CRISPR-Cas12a gene editing system based on homologous recombination repair mechanism and application of CRISPR-Cas12a gene editing system in mycobacterium neoaurum

Abstract

The invention discloses a CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-associated 12a) gene editing system based on a homologous recombination repair mechanism and application of the CRISPR-Cas12a gene editing system in mycobacterium neoaurum. The CRISPR (clustered regularly interspaced short palindromic repeats) technology is coupled with a homologous recombination (HR) repair mechanism, so that efficient and rapid genetic manipulation on the mycobacterium neoaurum gene is realized. According to the CRISPR-Cas12a system, an endogenous promoter is screened, so that respective expression of FnCas12a and crRNA is successfully realized, and the HR repair efficiency is improved by expressing an HR element Che9c and knocking out a key gene of a non-homologous end repair mechanism mediated by a Ku gene, so that accurate target gene editing is realized. Meanwhile, by screening proper PAM sequence recognition sites and crRNA length, the editing efficiency of the target gene is improved, and an effective technical means is provided for researching the mycobacterium neoaurum.

Description

Technical Field

[0001] The present invention relates to a gene editing system, and in particular to a system and method for editing the gene of Mycobacterium neogoldensis by using CRISPR-Cas12a editing technology based on homologous end ligation. Background Art

[0002] Mycobacterium neoaurum is a classic microorganism that produces steroid drugs and is very important in human health care and pharmaceutical processes. The production of steroid drugs depends largely on the endogenous metabolic pathways of Mycobacterium neoaurum. However, due to the strong exclusivity of the protection mechanism of Mycobacterium neoaurum itself, it is difficult for exogenous genes to stably exist and express in Mycobacterium neoaurum, which makes it difficult to use gene editing methods applicable to Mycobacterium neoaurum. At present, Mycobacterium neoaurum is often edited by allele replacement. Since the activity of the recombinant protein of Mycobacterium neoaurum itself is very low, the probability of allele replacement is very low, resulting in low editing efficiency. In addition, the editing method of allele replacement also requires the introduction of resistance tags on the genome, and continuous gene editing cannot be performed. The suicide vector system (pNIL / pGOAL series plasmids) developed based on the homologous recombination repair mechanism of microorganisms solves the problem of selection markers, but the endogenous homologous recombination repair mechanism is weak, resulting in its editing efficiency is still very low. Therefore, gene editing is undoubtedly a difficulty in metabolic engineering of Mycobacterium neoaurea, and there is an urgent need to improve the gene editing system for Mycobacterium neoaurea in order to more efficiently transform Mycobacterium neoaurea.

[0003] The CRISPR-Cas (clustered regularly interspaced short palindromic repeats and CRISPR-associated protein) system, that is, clustered regularly interspaced short palindromic repeats and CRISPR-associated proteins, is widely present in the genomes of bacteria and archaea, and serves as an acquired immune system to effectively resist interference caused by bacteriophages and various external genetic elements.

[0004] In 2012, Jennifer Doudna and Emmanuelle Charpentier used Streptococcus pyogenes to demonstrate the cutting mechanism of the type II CRISPR system in vitro for the first time. The CRISPR system inserts a gene fragment (proto-spacers) on a plasmid or phage between the leader sequence and the repeat sequence, thereby forming a repeat sequence-spacer sequence unit. The CRISPR locus is transcribed into a long chain of precursor RNA (pre-crRNA) and processed into mature crRNA by the Cas endonuclease. At the same time, the trans-activating crRNA (tracrRNA) complementary to the crRNA is also transcribed. Ultimately, mature crRNA, tracrRNA and Cas protein combine to form an effector complex, forming a DNA double-strand break (DSB) at a specific target. As a severe DNA damage, DSB will initiate two repair pathways: homologous recombination (HR) or non-homologous end joining repair (NHEJ).

[0005] Generally speaking, DSB repair in prokaryotes mainly relies on homologous recombination. HR is a basic feature of horizontal gene transfer between bacteria, that is, the transferred DNA fragment cannot replicate independently, and must break, exchange, and reconnect with the DNA molecule with the same sequence on the recipient chromosome. However, in Mycobacterium neogoldensis, NHEJ, as the main repair mechanism, inhibits HR repair ability, which may be related to Ku and DNA ligase (LigD) in the strain. Ku protein recognizes and binds to the broken double-stranded ends to prevent nuclease degradation, thereby increasing the half-life of DNA, and then recruits LigD to modify and connect the ends. D. Nayak et al. found that non-homologous end joining is an error-prone repair mechanism that usually introduces insertions or deletions at the DNA break, resulting in gene knockout. Homologous recombination has high fidelity and can accurately modify the break according to the template. Therefore, based on this principle, the CRISPR-Cas9 system is used to couple the HR repair mechanism in Escherichia coli and Lactobacillus for gene editing to obtain high editing efficiency.

[0006] Although Cas9 has been applied to gene regulation in Mycobacterium tuberculosis, the toxicity of Cas9 protein limits its function in Mycobacterium neogoldensis. Cas12a is a recently discovered type V nuclease that can recognize the thymidine-rich PAM region (5'-TTTN-3'), and the formed CRISPR-Cas12a complex only requires crRNA to participate in gene editing. Therefore, how CRISPR-Cas12a is specifically applied to Mycobacterium neogoldensis can be further studied and analyzed. Summary of the invention

[0007] Purpose of the invention: In view of the problems existing in the operation of the traditional homologous recombination system, such as the cumbersome and time-consuming construction process and the toxicity of Cas9 protein in Mycobacterium novogenes, the present invention is based on the homologous recombination repair mechanism, utilizes the CRISPR-Cas12a system to perform genome editing of Mycobacterium novogenes, and improves the editing efficiency of the CRISPR-Cas12a system through system optimization.

