillium wilt resistance;

[0018] c. Clone the GhPR6-5b promoter and obtain the WRKY transcription factor GhWRKY75 using yeast one-hybrid technology;

[0019] d. GhWRKY75 binds to Wbox: TTGAC (T / C) and positively regulates GhPR6-5b gene expression.

[0020] Preferably, through the analysis of the transcriptome data of the lesion-like mutant, GhWRKY75 was significantly expressed in the lesion-like mutant, which indirectly confirmed that GhWRKY75 regulates GhPR6-5b and is involved in cotton Verticillium wilt resistance.

[0021] Preferably, the virus-induced gene silencing technology is used to silence the gene in TM-1 and H7124, respectively, to verify that the GhWRKY75 gene is positively involved in cotton Verticillium wilt resistance.

[0022] Compared with the prior art, the present invention has the following beneficial effects: the present invention screened and cloned the cotton Verticillium wilt resistance gene GhPR6-5b for the first time through family analysis and transcriptome data analysis, and screened the upstream disease resistance transcription factor GhWRKY75 of GhPR6-5b through yeast single hybridization technology. Through virus-mediated gene silencing technology, it was verified that GhWRKY75 and GhPR6-5b are positively involved in cotton Verticillium wilt resistance. The GhWRKY75 and GhPR6-5b genes described in the present invention can be widely used in breeding new varieties of crops resistant to Verticillium wilt.

[0023] It can be seen that compared with the prior art, the present invention has substantial characteristics and progress, and the beneficial effects of its implementation are also obvious. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solution of the present invention, the accompanying drawings required for use in the description will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0025] Figure 1 Analysis of the PR6 gene family.

[0026] A: Analysis of gene family members, evolutionary analysis, gene structure analysis, and mot if analysis. Identification and evolutionary analysis of PR6 gene family members in upland cotton (quadruploid susceptible varieties, AADD, 10), sea island cotton (quadruploid resistant varieties, AADD, 14), Raymond cotton (diploid, DD, 9), and Asian cotton (diploid, AA, 6). Using amino acid sequences as evolutionary trees and the NJ model, the PR6 gene family can be divided into four subfamilies. Gene structure analysis found that the PR6 gene has the most 3 exons and 2 introns, and the least has only 1 exon and no introns. Mot if analysis found that in each family, almost all PR6s have the same or similar motifs. Mot if1 exists in all PR6 family members. In subfamily I, most members have motifs 4, 1, and 2. In subfamily II, the motifs are 3, 1, and 2, respectively. Motif 6 only exists in subfamily III. In subfamily IV, all members have motifs 4, 3, 5, 1, and 2. These findings suggest that the motif composition of each group in the PR6 gene family is relatively conserved. The presence of conserved domains and exon-intron organization is consistent with the classification.

[0027] B: Mot if of PR6 gene family.

[0028] Figure 2 Transcriptome sequencing data analysis was used to screen the Verticillium wilt resistance gene GhPR6-5b.

[0029] A: To better understand the gene function of GhPR6, tissue-specific expression of 10 GhPR6 genes was examined in RNA-seq data of TM-1 and H7124, and FPKM values ​​were used to evaluate gene expression levels. GhPR6-1, -2, -3, -5c, -6, and -7 showed very low expression levels in all tissues examined in TM-1 and H7124. GhPR6-5b showed the highest expression in leaves, styles, anthers, and filaments compared to other PR6 family numbers. B: To further determine whether GhPR6 levels were associated with Verticillium wilt virus infection, RNA-seq data of GhPR6 genes in roots of Verticillium wilt-inoculated cotton in TM-1 and H7124 were investigated. In H7124, GhPR6-5a, GhPR6-5b, and GhPR6-8 showed high expression levels at the dahlia treatment time points. But almost only the gene of GhPR6-5b showed a significant increase in expression at each period compared to the control. The same results were obtained in TM-1. C: Gh lmm is a lesion mimicking mutant with elevated salicylic acid levels, constitutive expression of pathogenesis-related genes, and enhanced resistance to Verticillium dahliae infection. Although the expression levels of GhPR6-5b and GhPR6-8 were increased in the leaves of the Gh lmm mutant compared with the wild-type recipient W0, the FPKM of GhPR6-5b (439) was higher than that of GhPR6-8 (84). Therefore, we believe that GhPR6-5b plays an important role in disease resistance of the GhPR6 gene family. Therefore, we chose GhPR6-5b as the object of further study.

