Ferrous ion permease gene fvftr1 of flammulina velutipes and application thereof

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a Flammulina velutipes iron ion permease gene FvFTR1 and application thereof, a nucleotide sequence of the Flammulina velutipes iron ion permease gene FvFTR1 is shown as SEQ ID NO. 1, and an amino acid sequence of the protein is shown as SEQ ID NO. 2. The Flammulina velutipes iron ion permease gene FvFTR1 is cloned for the first time, the FvFTR1 gene is transferred into tobacco by using molecular biology and biotechnology means, and subcellular localization results of the FvFTR1 gene are obtained; meanwhile, the FvFTR1 gene is transferred into Pichia pastoris, and a FvFTR1 gene overexpression strain is obtained, and through comparison and analysis, it is proved that the tolerance of the overexpression strain to high iron ion stress is obviously improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to an iron ion permease gene FvFTR1 from Flammulina velutipes and its application. Background Technology

[0002] Enoki mushrooms (Flammulina velutipes) are an important edible fungus with rich nutritional and medicinal value. However, their production faces challenges such as long growth cycles and unstable yields. Therefore, accelerating the breeding of superior strains that are high-quality, high-yielding, disease-resistant, insect-resistant, and storage-resistant is essential for improving product quality.

[0003] Iron permeases belong to the ferric reductase-dependent protein family, characterized by the presence of two conserved domains, REXXE. FTR1 is currently the only known permease with a high affinity for iron ions, consisting of a ferric binding site Glu-Xaa-Xaa-Glu. The first reported iron permease was found in yeast. Further research revealed the presence of a copper oxidase protein, Fet3, on the yeast plasma membrane, and FTR1 requires the participation of Fet3 for iron uptake and transport. During iron transport and uptake, Fet3 forms a transport complex with FTR1, with Fet3 catalyzing the uptake of iron. 2+ Oxidized to Fe 3+ Fe 3+ The protein is then transported into the cell by FTR1 for absorption and utilization. FTR1 plays an important role in the survival of Candida albicans in low-iron environments and also participates in regulating the utilization of C and N sources. Furthermore, FTR1 negatively regulates the hyphal growth of Candida albicans, and its absence prevents the fungus from effectively infecting the host. In Rhizopus oryzae: FTR1 is induced to express on iron-deficient media, and RNAi silencing of the FTR1 gene leads to decreased virulence of the strain in mice; in Fusarium graminearum, FgFtr1 expression is increased on iron-deficient media, but it does not participate in regulating pathogenicity. The FTR1 homolog fer2 was identified in Ustilago maydis, and Fre2, located in the cell membrane, can complement the function of the FTR1 deletion mutant in Saccharomyces cerevisiae. During the pathogenic process, fre2 is expressed during the hyphal differentiation period of the strain within the host. The absence of fer2 leads to a significant decrease in the pathogenicity of the strain, indicating that the high-affinity iron ion uptake system is involved in regulating the pathogenicity of plant pathogenic fungi.

[0004] However, research on FTR1 and its function in large edible and medicinal fungi is still relatively lacking. Therefore, we used enoki mushroom as the research material to identify the FTR1 gene and explore its biological function. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an iron ion permease gene FvFTR1 from *Flammulina velutipes* and its application.

[0006] The present invention is achieved by providing a ferrous enoki mushroom iron ion permease gene FvFTR1, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] A protein encoded by the iron ion permease gene FvFTR1 of *Flammulina velutipes* is provided, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] Primers for amplifying the iron permease gene FvFTR1 from *Flammulina velutipes* are provided as follows: pCAMBIA1300-FvFTR1-F and pCAMBIA1300-FvFTR1-R.

[0009] pCAMBIA1300-FvFTR1-F:

[0010] 5'-GAGCTCGGTACCCGGGGATCCATGGCAAAAAACTTGTTCTC-3'

[0011] pCAMBIA1300-FvFTR1-R:

[0012] 5'-GCCCTTGCTCACCATGTCGACCTTCGGGAGTTCATGAAGGCT-3'

[0013] The first 15 bases at the 5' end of the primer are homologous sequences of the vector, and the next 6 bases are restriction enzyme sites. These 21 bases do not belong to the FvFTR1 gene sequence, but are necessary for constructing a recombinant plant overexpression vector.