[0008] Technical solution: The present invention first provides an FnCas12a gene for a CRISPR-Cas12a gene editing system, whose sequence is shown in SEQ ID No: 1.

[0009] The FnCas12a gene provided by the present invention encodes the FnCas12a protein, and its gene sequence is optimized with reference to the characteristics of high GC content and codon preference of Mycobacterium neogoldensis.

[0010] The present invention further provides a recombinant vector carrying an optimized FnCas12a gene, which is an Escherichia coli-Mycobacterium shuttle vector containing a replication origin oriE and a temperature-sensitive replicon pAL5000, and the optimized FnCas12a gene is expressed under the drive of the endogenous promoter mn23 of Mycobacterium neogoldensis.

[0011] In an embodiment of the present invention, the FnCas12a gene sequence was first optimized with reference to the characteristics of high GC and codon preference of mycobacteria, and then cloned into a shuttle vector pJV53 that can replicate in Mycobacterium neogoldensis, so that FnCpf1 was induced to express under the regulation of the endogenous promoter mn23, and the prepared vector was named pCR2D.

[0012] In a second aspect, the present invention provides a recombinant vector for constructing a single plasmid CRISPR-Cas12a system, the recombinant vector carrying the FnCas12a gene as described above, comprising a crRNA expression unit (direct repeat sequence-spacer sequence-direct repeat sequence unit) and overexpressing a homologous recombinase Che9c gene. The recombinant vector HpCR2D-crRNA.

[0013] Optionally, in some embodiments of the present invention, the FnCas12a gene is a gene encoding a FnCas12a protein, and the FnCas12a gene is expressed under the drive of an endogenous promoter mn23, and the nucleotide sequence of the endogenous promoter mn23 is shown in SEQ ID No: 27.

[0014] Optionally, in some embodiments of the present invention, the crRNA expression unit is expressed under the drive of the endogenous promoter mn1, and the nucleotide sequence of the endogenous promoter mn1 is shown in SEQ ID No:5.

[0015] Optionally, in some embodiments of the present invention, the Che9c gene is expressed by the Hsp60 promoter, the Che9c gene sequence is shown in SEQ ID No:3, and the Hsp60 gene sequence is shown in SEQ ID No:4.

[0016] In the third aspect, the present invention further constructs a single plasmid CRISPR-Cas12a system, including the above-mentioned recombinant vector HpCR2D-crRNA, that is, a recombinant vector HpCR2D-crRNA carrying the FnCas12a gene and a direct repeat sequence-spacer sequence-direct repeat sequence unit and overexpressing the Che9c gene, wherein the spacer sequence is derived from the target gene.

[0017] Optionally, in some embodiments of the present invention, the sequence of the direct repeat sequence-spacer sequence-direct repeat sequence unit of the present invention is as shown in SEQ ID No: 2 in the sequence table. The direct repeat sequence is 19 bp long and rich in palindromic sequences capable of forming a hairpin structure; the spacer sequence is a 23 bp pre-spacer sequence for the target gene.

[0018] Optionally, in some embodiments of the present invention, in the HpCR2D-crRNA plasmid of the present invention, the mn1 promoter is responsible for driving the direct repeat sequence-spacer sequence-direct repeat sequence unit crRNA, and the nucleotide sequence of the promoter mn1 is shown in SEQ ID No:5.

[0019] Optionally, in some embodiments of the present invention, the above-mentioned HpCR2D-crRNA plasmid also contains a constitutive strong promoter Hsp60 for expressing the phage-derived homologous recombinase Che9c, and the sequences of the gene Che9c and the promoter Hsp60 are shown in SEQ ID No: 3 and SEQ ID No: 4, respectively.

[0020] In a fourth aspect, the present invention provides a CRISPR-Cas12a gene editing system, comprising the gene as described above or the recombinant vector as described above, and no off-target effect can be detected at the genomic level; or comprising the single plasmid CRISPR / Cas12a system as described above.

[0021] In a fifth aspect, the present invention provides a gene editing kit for bacteria, wherein the gene editing kit for bacteria comprises the CRISPR-Cas12a gene editing system as described above.

[0022] In a sixth aspect, the present invention provides the use of the CRISPR-Cas12a gene editing system or the gene editing kit for bacteria as described above in gene editing of the new Mycobacterium aureus mutant strain LY-2△Ku.

[0023] Optionally, in some embodiments of the present invention, the above-mentioned new Mycobacterium aureum mutant strain LY-2△Ku is a mutant strain in which the endogenous non-homologous end repair key gene Ku in the new Mycobacterium aureum LY-2 gene is knocked out.

[0024] Optionally, in some embodiments of the present invention, the CRISPR-Cas12a gene editing system of the present invention can be used to perform CRISPR-Cas12a-assisted homologous recombination in the new Mycobacterium goldii mutant strain LY-2△Ku, and perform gene editing on the new Mycobacterium goldii mutant strain LY-2△Ku.

[0025] Optionally, in some embodiments of the present invention, the specific gene editing method includes:

[0026] Insert the target sequence located at the 3' end of the PAM sequence in the target gene into the target sequence insertion site of the recombinant plasmid HpCR2D-crRNA;

[0027] Prepare upper and lower homology arms for the target gene and connect them to the recombinant plasmid HpCR2D-crRNA to form HpCR2D-crRNA-UD;

[0028] The editing plasmid HpCR2D-crRNA-UD with the inserted target sequence and upper and lower homology arms was electroporated into the new Mycobacterium aureus mutant strain LY-2△Ku cells;

[0029] Screening of new Mycobacterium aureus monoclonal clones with edited target genes.