[0030] Figure 3 GhPR6-5b is positively involved in cotton resistance to Verticillium wilt.

[0031] A: To further evaluate the resistance of GhPR6-5b to Verticillium wilt, VIGS validation was performed in the resistant cotton variety H7124 and the susceptible cotton variety TM-1. We constructed TRV:GhPR6-5b and TRV:00 as a control. Each experimental group included at least 12 individual cotton seedlings and was repeated three times. About two weeks after injection, when TRV:CLA1 cotton individuals showed an albino phenotype, silencing of GhPR6-5b was confirmed by qPCR. We inoculated cotton with Verticillium wilt V991. 15 days after inoculation, H7124 plants with GhPR6-5b gene silenced showed obvious Verticillium wilt phenotype, but no obvious disease symptoms appeared in the leaves of the control TRV:00 seedlings. B: Split pole experiment, after silencing GhPR6-5b, Verticillium wilt accumulated in the stem segments of H7124, and obvious black spots appeared.

[0032] C: Verticillium wilt disease level survey after inoculation. 20 days after inoculation, most of the H7124 seedlings with GhPR6-5b gene silencing had died, with a disease index of 82.7%. However, the control TRV:00H7124 seedlings had fewer wilted and yellowed leaves, with a disease index of only 47.4%.

[0033] D: Gene expression analysis shows that the GhPR6-5b gene has been silenced, and the silencing effect is obvious.

[0034] Figure 4 GhWRKY75 regulates GhPR6-5b gene expression by binding to Wbox:TTGAC(T / C).

[0035] A: In order to study the transcriptional regulation mechanism of GhPR6-5b gene, 1550bp of GhPR6-5b promoter region was cloned into yeast vector pAbAi to construct bait vector. Cotton root cDNA library was screened. A WRKY transcription factor GHA10G0720 was screened. The binding of GhPR6-5b promoter was verified using the full length of GHA10G0720 in Y1 H reporter strain. GHA10G0720 is a homolog of AtWRKY75 (AT5G13080), so we named it GhWRKY75.

[0036] B: There are several W-boxes in the promoter region of GhPR6-5b: 3 TTGACT, 1 TTGACC, and 1 CTGACT. C: In vitro EMSA analysis. To clarify whether GhWRKY75 directly targets W-box, in vitro EMSA analysis was performed to verify the binding ability of GhWRKY75 to W-box. Four types of W-box labeled with biotin were used as probes for EMSA. The results showed that GhWRKY75 can directly and specifically bind to W-box: TTGAC(T / C), but cannot bind to CTGAC(T / C)

[0037] D: GUS staining experiment. To test whether the GhWRKY75 transcription factor can regulate the expression of GhPR6-5b, transient expression assays of the GUS reporter system were performed using tobacco leaves. The stop codon containing GhWRKY75 was constructed into the pBI 121 vector that does not express the GUS gene. The 35S promoter in the pBI 121 vector was replaced by the -1550bp promoter sequence of GhPR6-5b to drive GUS gene expression. The pGhPR6-5b:GUS vector was co-transformed into tobacco leaves alone or together with the GhWRKY75 expression vector. 35S:GUS served as a positive control, and GhWRKY75 served alone as a negative control. GUS expression in the co-transfectants of the GhWRKY75 expression vector and the pGhPR6-5b:GUS vector was significantly higher than that in the single pGhPR6-5b:GUS vector transfectants. These results indicate that GhWRKY75 can bind to the promoter sequence of GhPR6-5b and positively regulate gene expression.

[0038] E: Verification of GUS expression.