[0014] Primers for amplifying the iron permease gene FvFTR1 from *Flammulina velutipes* are provided as pPIC9-FvFTR1-F and pPIC9-FvFTR1-R, with the following nucleotide sequences:

[0015] pPIC9-FvFTR1-F:

[0016] 5'-AGAATTCATGGCAAAAAACTTGTTCTCTG-3'

[0017] pPIC9-FvFTR1-R:

[0018] 5'-TTGCGGCCGCTTAGTGGTGGTGGTGGTGGTGCTTCGGGAGTTCATGAAG GCT-3'

[0019] In the pPIC9-FvFTR1-F primer, the first 7 bases at the 5' end are the restriction enzyme site sequence, the first 10 bases at the 5' end of the pPIC9-FvFTR1-R primer are the restriction enzyme site sequence, the next 3 bases are the stop codon sequence, and the following 18 bases are the 6×his tag. These bases are necessary for constructing the yeast expression vector.

[0020] A plant overexpression vector containing the above-mentioned enoki mushroom iron ion permease gene FvFTR1 is provided, namely pCAMBIA1300-35S-GFP-FvFTR1.

[0021] This invention provides an application of a plant overexpression vector containing the above-mentioned enoki mushroom iron ion permease gene FvFTR1, specifically for the subcellular localization of pCAMBIA1300-35S-GFP-FvFTR1 in tobacco.

[0022] A yeast overexpression vector containing the above-mentioned enoki mushroom iron ion permease gene FvFTR1 is provided, namely pPIC9-FvFTR1.

[0023] This invention provides an application of the yeast overexpression vector of the above-mentioned enoki mushroom iron ion permease gene FvFTR1, which is used to improve the iron tolerance of yeast.

[0024] Compared with the prior art, the advantages of the present invention are as follows:

[0025] This invention marks the first time that an iron ion permease gene, FvFTR1, has been cloned from *Flammulina velutipes*. Using molecular biology and biotechnology, the FvFTR1 gene was transferred into tobacco, yielding subcellular localization results. Simultaneously, it was transferred into *Pichia pastoris*, resulting in a yeast strain overexpressing the FvFTR1 gene. Comparative analysis demonstrated that the overexpressing yeast strain exhibited significantly improved tolerance to high iron ion stress. Attached Figure Description

[0026] Figure 1 The result is the amplification of the full-length 1152bp cDNA sequence of the FvFTR1 gene;

[0027] Figure 2 The results of subcellular localization detection of the FvFTR1 gene in tobacco leaves;

[0028] Figure 3 (a) Yeast growth of GS115 and pPIC9:FvFTR1 under normal conditions, 5 mM FeCl3, and 15 mM FeCl3. Figure 3 (b) Yeast growth of GS115 and pPIC9:FvFTR1 under normal conditions, 5mM FeSO4 and 15mM FeSO4.

[0029] Figure 4 The expression levels of the pPIC9:FvFTR1 gene were observed under normal conditions, after treatment with 5 mM FeCl3 and FeSO4, and after treatment with 15 mM FeCl3 and FeSO4. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0031] Example 1: Cloning of the FvFTR1 gene in *Flammulina velutipes*

[0032] Using the mycelium of Shennong Pleurotus ostreatus No. 1 as the test material; total RNA was extracted from the mycelium using the EASYspin Plus plant RNA rapid extraction kit and then reverse transcribed to synthesize the first strand of cDNA.

[0033] Gene cloning: Using the reverse-transcribed first-strand cDNA as a template, PCR amplification was performed using primers pCAMBIA1300-FvFTR1-F / pCAMBIA1300-FvFTR1-R and pPIC9-FvFTR1-F / pPIC9-FvFTR1-R. The PCR product was recovered, yielding a 1152 bp target fragment. See the appendix for related results. Figure 1 .

[0034] Example 2: Construction of plant expression vectors

[0035] The purified gel-recovered product, FvFTR1, was ligated into a linear fragment of pCAMBIA1300-35S-GFP using an In-Fusion HD Cloning kit. The reaction mixture consisted of 5 μL 2×Cloning Mix, 3 μL of the linear fragment, and 2 μL of the target gene fragment, and was incubated at 50°C for 30 min. The ligation product was transformed into E. coli competent cells TOP10. After colony PCR and sequencing identification, the plant expression vector pCAMBIA1300-35S-GFP-FvFTR1 carrying the target gene was obtained by shaking the cells and extracting the plasmid. This was then transformed into Agrobacterium GV3101 competent cells, and colony PCR identification was performed to obtain Agrobacterium containing the recombinant plasmid, which was then used for transformation of tobacco leaves.