[0030] Optionally, in some embodiments of the present invention, the upper and lower homology arms are linear double-stranded DNAs targeting the target gene, each with a length of 500 bp.

[0031] Optionally, in some embodiments of the present invention, the crRNA nucleotide sequence of the target gene aftA is shown in SEQ ID No: 46-SEQ ID No: 49.

[0032] Further optionally, in some embodiments of the present invention, the crRNA nucleotide sequence of the target gene aftA is as shown in SEQ ID No:47.

[0033] Beneficial effects: The present invention utilizes CRISPR technology coupled with homologous recombination (HR) repair mechanism to achieve efficient and rapid genetic manipulation of the genes of Mycobacterium neogoldensis. The CRISPR-Cas12a system successfully achieved the expression of FnCas12a and crRNA by screening endogenous promoters, and improved the HR repair efficiency by expressing the HR element Che9c and knocking out the key genes of the non-homologous end repair mechanism mediated by the Ku gene, thereby achieving precise target gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a schematic diagram of the single plasmid structure of the CRISPR-Cas12a-assisted homologous recombination system.

[0035] Figure 2 It is expressed with strong endogenous promoter of Mycobacterium neoformans.

[0036] Figure 3 This is the result of the effect of expressing FnCas12a by a weak endogenous promoter on the growth of Mycobacterium neogoldenum.

[0037] Figure 4 This is a schematic diagram of the knockout of Mycobacterium neoformans LY-2 by the CRISPR-Cas12a single plasmid HpCR2D-crRNA system, wherein A shows the knockout effect diagram for the hydroxyacyl-CoA dehydrogenase hsd4a of Mycobacterium neoformans, with an editing efficiency of 0%; B shows the knockout effect diagram for the arabinofuranosyltransferase aftA of Mycobacterium neoformans, with an editing efficiency of 0%.

[0038] Figure 5 This is a schematic diagram of the knockout of the new Mycobacterium aureum mutant strain LY-2△Ku by the CRISPR-Cas12a single plasmid HpCR2D-crRNA system, where A shows the knockout effect diagram for the new Mycobacterium aureum hydroxyacyl-CoA dehydrogenase hsd4a, with an editing efficiency of 13.1%; B shows the knockout effect diagram for the new Mycobacterium aureum arabinofuranosyltransferase aftA, with an editing efficiency of 21.7%.

[0039] Figure 6 It is to enhance homologous recombination and improve the editing efficiency of the CRISPR-Cas12a system.

[0040] Figure 7 This is the editing efficiency result of arabinofuranosyltransferase aftA after screening suitable PAM sequence recognition sites and crRNA lengths by the CRISPR-Cas12a system. DETAILED DESCRIPTION

[0041] Although Cas9 has been applied to gene regulation in Mycobacterium tuberculosis, the toxicity of Cas9 protein limits its function in Mycobacterium neogoldensis. Cas12a is a recently discovered type V nuclease that can recognize the thymidine-rich PAM region (5'-TTTN-3'), and the formed CRISPR-Cas12a complex only requires crRNA to participate in gene editing. However, how CRISPR-Cas12a should be specifically applied to Mycobacterium neogoldensis still requires further research and analysis.

[0042] Based on this, the present invention aims at the problems that the construction process of the traditional homologous recombination system is cumbersome and time-consuming, and the toxicity of Cas9 protein in Mycobacterium neogoldensis, and proposes a FnCas12a gene applied to the CRISPR-Cas12a genome editing system based on the homologous recombination repair mechanism, and its sequence is shown in SEQ ID No: 1.

[0043] On the other hand, the present invention also proposes a recombinant vector for constructing a single plasmid CRISPR-Cas12a system, the recombinant vector carrying the FnCas12a gene as described above, comprising a crRNA expression unit and overexpressing a homologous recombinase Che9c gene. The recombinant vector HpCR2D-crRNA, the vector is an Escherichia coli-Mycobacterium shuttle vector containing a replication origin ori and a temperature-sensitive replicon pAL5000.

[0044] In some examples, the FnCas12a gene is a gene encoding a FnCas12a protein, and the FnCas12a gene is expressed under the drive of an endogenous promoter mn23, and the nucleotide sequence of the endogenous promoter mn23 is shown in SEQ ID No: 27.

[0045] In some examples, the crRNA expression unit is expressed under the drive of the endogenous promoter mn1, and the nucleotide sequence of the endogenous promoter mn1 is shown in SEQ ID No:5.

[0046] In some examples, the Che9c gene is expressed by the Hsp60 promoter, the Che9c gene sequence is shown in SEQ ID No:3, and the Hsp60 gene sequence is shown in SEQ ID No:4.

[0047] On the other hand, the present invention provides a single plasmid CRISPR-Cas12a system, comprising the recombinant vector HpCR2D-crRNA as described above.

[0048] In some examples, the crRNA expression unit contains a direct repeat sequence-spacer sequence-direct repeat sequence unit driven by promoter mn1, wherein the spacer sequence comprises a target sequence insertion site, and the nucleotide sequence of the promoter mn1 is shown in SEQ ID No:5.

[0049] In some examples, the sequence of the direct repeat sequence-spacer sequence-direct repeat sequence unit is as shown in SEQ ID No: 2 in the sequence listing.