[0039] Figure 5 Functional analysis of GhWRKY75 gene.

[0040] A: Expression of GhWRKY75 in roots, stems and leaves of W0 and Gh lmm.

[0041] B: We used leaf RNA-seq data to further elucidate the expression of WRKY family genes. As a result, 50 WRKY transcription factors were significantly increased in Gh lmm compared with W0. The FPKM values ​​of 24 WRKY transcription factors were all above 10. The four genes with the largest multi-gene expression differences were homologous genes of AtWRKY75 (AT5G13080). They are GH_D02G1607 (99.0×), GH_A03G1347 (43.1×), GH_A10G0720 (30.5×), GH A01G1658 (25.9×) ( Figure 5 b) Therefore, we considered a close relationship between GhPR6-5b and GhWRKY75. This is consistent with our previous results and convinced us that GhWRKY75 plays an important role in disease resistance.

[0042] C: Tissue-specific expression of GhWRKY75 in TM-1. GhWRKY75 was expressed at high levels in roots, stems, leaves, awns, anthers, filaments and day-0 ovules, but it was not expressed in cotton fibers.

[0043] D: RNA-seq data showed that GhWRKY75 was upregulated after Verticillium wilt virus infection.

[0044] E: Subcellular localization of GhWRKY75, located in the cell.

[0045] Figure 6 GhWRKY75 is positively involved in cotton Verticillium wilt resistance.

[0046] A: To further evaluate the response function of GhWRKY75 to Verticillium dahliae infection, VIGS verification was carried out in H7124 and TM-1. We constructed TRV:GhWRKY75, with TRV:00 as the control. Each experimental group included at least 13 individual cotton seedlings and was repeated three times. When the albino phenotype was shown by TRV:CLA1, the silencing of GhPR6-5b was confirmed by qPCR. We inoculated cotton with Verticillium dahliae V991. 21 days after inoculation, the H7124 plants with silenced GhWRKY75 gene showed obvious Verticillium wilt phenotypes, but no obvious disease symptoms appeared in the leaves of the control TRV:00 seedlings.

[0047] B: Split-stem experiment. After silencing GhPR6-5b, Verticillium wilt accumulated in the H7124 stem segments, showing obvious black spots.

[0048] C: Investigation of Verticillium wilt disease grade after inoculation. 30 days after inoculation, the disease index of the H7124 seedlings with silenced GhWRKY75 gene was 36.2%, while that of the control TRV:00 H7124 seedlings was only 7.8%. Silencing GhWRKY75 increased the sensitivity of TM-1 seedlings to Verticillium wilt, and the leaf wilting phenotype appeared 2 days earlier. 20 days after inoculation, the disease indexes of TRV:GhWRKY75 and TRV:00 were 68.9% and 80.6% respectively (Figure 6a and c).

[0049] D: Gene expression analysis showed that the GhWRKY75 gene had been silenced with obvious silencing effect. Detailed implementation manner

[0050] In order to make the invention objectives, features, and advantages of the present invention more obvious and understandable, the following will use specific examples and drawings to clearly and completely describe the technical solutions protected by the present invention. Obviously, the following described examples are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments in this patent, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of this patent.

[0051] A cotton Verticillium wilt-resistant gene, the cotton Verticillium wilt-resistant gene includes GhPR6-5b, the nucleotide sequence list of GhPR6-5b is as shown in Sequence Listing 1, and the encoded protein sequence of GhPR6-5b is as shown in Sequence Listing 3.

[0052]

[0053] Sequence Listing 1

[0054]

[0055] Sequence Listing 3

[0056] Preferably, the cotton Verticillium wilt resistance gene further comprises GhWRKY75, the nucleotide sequence of GhWRKY75 is shown in Sequence Table 2, and the protein encoding sequence of GhWRKY75 is shown in Sequence Table 4.