[0036] Example 3: Construction of yeast expression vector

[0037] The purified gel-recovered product FvFTR1 was ligated into the pLB-T vector. EcoRI and NotI were used to digest the T-vector and pPIC9 vector, respectively. The reaction mixture consisted of 6 μL pPIC9 plasmid / T-vector plasmid, 2 μL 10×H Buffer, 2 μL LBSA, 1 μL EcoRI, 1 μL NotI, and 8 μL ddH2O. The reaction was carried out at 37℃ for 3 h, and the linear large fragment and target small fragment were recovered. The target small fragment of FvFTR1 was ligated into the linear large fragment of pPIC9 using T4 ligase. The reaction mixture consisted of 1 μL 10×T4 ligase buffer, 1 μL T4 ligase, 5 μL target small fragment, and 3 μL linear large fragment. Ligation was carried out overnight at 16℃. The ligation product was transformed into E. coli competent cells TOP10. After colony PCR and sequencing identification, the recombinant plasmid pPIC9-FvFTR1 carrying the target gene was obtained by shaking the culture and extracting the plasmid.

[0038] Example 4: Subcellular localization detection of tobacco leaves transformed with recombinant plasmids

[0039] Agrobacterium GV3101 positive clones containing the recombinant plasmids pCAMBIA1300-35S-GFP and pCAMBIA1300-35S-GFP-FvFTR1 were first inoculated into 10 mL of solution containing 50 μg / mL of the compound plasmid. -1 Rif (rifampin) and 50 μg·mL -1 The culture was carried out in YEP liquid medium containing kanamycin at 28°C with shaking for 16 hours, and then inoculated into 50 mL of medium containing 50 μg / mL kanamycin. -1 Rif (rifampin) and 50 μg·mL -1In YEP liquid medium containing kanamycin, the cells were cultured at 28°C with shaking for 3 hours until the OD600 reached 0.8-1. The cells were then collected by centrifugation at 4000 rpm for 10 minutes and analyzed using 0.5 mol·L⁻¹ hydrochloride. -1 MES + 1 mol·L -1 MgCl2 + 100 mmol·L -1 The bacterial cells were suspended in an aqueous solution of AS (acetylsyleugenol) until the OD600 was 0.6-0.8, and then incubated at 28°C in the dark for 3 hours. The bacterial suspension was then injected into the tobacco leaves using a needleless syringe. The cells were then cultured in the dark for 24 hours, followed by 72 hours of light culture.

[0040] Subcellular localization detection: Using tobacco leaves injected with only pCAMBIA1300-35S-GFP Agrobacterium as a control, the expression of the pCAMBIA1300-35S-GFP-FvFTR1 fusion protein in tobacco protoplasts was detected using laser confocal microscopy. The fluorescence signal of pCAMBIA1300-35S-GFP was detected in multiple subcellular compartments, including the plasma membrane, nucleus, and cytoplasm, while the fluorescence signal of pCAMBIA1300-35S-GFP-FvFTR1 was mainly detected in the plasma membrane, with a small amount detected in the cytoplasm. This indicates that FTR1 in *Flammulina velutipes* is mainly localized on the plasma membrane, which is consistent with its iron ion permeation function. Related results are shown in the appendix. Figure 2 .

[0041] Example 5: Functional verification of Pichia pastoris by transforming recombinant plasmid.

[0042] Pichia pastoris GS115 was inoculated into liquid YPD medium and cultured at 30°C and 180 rpm for 24 h. 1 mL of the bacterial culture was centrifuged at 3000 rpm for 5 min. Using the Super Yeast Competent Cell Preparation and Transformation Kit, 1 mL of LY1 solution was added to resuspend the cells. After centrifugation, 100 μL of LY2 solution was added to prepare competent yeast cells. The pPIC9-FvFTR1 recombinant plasmid was digested with BglII, and the linear large fragment was recovered and mixed with 350 μL of LY3 solution. This mixture was then added to 50 μL of competent cells and heat-shocked at 30°C for 1 h, mixing every 10 min. After centrifugation, ddH2O was added to resuspend the cells, and the mixture was incubated upside down on MD plates. After screening and colony PCR detection, the recombinant yeast transformant pPIC9:FvFTR1 was obtained.