[0050] On the other hand, the present invention proposes a CRISPR / Cas12a gene editing system, comprising the gene as described above or the recombinant vector as described above, and no off-target effect can be detected at the genome level; or comprising the single plasmid CRISPR / Cas12a system as described above.

[0051] On the other hand, the present invention provides a gene editing kit for bacteria, which comprises the CRISPR-Cas12a gene editing system as described above.

[0052] On the other hand, the present invention proposes the use of the above-mentioned CRISPR / Cas12a gene editing system or the above-mentioned gene editing kit for bacteria in gene editing of the new Mycobacterium aureum mutant strain LY-2△Ku, wherein the new Mycobacterium aureum mutant strain LY-2△Ku is a mutant strain in which the endogenous non-homologous end repair key gene Ku in the new Mycobacterium aureum LY-2 gene is knocked out.

[0053] In some examples, gene editing was achieved by CRISPR-Cas12a-assisted homologous recombination in the new Mycobacterium auris mutant strain LY-2ΔKu.

[0054] In some examples, the gene editing specifically includes:

[0055] Insert the target sequence located at the 3' end of the PAM sequence in the target gene into the target sequence insertion site of the recombinant plasmid HpCR2D-crRNA;

[0056] Prepare the upper and lower homology arms UD for the target gene, and insert them into the recombinant plasmid HpCR2D-crRNA of the target sequence to form HpCR2D-crRNA-UD;

[0057] The editing plasmid HpCR2D-crRNA-UD with the inserted target sequence and allelic exchange substrate was electroporated into the new Mycobacterium aureus mutant strain LY-2△Ku cells;

[0058] Screening of new Mycobacterium aureus monoclonal clones with edited target genes.

[0059] In some examples, the crRNA nucleotide sequence of the target gene aftA is shown in SEQ ID No:46-SEQ ID No:49.

[0060] Preferably, in some examples, the crRNA nucleotide sequence of the target gene aftA is shown in SEQ ID No:47.

[0061] The present invention is further described in detail below by way of examples, but the scope of the present invention is not limited in any way.

[0062] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the specific material ratios, process conditions and results described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0063] In the following examples, only the pJV53 vector involved was purchased from Hunan Fenghui Biotechnology Co., Ltd.; the one-step cloning reagent ClonExpress II One Step Cloning Kit involved in the following examples was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; the new Mycobacterium aureus LY-2 involved in the following examples was excavated from the laboratory.

[0064] Method for detecting gene knockout efficiency:

[0065] The calculation formula of gene knockout efficiency is as follows: gene knockout efficiency = (number of colonies verified to be successfully knocked out / total number of transformants picked) × 100%.

[0066] The preparation method of Mycobacterium neoaurea LY-2 competent cells is as follows:

[0067] The new gold Mycobacterium LY-2 in the frozen tube was inoculated into 10mL LB liquid culture medium and cultured on a shaking table at 30°C for 64h to obtain a seed solution; the seed solution was transferred to 50mL competent culture medium at an inoculation rate of 2%, and cultured on a shaking table at 30°C for 4-6h to obtain a bacterial solution; the bacterial solution, 10% glycerol, a dry and sterile electric shock cup and a sterilized 50mL centrifuge tube were precooled on ice for 20-30min; the precooled bacterial solution was placed in a centrifuge tube on a clean bench, refrigerated centrifuged at 5000rpm and 4°C for 10min, the supernatant was discarded, 30mL 10% glycerol was added and the bacteria were suspended, and the cells were precooled on ice for 15min; the above steps were repeated twice, the supernatant was discarded, 2mL 10% glycerol was added and the bacteria were suspended, and the cells were dispensed into EP tubes, 100μL per tube, to obtain new gold Mycobacterium LY-2 competent cells.

[0068] The transformation method of Mycobacterium neoaurea LY-2 is as follows:

[0069] In the clean bench, add the plasmid to be transformed into the LY-2 competent cells, mix well, and place on ice for 30 minutes; after 30 minutes, transfer all the competent cells into the pre-cooled electroporation cup, quickly wipe the outer wall of the cup, place it in the electroporator, and electroporate twice at 2.5KV and 5ms; after the electroporation, add 1mL LB culture medium to the electroporation cup and mix well, transfer all to the EP tube, and resuscitate at 30℃ shaking for 2-3h; after resuscitation, collect the cells by centrifugation, remove part of the supernatant, spread on the resistant slant / solid culture medium, and culture inverted at 30℃ incubator for 5-7 days to obtain the transformed new golden mycobacterium LY-2.

[0070] Example 1: Construction of CRISPR-Cas12a gene editing system

[0071] This embodiment mainly realizes the separate expression of the two components of the CRISPR-Cas12a gene editing system, FnCas12a and crRNA, by screening the endogenous promoter of Mycobacterium neogoldensis, wherein the FnCas12a gene sequence derived from Francisella was optimized with reference to the characteristics of high GC content and codon preference of Mycobacterium neogoldensis.

[0072] The template plasmid pJV53 provided by the present invention contains the Escherichia coli replication origin oriE and the mycobacterium temperature-sensitive replicon pAL5000, which can be used as a shuttle vector. When constructing the CRISPR-Cas12a editing system, the strong promoter Hsp60 is first integrated into the front of the FnCas12a gene using a one-step cloning method, and electroporated into the new gold mycobacterium for characterization. It was found that no single colony appeared, indicating that the expression of FnCas12 using a strong promoter has greater cytotoxicity. Therefore, it is necessary to dig out the endogenous promoter to express the FnCas12 gene (SEQ ID No: 1).