[0057]

[0058] Sequence Listing 2

[0059]

[0060] Sequence Listing 4

[0061] A method for screening cotton Verticillium wilt resistance genes comprises the following steps:

[0062] a. Based on the analysis of the whole gene family, we explored the PR6 gene family members in tetraploid upland cotton, sea island cotton, diploid Raymond cotton and Asiatic cotton (such as Figure 1 As shown), the target gene GhPR6-5b (as shown) was obtained by using the transcriptome sequencing data analysis of Verticillium wilt-induced transcriptome and the transcriptome data analysis of the lesion-like mutant. Figure 2 shown);

[0063] b. Virus-induced gene silencing was used to silence the GhPR6-5b gene in TM-1 and H7124, respectively, to verify that the GhPR6-5b gene is positively involved in cotton Verticillium wilt resistance (e.g. Figure 3 shown);

[0064] c. Clone the GhPR6-5b promoter and obtain the WRKY transcription factor GhWRKY75 (eg Figure 4 A);

[0065] d. GhWRKY75 binds to Wbox: TTGAC (T / C) and positively regulates GhPR6-5b gene expression (e.g. Figure 4 BE).

[0066] Preferably, through the analysis of the transcriptome data of the lesion-like mutant, GhWRKY75 is significantly expressed in the lesion-like mutant, which indirectly confirms that GhWRKY75 regulates GhPR6-5b and is involved in cotton Verticillium wilt resistance (such as Figure 5 shown).

[0067] Preferably, the virus-induced gene silencing technique is used to silence the GhWRKY75 gene in TM-1 and H7124, respectively, to verify that the GhWRKY75 gene is positively involved in cotton Verticillium wilt resistance (eg Figure 6 shown).

[0068] Analysis of GhPR6 gene family and screening of GhPR6-5b

[0069] 1. Gene family member identification and sequence retrieval

[0070] The HMM file (PF00280) of the conserved domain of the GhPR6 gene family was downloaded from the Pfam website and retrieved from upland cotton, sea island cotton, raimondii cotton, and Asiatic cotton using the HMMER software. The retrieved sequences were verified in SMART and NCBI-CDD. The protein sequences were submitted to the online program CELLO to predict and calculate the amino acid length, isoelectric point, theoretical molecular weight, and subcellular localization of the GhPR6 family (e.g. Figure 1 shown).

[0071] 2. Evolutionary analysis of the GhPR6 gene family

[0072] Multiple sequence alignment of PR6 from upland cotton, sea island cotton, raimondii cotton, and Asiatic cotton was performed using the default parameters of the ClustalW program. The phylogenetic tree (e.g. Figure 1 A).

[0073] 3. Gene structure and motif analysis

[0074] Gene structure analysis The exon and intron structures of the PR6 gene were mapped using the online program GSDS, and the conserved motifs of PR6 were identified using the MEME website (e.g. Figure 1 A).

[0075] 4. Screening of GhPR6-5b through transcriptome data analysis

[0076] Using TM-1 and H7124 tissue expression RNAseq data and Verticillium wilt induction data, the tissue expression of GhPR6 gene family genes in upland cotton was analyzed (e.g. Figure 1 A) and Verticillium wilt induction (as shown in Figure 1 B); Gh lmm mutant is a lesion-like mutant caused by mutation during transgenic process, its receptor is W0, its SA content is extremely high, and it has similar Verticillium wilt resistance as the disease-resistant variety H7124. GhPR6-5b was screened out by analyzing the expression data of GhPR6 family in root, stem and leaf tissues of Gh lmm mutant and its receptor W0.

[0077] Virus-mediated silencing of the GhPR6-5b gene

[0078] 1. Preparation of competent cells of GV3101 Agrobacterium. (1) Streak the GV3101 strain stored in glycerol on an LB plate and activate and culture at 28°C for 2-3 days; pick a single clone and transfer it to a 1.5ml tube containing LB and culture it at 28°C, 220r / m for 24h. (2) 1:100 expansion culture: inoculate 2mL of bacterial solution into 200mL LB liquid culture medium to culture Agrobacterium at 28°C, 220r / m until OD600=0.5; (3) Transfer the Agrobacterium to a 50ml tube, centrifuge at 5000rpm for 5min, and discard the supernatant. Resuspend the cells in 10ml of sterilized 0.15M NaCl; (4) Centrifuge at 5000rpm for 5min and discard the supernatant. Then add 1ml of ice-cold 20mM CaCl 2 (5) 200uL was dispensed into 1.5ml tubes, snap-frozen in liquid nitrogen, and stored at -70°C.