[0043] Dot assay: GS115 and pPIC9:FvFTR1 were simultaneously inoculated into liquid YPD and cultured for 16 h. The OD600 was adjusted to an error of <0.1. The adjusted bacterial suspension was then diluted 10⁻⁶ times. 0 10 -1 10 -2 10 -3The yeast cells were diluted 10 times and then inoculated into normal YPD and iron-containing media to observe the phenotype. The results showed that under iron stress, yeast volume decreased with increasing iron concentration. Under low iron stress, there was no significant difference in growth between GS115 and pPIC9:FvFTR1. However, when the iron concentration reached 15 mM, i.e., high iron stress, GS115 showed a significant decrease in volume at a 10-fold dilution. -2 The pPIC9:FvFTR1 strain could no longer grow, while the GS115 strain continued to grow normally. This indicates that the pPIC9:FvFTR1 strain is more tolerant to iron stress than the GS115 strain. FvFTR1 can promote the growth of Pichia pastoris under high iron ion stress. See the attached table for related results. Figure 3 .

[0044] qRT-PCR assay: Further analysis of FvFTR1 gene expression was performed. Total RNA was extracted from pPIC9:FvFTR1 cells cultured under normal conditions and with different iron concentrations for 24 hours with shaking. cDNA was synthesized via reverse transcription, and the expression of the FvFTR1 gene in the recombinant yeast transformant pPIC9:FvFTR1 was detected using qRT-PCR. Results showed that FvFTR1 expression gradually decreased with increasing iron concentration; its expression was inhibited at high iron concentrations. (See attached table for related results.) Figure 4 .

Claims

1. The iron permease gene FvFTR1 from *Flammulina velutipes*, characterized in that... The nucleotide sequence of the enoki mushroom iron ion permease gene FvFTR1 is shown in SEQ ID NO.

1.

2. The protein encoded by the iron permease gene FvFTR1 of *Flammulina velutipes*, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. Primers for amplifying the *Flammulina velutipes* iron ion permease gene FvFTR1 as described in claim 1, characterized in that, The nucleotide sequences of pCAMBIA1300-FvFTR1-F and pCAMBIA1300-FvFTR1-R are as follows: pCAMBIA1300-FvFTR1-F: 5'-GAGCTCGGTACCCGGGGATCCATGGCAAAAAACTTGTTCTC-3' pCAMBIA1300-FvFTR1-R: 5'-GCCCTTGCTCACCATGTCGACCTTCGGGAGTTCATGAAGGCT-3' The first 15 bases at the 5' end of the primer are homologous sequences of the vector, and the next 6 bases are restriction enzyme sites. These 21 bases do not belong to the FvFTR1 gene sequence, but are necessary for constructing a recombinant plant overexpression vector.

4. Primers for amplifying the *Flammulina velutipes* iron permease gene FvFTR1 as described in claim 1, characterized in that, The nucleotide sequences of pPIC9-FvFTR1-F and pPIC9-FvFTR1-R are as follows: pPIC9-FvFTR1-F: 5'-AGAATTCATGGCAAAAAACTTGTTCTCTG-3' pPIC9-FvFTR1-R: 5'-TTGCGGCCGCTTAGTGGTGGTGGTGGTGGTGCTTCGGGAGTTCATGAAG GCT-3' In the pPIC9-FvFTR1-F primer, the first 7 bases at the 5' end are the restriction enzyme site sequence, the first 10 bases at the 5' end of the pPIC9-FvFTR1-R primer are the restriction enzyme site sequence, the next 3 bases are the stop codon sequence, and the following 18 bases are the 6×his tag. These bases are necessary for constructing the yeast expression vector.

5. A plant overexpression vector containing the *Flammulina velutipes* iron ion permease gene FvFTR1 as described in claim 1, characterized in that, It is pCAMBIA1300-35S-GFP-FvFTR1.

6. The application of the plant overexpression vector of the *Flammulina velutipes* iron ion permease gene FvFTR1 as described in claim 5, characterized in that, Application of pCAMBIA1300-35S-GFP-FvFTR1 in subcellular localization in tobacco.

7. A yeast overexpression vector containing the *Flammulina velutipes* iron permease gene FvFTR1 as described in claim 1, characterized in that, It is pPIC9-FvFTR1.

8. The application of the yeast overexpression vector of the *Flammulina velutipes* iron permease gene FvFTR1 as described in claim 7, characterized in that, Application of pPIC9-FvFTR1 in improving iron tolerance in yeast.

Images