[0073] 23 endogenous promoters mn1-23 of new golden mycobacterium LY-2 were predicted through the online website softberry (as shown in Table 1), and the strong promoter hsp60 was used as a control. The enhanced green fluorescent protein EGFP was cloned into the template plasmid pJV53 by homologous recombination to obtain the recombinant plasmids phsp60E and pmn1-23E. The recombinant plasmid was electroporated into new golden mycobacterium LY-2, spread on a kana resistant plate, and cultured for 5-7 days until the bacteria grew. A single colony was picked and cultured in liquid LB, and the fluorescence intensity of the strain expressing green fluorescent protein (EGFP) was measured using a flow cytometer, as shown in Figure 2. Figure 2 Shown are the new M. aureus endogenous promoters discovered.

[0074] Table 1 New endogenous promoters of Mycobacterium aureus discovered

[0075]

[0076]

[0077] In order to screen suitable promoters for expressing FnCas12a, all promoters with fluorescence intensity lower than Hsp60 were used to express FnCas12, such as Figure 3 As shown, the promoter mn23 with the most colony-forming units after electroporation was successfully screened, and the strong promoter mn1 was used to express the crRNA unit (SEQ ID No: 2).

[0078] Using vector pJV53 as a template, promoters mn23 and mn1 were used to express FnCas12a and crRNA units, respectively, using a one-step cloning method to obtain vector pCR2D-crRNA.

[0079] Example 2: Application of CRISPR-Cas12a gene editing system 1

[0080] The purpose of this example is to verify whether the CRISPR-Cas12a gene editing system pCR2D-crRNA can achieve gene editing in Mycobacterium neogold using genes hsd4a and aftA as targets.

[0081] According to the conclusions obtained in Example 1, the expression of FnCas12a and crRNA units is achieved by using endogenous promoters, but in order to achieve the editing of the new gold mycobacterium gene, it is necessary to frequently replace the spacer sequence in the crRNA unit to achieve the editing of different genes. At present, the spacer sequence of the target gene is usually designed using CRISPOR online.

[0082] The crRNA unit sequence is as follows:

[0083] AATTTCTACTGTTGTAGAT GACCGAGGGACCGTTCGTGCTGG AATTTCTACTGT TGTAGAT

[0084] The solid line part is the direct repeat sequence, and the other parts are the spacer sequences that are frequently replaced for the target gene.

[0085] In Mycobacterium neoformans, hydroxyacyl-CoA dehydrogenase hsd4a was targeted, the corresponding spacer sequence crhsd4a was designed using CRISPOR, and the single-plasmid editing system pCR2D-crhsd4a-UD was constructed by a one-step cloning method.

[0086] The crhsd4a unit sequence is as follows

[0087] AATTTCTACTGTTGTAGAT CGCCTCTTCGGGCAGCGAACCCA AATTTCTACTGT TGTAGAT(SEQ ID No: 28)

[0088] U-hsd4a primer pair for homology arm on hsd4a gene

[0089] primer U-hsd4a-F:5'-CGAGCGTCGTACGAGCGCGGCACCAA-3'(SEQ ID No:29)

[0090] primer U-hsd4a-R:5'-CGGTTCCTTACGTGCTGAATGTCCTTTCTGGATGG-3'(SEQ ID No:30)

[0091] Hsd4a gene lower homology arm D-hsd4a primer pair

[0092] primer D-hsd4a-F:5'-GGACATTCAGCACGTAAGGAACCGATATGTCTTTTGG-3'(SEQ IDNo:31)

[0093] primer D-hsd4a-R:5'-CGGCGCGGAATCAGCACCAGACCCG-3'(SEQ ID No:32)

[0094] The single plasmid editing system pCR2D-crhsd4a was transformed into Mycobacterium novogenes LY-2 according to the electroporation method of Mycobacterium novogenes, and primers hsd4a-F and hsd4a-R were designed to verify the knockout of the target gene hsd4a. Figure 4 As shown in A, the editing efficiency is 0%.

[0095] hsd4a-F:5'-GCACCAACATGCTCGACACCGG-3'(SEQ ID No:33)

[0096] hsd4a-R:5'-CGGTACATCGTCCTCACCCGGG-3'(SEQ ID No:34)

[0097] In Mycobacterium neogoldenum, the arabinofuranosyltransferase aftA was targeted, the corresponding spacer sequence craftA was designed using CRISPOR, and the single-plasmid editing system pCR2D-craftA-UD was constructed through a one-step cloning method.

[0098] The craftA unit sequence is as follows

[0099] AATTTCTACTGTTGTAGAT CGGATGGCCAGCACGAACGGTCC AATTTCTACTGT TGTAGAT(SEQ ID No:35)

[0100] U-aftA primer pair for homology arm on aftA gene

[0101] primer U-aftA-F:5'-GCTCTAGAGGTCGACGTGGCGATCGTCGC-3'(SEQ IDNo:36)

[0102] primer U-aftA-R:5'-GTAGTTGTCGGGATGTGCCGAATCACGGACATCAG-3'(SEQ ID No:37)

[0103] aftA gene lower homology arm D-aftA primer pair

[0104] primer D-aftA-F:5'-GACAACTACCATCTAGCTCCGTGAACGACAC-3'(SEQ IDNo:38)

[0105] primer D-aftA-R:5'-GCCTACGTAGGGATCGGGATCATCCGAGGCCTG-3'(SEQ IDNo:39)

[0106] The single plasmid editing system pCR2D-craftA was transformed into Mycobacterium neogoldensis LY-2 according to the electroporation method of Mycobacterium neogoldensis, and primers aftA-F and aftA-R were designed to verify the knockout of the target gene aftA. Figure 4 As shown in Figure B, the editing efficiency is still 0%, which may be because the homologous recombination repair ability of the new gold Mycobacterium itself is weak. In order to further enhance the homologous recombination repair ability, Examples 3 and 4 were carried out.