[0079] 2. Construction of silencing vector. Design primers in the conservative region of the gene, and the PCR product is about 400-500bp. Use gene recombination method to construct the target gene fragment into pTRV2 vector.

[0080] Plasmid extraction: (1) Inoculate the positive colony into 2 ml of LB medium containing appropriate antibiotics and culture at 37°C with vigorous shaking overnight.

[0081] (2) Take 1.5 ml of the culture medium, centrifuge at 12,000 rpm for 1 min, discard the supernatant, and aspirate as much of the culture medium as possible.

[0082] (3) Resuspend the bacteria in 100 μL of ice-cold solution 1 and shake vigorously.

[0083] (4) Add 200 μL of the newly prepared solution 2, quickly invert the tube 5 times without shaking, and place the tube on ice.

[0084] (5) Add 150 μL of ice-cold solution 3, invert several times, and then place the centrifuge tube on ice for 3-5 minutes.

[0085] (6) Centrifuge at 12000 rpm for 5 min and transfer the supernatant to another centrifuge tube.

[0086] (7) Add an equal volume of phenol:chloroform, vortex to mix, centrifuge at 12,000 rpm for 2 min, and transfer the supernatant to a new centrifuge tube.

[0087] (8) Precipitate the plasmid with 2 volumes of anhydrous ethanol at room temperature, vortex to mix, and leave at room temperature for 2 minutes.

[0088] (9) Centrifuge at 12000 rpm for 5 min and collect the precipitated plasmid.

[0089] (10) Carefully remove the remaining alcohol, then add 70% ethanol, invert several times, and centrifuge at 12,000 rpm for 2 min.

[0090] (11) Remove as much residual alcohol as possible from the supernatant and place the 1.5 ml tube open at room temperature for 10 minutes to allow the alcohol to evaporate.

[0091] (12) Redissolve the plasmid in 50 μL of TE containing DNase-free RNase A (20 μg / ml), store at minus 20, and transform the recombinant plasmid into Agrobacterium.

[0092] 3. The silencing vector is transformed into Agrobacterium.

[0093] (1) Add 1 μg (5-10 μl) of recombinant plasmid to 200 μl of competent medium and incubate on ice for 30 min.

[0094] (2) After quick freezing in liquid nitrogen for 1 min, immediately place in a 37°C water bath until thawed.

[0095] (3) Add 1 ml of empty liquid LB and shake gently at 28°C for 2 h.

[0096] (4) Centrifuge at 5000 rpm for 1 min and discard the supernatant.

[0097] (5) Spread the bacteria evenly on LB solid medium containing antibiotics and culture inverted at 28°C for 2-3 days.

[0098] (6) Pick a single colony from the plate and place it in 1 ml of liquid LB with antibiotics and culture it on a shaker at 28°C for 1-2 days.

[0099] (7) Colony PCR was used to identify whether the bacterial solution was positive.

[0100] 4. Preparation of bacterial solution and injection into cotton cotyledons.

[0101] 8-10 days after cotton sowing, when the cotyledons are fully expanded and before the first true leaf grows out, it is used for VIGS silencing experiments. Pick freshly streaked pTRV1, pTRV2-target gene, pTRV2 empty vector, and pTRV2-CLA colonies, inoculate them in LB containing both Kan (100 μg / ml) and Rifampicin (50 μg / ml), and culture them overnight at 28 degrees and 200 rpm for 16 hours. With a 1% accession amount, shake vigorously for about 12 hours, and the OD value is about 0.5. Centrifuge at 4000 rpm for 10 minutes to collect the bacteria. Use an appropriate suspension (10 mM MgCl 2, 10mM MES, 200μM acetosyringone) to resuspend the cells, adjust the OD value to 2.0, and let the resuspended solution stand at room temperature for 3 hours. Mix pTRV1 with TRV2-target gene; pTRV2 empty vector; pTRV2-CLA 1:1 for injection. Use a 1ml syringe and carefully pierce the back of the cotton cotyledon with the needle to inject the bacterial solution. Try to fill the cotyledon with the injection. Cultivate at 23 degrees and 16 / 8 light cycle. The target gene will be silenced after about 10 days to 2 weeks.

[0102] Indoor resistance identification of Verticillium wilt (such as Figure 3 (shown)

[0103] 1. Vaccinate against Verticillium wilt. Figure 3 A) 16-18 days after cotton was sown, when the cotton had two leaves and one heart, water it appropriately two days before inoculation with Verticillium wilt. On the day of inoculation, tear off the bottom of the nutrient pot to achieve the purpose of root injury. Each material was inoculated with a conidia suspension of Verticillium wilt at a concentration of 6×10 7 spores / ml (the sum of the spore counts in 5 large grids of the hemocytometer × 4 × 10 6 / 80 / 10 7 , get the value × the dilution multiple before the spore count, which is the required dilution multiple), 20ml per nutrient pot. Plant 30 plants of each material and set three replicates. Do not water within 3 days after infection, and then add 50ml of water every 2 days; maintain the temperature and humidity in the room to facilitate the disease.

[0104] 2. Disease level survey. Figure 3 C) The disease situation was counted one week after the inoculation. Level 0: seedlings intact, no disease; Level 1: 25% of leaves were diseased; Level 2: 50% of leaves were diseased; Level 3: 75% of leaves were diseased; Level 4: leaves of the entire plant were diseased or died. Disease index = [∑(Ni×i) / (N×4)]×100, i represents level 0 to 4. Ni represents the number of individual plants i, and N is the total number of plants.

[0105] 3. Pole splitting experiment. Figure 3 B) Verticillium wilt is a soil-borne fungus that enters through the roots and spreads throughout the body through the vascular tissue. After infection, Verticillium wilt will block the plant microtubules, making them appear brown-black. The higher the degree of infection, the darker the color. The split-pole experiment can visually show the content of Verticillium wilt in the vascular tissue. After infection, the oblique split-pole experiment was performed on the same part of the gene-silenced individual plant and the control individual plant (1 cm above the cotyledon node), and photos were taken under a stereoscope.

[0106] Cloning of GhPR6-5b gene promoter

[0107] 1. Primer sequences

[0108] According to the TM-1 genome pre-sequence analysis, the GhPR6-5b gene promoter cloning primers were designed. S707F:TGGATCTGTAGTCGGCAAAC; S707R:TAGCCTTACCAGGACACCC

[0109] 2. Cotton DNA Extraction

[0110] (1) Take a young cotton leaf (1 young leaf or 2 young buds) and place it in a 1.5 ml centrifuge tube. Add 600 μl of pre-cooled freshly prepared extraction buffer and use it directly for DNA extraction or store it at -20°C.

[0111] (2) Add steel balls, grind with a ball mill, remove the steel balls with a magnet, centrifuge at 10,000 rpm for 5 min, and discard the supernatant;

[0112] (3) Add 600 μl of lysis buffer preheated at 65°C to the pellet, loosen the pellet with a toothpick, vortex mix, and incubate at 65°C for at least 30 min, inverting and mixing 2-3 times;

[0113] (4) Add 500 μl of a mixture of chloroform and isoamyl alcohol (24:1), invert more than 50 times, centrifuge at 10,000 rpm for 10 min, and transfer the supernatant (about 400 μl) into a new 1.5 ml centrifuge tube;

[0114] (5) Add an equal volume of pre-cooled isopropanol, invert slowly at least 30 times, and let stand at -20°C for 30 min;

[0115] (6) Centrifuge at 10,000 rpm for 10 min, discard the supernatant, add 500 μl of 70% ethanol to the precipitate for washing, and dry the DNA under natural ventilation;