[0107] aftA-F:5'-GACAGGTCGGTGAAGACGCCGAC-3'(SEQ ID No:40)

[0108] aftA-R:5'-CGAAGTCGGTGCAGTACTTGGACTTCGAC-3'(SEQ ID No:41)

[0109] Example 3: Overexpression of the homologous recombinase Che9c in Mycobacterium neogoldenum

[0110] The purpose of this embodiment is to enhance the ability of homologous recombination. Plasmid pJV53 is used as a template and the constitutive strong promoter Hsp60 is used to express the phage-derived homologous recombination enzyme Che9c. The Che9c gene sequence is shown in SEQ ID No: 3 in the sequence list. At the same time, the Hsp60 gene sequence is shown in SEQ ID No: 4 in the sequence list. Primers primer Hsp60-F and primer Hsp60-R are designed to amplify Hsp60, and Hsp60 is recombined into pCR2D-crRNA using a one-step cloning method to form a recombinant plasmid HpCR2D-crRNA, as shown in FIG. Figure 1 shown.

[0111] Hsp60 constitutive strong promoter primer pair

[0112] primer Hsp60-F: 5'-ACGCAGACCGGGTGACCACAACGACGCGCC-3'(SEQ IDNo:42)

[0113] primer Hsp60-R: 5'-TCTCCATCATACTCGCTGCGACGACGGGC-3' (SEQ ID No: 43)

[0114] The homologous recombination enzyme Che9c obtained by the enhanced homologous recombination strategy of this example was tested for homologous recombination ability in the subsequent Example 5.

[0115] Example 4: Construction of a new Mycobacterium aureus mutant LY-2ΔKu strain

[0116] In this embodiment, in order to improve the homologous recombination repair ability of the new gold Mycobacterium itself, in addition to using the method of Example 3 to enhance the expression of Che9c homologous recombinase, it is also necessary to reduce the expression of key enzymes of the non-homologous end repair mechanism of the endogenous strain to further enhance the endogenous homologous repair ability. Therefore, this embodiment uses the traditional suicide plasmid method, designs primers primer U-Ku-F and primer U-Ku-R to amplify the homologous arm U-Ku on the Ku gene, and primers primer D-Ku-F and primer D-Ku-R to amplify the homologous arm D-Ku under the Ku gene, and integrates them into the suicide plasmid using a one-step cloning method to form a recombinant plasmid p2NILB-Ku-UD.

[0117] Ku gene homology arm U-Ku primer pair

[0118] primer U-Ku-F:5'-TTTGATTAGTACGACTTCAGGTGGGCGGCACG-3'(SEQ IDNo:44)

[0119] primer U-Ku-R: 5'-GGACGTGCCAGTTCACCTAGACCCGGGTACCCCGA-3' (SEQ ID No: 45)

[0120] Downstream homologous arm D-Ku primer pair of Ku gene

[0121] primer D-Ku-F: 5'-GTCTAGGTGAACTGGCACGTCCGGCGACAGAAC-3' (SEQ IDNo: 46)

[0122] primer D-Ku-R: 5'-GTGATGTTATTCCGACCAGCCCCAGCGAATC-3' (SEQ IDNo: 47)

[0123] The suicide plasmid p2NILB-Ku-UD targeting the target gene Ku was added to the competent Mycobacterium neoaurum LY-2, and the plasmid concentration was 1 μg; after ice bath for 30 min, electrotransformation was carried out at 2 KV for 5 ms twice, and then 1 mL of LB was added for resuscitation for 3 h; after 3 h, the supernatant was removed by centrifugation at 5000 rpm for 2 min, and the remaining 100 μL was spread on a Kana plate and cultured for 5 - 7 d; when single colonies grew out, any one was selected and cultured in 10 mL of LB for 2 d; the culture solution was diluted 10000 times and then spread on a 100 g / L sucrose LB solid plate and cultured for 4 d; when single colonies grew out, the verification primers Ku-F and Ku-R of the target gene Ku were used for verification, and finally the construction of the recombinant Mycobacterium neoaurum mutant strain LY-2△Ku was achieved, reducing the ability of the endogenous non-homologous end joining mechanism.

[0124] Ku-F: 5'-GTGTCGAGGCGTGCGAGCTGA-3' (SEQ ID No: 48)

[0125] Ku-R: 5'-CGCACCGCGATGAAGTCCCAG-3' (SEQ ID No: 49)

[0126] The recombinant Mycobacterium neoaurum mutant strain LY-2△Ku constructed by the enhanced homologous recombination strategy in this example was tested for homologous recombination ability in Example 5 below.

[0127] Example 5: Application of CRISPR-Cas12a gene editing system 2

[0128] The purpose of this embodiment is to verify the application of the CRISPR-Cas12a gene editing system HpCR2D-crRNA again on the basis of the enhanced homologous recombination repair ability in Example 4, and use the online CRISPOR to design the spacer sequence of the target gene.

[0129] The crRNA unit sequence is as follows:

[0130] AATTTCTACTGTTGTAGAT GACCGAGGGACCGTTCGTGCTGG AATTTCTACTGT TGTAGAT

[0131] The solid line part is the direct repeat sequence, and the other parts are the spacer sequences that are frequently replaced for the target gene.