[0116] (6) Add 500 μl TE buffer [10 mM Tris / HCl (pH 8.0), 1 mM EDTA (pH 8.0)] to dissolve the DNA;

[0117] (7) Add an equal volume of chloroform:isoamyl alcohol (24:1), slowly invert 50 times to mix, and centrifuge at 10,000 rpm for 10 min;

[0118] (8) Transfer the supernatant to a new centrifuge tube, add 0.1 volume of 3 M sodium acetate (pH 5.2), add an equal volume of isopropanol, and invert 30 times; let stand at -20°C for 2 h;

[0119] (9) Centrifuge at 10,000 rpm for 10 min, discard the supernatant, add 1 ml of 70% ethanol to the precipitate for washing, discard the supernatant, and dry the DNA under natural ventilation;

[0120] (10) Add 200 ml of TE buffer to dissolve the DNA (4°C, 1 to 2 days) and store it at -20°C as a mother solution. The working solution concentration for PCR amplification is about 100 ng / ul.

[0121] 3. PCR reaction system (50 μL)

[0122]

[0123] The PCR reaction program was: 95°C, 5 min; 94°C, 45 sec, 57°C, 1 min, 72°C, 2 min, 35 cycles; 72°C, 10 min.

[0124] 4.1% agarose gel electrophoresis and recovery. The PCR amplification product was detected by 1% agarose gel electrophoresis and a target band was found at 2000 bp. The PCR product was recovered using the agarose gel recovery kit of TAKARA.

[0125] 5. Connect the promoter sequence recovery product. The sequencing vector was purchased from TAKARA's pmd19 vector, and the connection system was: PCR recovery product, 2.0 μL; Solution I, 2.5 μL; vector, 0.5 μL, and connect at 16°C overnight.

[0126] 6. Promoter cloning and sequencing.

[0127] (1) Thaw the competent cells on ice, add 5 μL of the ligation product to 100 μL of the competent cells, tap gently with the tip of your thumb to mix, and place on ice for 30 min;

[0128] (2) heat shock at 42°C for 90 seconds;

[0129] (3) Do not shake and carefully place on ice for 5 minutes;

[0130] (4) Add 700 μL of empty LB medium and culture at 37°C with shaking for 1 h;

[0131] (5) Centrifuge at 4000 rpm for 2 min, discard the supernatant, and spread the remaining bacteria on LB+Amp plates and culture inverted at 37°C for 15-16 h;

[0132] (6) Use a sterilized toothpick to pick a single clone from the transformation plate and place it in LB+Amp culture medium for shaking culture. When the LB liquid culture medium becomes turbid, take 2 μL of the bacterial solution for PCR amplification. The primers used for bacterial solution detection are gene-specific primers or pmd19 vector universal primers. The positive single clone is sequenced at Qingdao Qingke Company, and the sequencing gene analysis is performed using Bio-Shrimp; sequence alignment is performed using ClassalX; and post-alignment analysis is performed using Genedoc software.

[0133] Screening of GhWRKY75 genes

[0134] 1. Yeast one-hybrid (Y1 H) analysis In order to study the transcriptional regulation mechanism of GhPR6-5b gene, yeast one-hybrid technology was used to screen transcriptional regulatory factors that interact with GhPR6-5b promoter (such as Figure 4 A).

[0135] 1550bp of the promoter region of the GhPR6-5b gene was cloned into the yeast vector pAbAi to produce a bait vector; the vector was then transformed into yeast cells to construct a bait yeast strain; the cDNA library was then transformed into the bait yeast strain, and upstream regulatory factors were screened by homologous recombination; the ORF of GhWRKY75 was cloned into the yeast one-hybrid vector pGADT7-Rec to construct the fusion AD-GhWRKY75; the Y1 H-Go ld strain was used to transform the above construct for yeast one-hybrid assay with URA3 as the selective marker; the positive transformants were further cultured on YNB medium lacking uracil and leucine and containing 100ng / ml Aureobasidin A (AbA); an empty vector was used as a control to exclude self-activation and false positive results.

[0136] 2. Electrophoretic mobility shift assay (EMSA) Figure 4 C)

[0137] The ORF of GhPR6-5b was cloned into pETMALc-H to obtain a translational fusion protein with an MBP tag at the N-terminus and 6 His residues at the C-terminus; the plasmid was transformed into Rosetta (DE3); positive clones were grown in LB medium at 37°C to an OD600 of 0.4; the expression of the fusion protein was induced by adding 0.5 mM isopropylthio-β-galactoside (IPTG) and grown at 16°C for 10 hours; the cells were suspended in 6× His tag binding buffer (20 mM sodium phosphate, 0.5 mNaCl, 20–40 mM imidazole, pH 7.4) and disrupted by ultrasonication; the protein was purified using a Ni-NTA column (Qiagen).

[0138] Subcellular localization of GhWRKY75 gene (e.g. Figure 5 E)

[0139] The subcellular localization of genes was studied by transient transformation of tobacco. The vector pBinGFP4 was located, and the recombinant plasmid was transferred into Agrobacterium GV3101 by freeze-thaw transformation. Single clones of transformed Agrobacterium GV3101 were picked, and cultured in liquid LB medium containing kanamycin (50μg mL-1) + rifampicin (25μg mL-1) at 28℃ for 48h, and the bacteria were collected by centrifugation at 3000rpm for 10min. Resuspended three times with buffer suspension (10mM MgCl2, 10mM MES, pH 5.7, 150μM acetosyringone). The final concentration of the bacterial solution was adjusted to OD600 of 0.4, and it was allowed to stand at room temperature for 3h. The bacterial solution was injected into the back of 6-week-old Nicotiana benthamiana tobacco with a 1mL syringe, and 2 leaves in the middle of each tobacco were injected, and dark treatment was performed for 24h. The subcellular localization results were observed by laser confocal microscopy 72h after injection; Injection of Nicotiana benthamiana, transient transformation and observation of subcellular localization results.

[0140] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0141] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel and inventive features disclosed herein.

Claims

1. A cotton Verticillium wilt resistance gene, characterized in that: The cotton Verticillium wilt resistance gene includes GhPR6-5b, and the nucleotide sequence of GhPR6-5b is shown in Sequence Table 1.

2. The cotton Verticillium wilt resistance gene according to claim 1, characterized in that The cotton Verticillium wilt resistance gene also includes GhWRKY75, and the nucleotide sequence of GhWRKY75 is shown in Sequence Table 2.

3. A method for screening cotton Verticillium wilt resistance genes, characterized in that: The following steps are involved: a. Based on the whole gene family analysis, PR6 gene family members were discovered in tetraploid upland cotton, sea island cotton, diploid Raymond cotton and Asiatic cotton. The target gene GhPR6-5b was obtained by using the transcriptome sequencing data analysis induced by Verticillium wilt and the transcriptome data analysis of lesion-like mutants; b. Virus-induced gene silencing was used to silence the GhPR6-5b gene in TM-1 and H7124, respectively, to verify that the GhPR6-5b gene is positively involved in cotton Verticillium wilt resistance; c. Clone the GhPR6-5b promoter and obtain the WRKY transcription factor GhWRKY75 using yeast one-hybrid technology; d. GhWRKY75 binds to Wbox: TTGAC (T / C) and positively regulates GhPR6-5b gene expression.

4. The method for screening cotton Verticillium wilt resistance gene according to claim 3, characterized in that: Through the analysis of the transcriptome data of lesion-like mutants, GhWRKY75 was significantly expressed in lesion-like mutants, which indirectly confirmed that GhWRKY75 regulates GhPR6-5b and is involved in cotton wilt resistance.

5. The method for screening cotton Verticillium wilt resistance gene according to claim 4, characterized in that: Through virus-induced gene silencing technology, GhWRKY75 gene was silenced in TM-1 and H7124 respectively, verifying that it was positively involved in cotton Verticillium wilt resistance.

Images