[0132] In the new Mycobacterium aureus mutant strain LY-2△Ku, hydroxyacyl-CoA dehydrogenase hsd4a was targeted, the corresponding spacer sequence crhsd4a was designed using CRISPOR, and the single-plasmid editing system HpCR2D-crhsd4a-UD was constructed by a one-step cloning method.

[0133] The crhsd4a unit sequence is as follows

[0134] AATTTCTACTGTTGTAGAT CGCCTCTTCGGGCAGCGAACCCA AATTTCTACTGT TGTAGAT (SEQ ID No: 28)

[0135] U-hsd4a primer pair for homology arm on hsd4a gene

[0136] primer U-hsd4a-F:5'-CGAGCGTCGTACGAGCGCGGCACCAA-3'(SEQ ID No:29)

[0137] primer U-hsd4a-R:5'-CGGTTCCTTACGTGCTGAATGTCCTTTCTGGATGG-3'(SEQ ID No:30)

[0138] Hsd4a gene lower homology arm D-hsd4a primer pair

[0139] primer D-hsd4a-F:5'-GGACATTCAGCACGTAAGGAACCGATATGTCTTTTGG-3'(SEQ IDNo:31)

[0140] primer D-hsd4a-R:5'-CGGCGCGGAATCAGCACCAGACCCG-3'(SEQ ID No:32)

[0141] The single plasmid editing system HpCR2D-crhsd4a-UD was transformed into the mutant strain LY-2△Ku of Mycobacterium novogenes according to the electroporation method of Mycobacterium novogenes, and the primers hsd4a-F and hsd4a-R were designed to verify the knockout of the target gene hsd4a. Figure 5 As shown in A, its editing efficiency is 13.1%. At the same time, when strain LY-2△Ku is used alone as the chassis, only a low editing knockout of the target gene hsd4a can be achieved, and its editing efficiency is 2%. Figure 6 However, the editing system that enhanced the phage-derived homologous recombination enzyme Che9c was unable to achieve target gene knockout.

[0142] hsd4a-F:5'-GCACCAACATGCTCGACACCGG-3'(SEQ ID No:33)

[0143] hsd4a-R:5'-CGGTACATCGTCCTCACCCGGG-3'(SEQ ID No:34)

[0144] In Mycobacterium neoformans, the arabinofuranosyltransferase aftA was targeted, the corresponding spacer sequence craftA was designed using CRISPOR, and the single-plasmid editing system HpCR2D-craftA-UD was constructed through a one-step cloning method.

[0145] The craftA unit sequence is as follows

[0146] AATTTCTACTGTTGTAGAT CGGATGGCCAGCACGAACGGTCC AATTTCTACTGT TGTAGAT (SEQ ID No:35)

[0147] U-aftA primer pair for homology arm on aftA gene

[0148] primer U-aftA-F:5'-GCTCTAGAGGTCGACGTGGCGATCGTCGC-3'(SEQ IDNo:36)

[0149] primer U-aftA-R:5'-GTAGTTGTCGGGATGTGCCGAATCACGGACATCAG-3'(SEQ ID No:37)

[0150] aftA gene lower homology arm D-aftA primer pair

[0151] primer D-aftA-F:5'-GACAACTACCATCTAGCTCCGTGAACGACAC-3'(SEQ IDNo:38)

[0152] primer D-aftA-R:5'-GCCTACGTAGGGATCGGGATCATCCGAGGCCTG-3'(SEQ IDNo:39)

[0153] The single plasmid editing system HpCR2D-craftA was transformed into the mutant strain LY-2△Ku of Mycobacterium novogenes according to the electroporation method of Mycobacterium novogenes, and primers aftA-F and aftA-R were designed to verify the knockout of the target gene aftA. Figure 5 As shown in B, the editing efficiency is 21.7%. At the same time, when the strain LY-2△Ku is used alone, only a low editing knockout of the target gene aftA can be achieved, and its editing efficiency is 4%. Figure 6 However, the editing system that enhanced the phage-derived homologous recombination enzyme Che9c was unable to achieve target gene knockout.

[0154] aftA-F:5'-GACAGGTCGGTGAAGACGCCGAC-3'(SEQ ID No:40)

[0155] aftA-R:5'-CGAAGTCGGTGCAGTACTTGGACTTCGAC-3'(SEQ ID No:41)

[0156] Compared with the editing efficiency of the wild strain of Mycobacterium ly-2 obtained in Example 2, the editing efficiency of the single plasmid editing system HpCR2D-craftA can be effectively improved by overexpressing the phage-derived homologous recombinase Che9c and using the mutant strain of Mycobacterium ly-2△Ku as the competent cell.

[0157] Example 6: CRISPR-Cas12a gene editing system optimization

[0158] The purpose of this embodiment is mainly to further optimize the CRISPR-Cas12a gene editing system based on overexpression of the phage-derived homologous recombinase Che9c and using the new Mycobacterium aureus mutant strain LY-2△Ku as the competent cell to achieve efficient gene editing of the target gene.

[0159] In order to further improve the editing efficiency of the pCR2D-crRNA system constructed based on the homologous recombination repair mechanism, this embodiment overexpresses the phage-derived homologous recombinase Che9c and uses the new gold mycobacterium mutant strain LY-2△Ku as the competent cell. According to the type of target gene PAM sequence, four different crRNAs that recognize 5'-TTTT-3', 5'-TTTC-3', 5'-TTTG-3' and 5'-TTTA-3' are designed; at the same time, the spacer sequence on the crRNA is shortened to 23 to 19bp. Experimental results show that screening suitable PAM sequence recognition sites and crRNA lengths can improve the editing efficiency of the CRISPR-Cas12a system. Specifically as follows:

[0160] Taking arabinofuranosyltransferase aftA as the target, four craftA-1, craftA-2, craftA-3 and craftA-4 were designed according to the four types of PAM sequences of the target gene (5'-TTTT-3', 5'-TTTC-3', 5'-TTTG-3' and 5'-TTTA-3'), as shown in Table 2;

[0161] Table 2.4 craftA

[0162]

[0163] Based on the design of four craftA-1, craftA-2, craftA-3 and craftA-4, the spacer sequence at the 3' end of craftA was shortened, as shown in Table 3. The experimental results show that optimizing the length and type of crRNA can improve the editing efficiency of the CRISPR-Cas12a system.

[0164] Table 3. craftA shortened sequence

[0165]

[0166]

[0167] The optimized craftA series in Table 3 above were connected to the single plasmid editing system using a one-step cloning method, and were transformed into Mycobacterium neogoldensis LY-2△Ku according to the Mycobacterium neogoldensis electroporation method to determine the editing efficiency of the target gene aftA. Figure 7As shown in the figure, when the PAM sequence is 5'-TTTC-3' (craftA-2, SEQ ID No: 46-SEQID No: 49), the overall editing efficiency is high. Among them, the editing efficiency of craftA with the spacer sequence at the 3' end shortened by 2 is the highest (craftA-2-2, SEQ ID No: 47), with a maximum of 60.7%, and the colony forming unit (CFU) is also the highest (as shown in Figure 1). Figure 7 ). Therefore, based on the designed single-plasmid editing system HpCR2D-crRNA, we screened suitable PAM sequence recognition sites and crRNA lengths to achieve high CRISPR-Cas12a gene editing in Mycobacterium neoformans.

[0168] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An FnCas12a gene applied to a CRISPR-Cas12a genome editing system, whose sequence is shown in SEQ ID No:

1.

2. A recombinant vector for constructing a single plasmid CRISPR-Cas12a system, the recombinant vector carrying the FnCas12a gene as claimed in claim 1, comprising a crRNA expression unit and overexpressing a recombinant vector HpCR2D-crRNA of a homologous recombinase Che9c gene.

3. The recombinant vector according to claim 2, characterized in that The FnCas12a gene is a gene encoding the FnCas12a protein, and the FnCas12a gene is expressed under the drive of the endogenous promoter mn23, and the nucleotide sequence of the endogenous promoter mn23 is shown in SEQ ID No: 27; The crRNA expression unit is expressed under the drive of the endogenous promoter mn1, and the nucleotide sequence of the endogenous promoter mn1 is shown in SEQ ID No: 5; The Che9c gene is expressed by the Hsp60 promoter, the Che9c gene sequence is shown in SEQ ID No:3, and the Hsp60 gene sequence is shown in SEQ ID No:

4.

4. A single plasmid CRISPR-Cas12a system, comprising the recombinant vector HpCR2D-crRNA as claimed in claim 2 or 3, preferably, the crRNA expression unit contains a direct repeat sequence-spacer sequence-direct repeat sequence unit driven by promoter mn1, wherein the spacer sequence comprises a target sequence insertion site, and the nucleotide sequence of the promoter mn1 is shown in SEQ ID No:

5.

5. The single plasmid CRISPR-Cas12a system as claimed in claim 4, characterized in that The sequence of the direct repeat sequence-spacer sequence-direct repeat sequence unit is shown as SEQ ID No: 2 in the sequence listing.

6. A CRISPR / Cas12a gene editing system, comprising the gene as described in claim 1 or the recombinant vector as described in claim 2 or 3, and no off-target effect can be detected at the genomic level; or comprising the single plasmid CRISPR / Cas12a system as described in claim 4 or 5.

7. A gene editing kit for bacteria, characterized in that: The gene editing kit for bacteria includes the CRISPR-Cas12a gene editing system as described in claim 6.

8. Use of the CRISPR / Cas12a gene editing system according to claim 6 or the gene editing kit for bacteria according to claim 7 in gene editing of the new Mycobacterium aureum mutant LY-2ΔKu, wherein the new Mycobacterium aureum mutant LY-2ΔKu is a mutant in which the endogenous non-homologous end repair key gene Ku in the new Mycobacterium aureum LY-2 gene is knocked out.

9. The use according to claim 8, characterized in that Gene editing was achieved by CRISPR-Cas12a-assisted homologous recombination in the new Mycobacterium aureus mutant strain LY-2ΔKu.

10. The use according to claim 9, characterized in that: The gene editing specifically includes: Insert the target sequence located at the 3' end of the PAM sequence in the target gene into the target sequence insertion site of the recombinant plasmid HpCR2D-crRNA; Prepare the upper and lower homology arms UD for the target gene, and insert them into the recombinant plasmid HpCR2D-crRNA of the target sequence to form HpCR2D-crRNA-UD; The editing plasmid HpCR2D-crRNA-UD with the inserted target sequence and allelic exchange substrate was electroporated into the new Mycobacterium aureus mutant strain LY-2△Ku cells; Screening of new Mycobacterium aureus monoclonal clones with edited target genes; Preferably, the crRNA nucleotide sequence of the target gene aftA is shown in SEQ ID No: 46-SEQ ID No: 49; More preferably, the crRNA nucleotide sequence of the target gene aftA is as shown in SEQ ID No:47.

Images