Tomato Solyc03g118880 gene and application thereof

Abstract

The invention discloses an application of a tomato Solyc03g118880 gene in acceleration of tomato fruit maturation, the Solyc03g118880 gene is knocked out through gene editing, a homozygous plant which is obviously accelerated in fruit maturation and does not contain exogenous gene insertion can be rapidly obtained in two generations, and a parent material for subsequent tomato fruit accelerated breeding is obtained. By identifying edited homozygous fruits, the fruits are normally mature, the time for reaching the mature period is remarkably shortened, and a new strategy is provided for accelerating tomato production and breeding.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a tomato Solyc03g118880 gene and an application thereof. Background Art

[0002] Tomato (Solanum lycopersicum) ranks first in the world in annual output of vegetables. It is not only an important horticultural crop, but also an important model plant for scientific research. Tomato fruit occupies an important position in the diet and cooking of all countries. my country ranks first in the world in tomato cultivation area and output, and the consumption is huge. Fruit ripening time is an important trait of tomatoes, which determines its time to market and thus affects its commodity value. Effective adaptation of products to circulation and staggered market launch can generate higher production benefits and increase farmers' income. In addition, shortening the fruit development time and making it mature faster can help improve land and greenhouse utilization efficiency. Summary of the invention

[0003] The present invention aims to solve at least one of the above-mentioned technical problems existing in the prior art.

[0004] In order to achieve the above object, the technical solution adopted by the present invention is:

[0005] The first aspect of the present invention provides the use of an agent for blocking or weakening the expression of the tomato Solyc03g118880 gene in any of the following aspects:

[0006] Accelerate the ripening of tomato fruits;

[0007] Preparation of a product for accelerating the ripening of tomato fruit.

[0008] The Solyc03g118880 gene has a total of 1039 bases (the nucleotide sequence is shown in SEQ ID NO.1) and contains two exons. The ITAG4.0 gene model of the tomato genome (https: / / solgenomics.net / ) shows that Solyc03g118880 is located in the 62114142-62115180 interval of chromosome 3, and its protein contains 40 amino acids (the protein sequence is shown in SEQ ID NO.2).

[0009] Accelerating tomato fruit ripening means that the fruits of tomato plants whose tomato Solyc03g118880 gene expression is blocked or weakened not only ripen normally, but also take significantly shorter time to reach maturity compared to tomato plants whose tomato Solyc03g118880 gene expression is not regulated.

[0010] The product for accelerating the ripening of tomato fruits can be a kit containing a reagent for blocking or weakening the expression of the tomato Solyc03g118880 gene.

[0011] In some embodiments, the agent for blocking or weakening the expression of the tomato Solyc03g118880 gene includes at least one of an agent for knocking down the Solyc03g118880 gene and an agent for knocking out the Solyc03g118880 gene.

[0012] In some embodiments, the reagent for knocking down the Solyc03g118880 gene includes at least one reagent used in RNA interference technology, antisense RNA technology, CRISPR / Cas13 technology, target gene analog technology or short tandem target analog technology for the Solyc03g118880 gene. The RNA interference molecules include dsRNA, siRNA, and shRNA.

[0013] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes at least one of the reagents used in the giant nuclease technology, ZFN technology, TALEN technology, CRISPR / Cas gene knockout technology, homologous recombination technology, and random insertion mutagenesis technology for the Solyc03g118880 gene. For example, the giant nuclease used in the giant nuclease technology for the Solyc03g118880 gene, the ZFN protein used in the ZFN technology, the TALEN protein used in the TALEN technology, the guide RNA used for editing the Solyc03g118880 gene by the CRISPR / Cas gene knockout technology, the recombinant DNA fragment used in the homologous recombination technology, and the T-DNA or transposon used in the random insertion mutagenesis technology.

[0014] In some embodiments, the CRISPR / Cas gene knockout technology is CRISPR / Cas9 technology, and the guide RNA sequence used for CRISPR / Cas9 technology is shown in any one of SEQ ID NO.3-4.

[0015] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing at least one of the guide RNA sequences shown in SEQ ID NO.3-4.

[0016] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing a guide RNA sequence shown in SEQ ID NO.3.

[0017] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing a guide RNA sequence shown in SEQ ID NO.4.

[0018] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing the guide RNA sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0019] In some embodiments, the CRISPR / Cas9 gene editing vector further contains a nucleotide sequence encoding a Cas9 protease.

[0020] In some embodiments, the CRISPR / Cas9 gene editing vector is a pAGM4723 vector.

[0021] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes Agrobacterium transformed with the CRISPR / Cas9 gene editing vector.

[0022] In some embodiments, the Agrobacterium is Agrobacterium of the GV3101 strain.

[0023] A second aspect of the present invention provides a method for accelerating the ripening of tomato fruits, comprising:

[0024] Block or weaken the expression of Solyc03g118880 gene in tomato cells;

[0025] A tomato plant in which the expression of the Solyc03g118880 gene is blocked or weakened is developed or regenerated from the tomato cell.

[0026] In some embodiments, the blocking or weakening of the expression of the Solyc03g118880 gene in tomato cells comprises at least one of knocking down the Solyc03g118880 gene and knocking out the Solyc03g118880 gene.

[0027] In some embodiments, the knocking down of the Solyc03g118880 gene includes knocking down the Solyc03g118880 gene by at least one of RNA interference technology, antisense RNA technology, CRISPR / Cas13 technology, target gene analog technology, or short tandem target analog technology.

[0028] In some embodiments, the knocking out of the Solyc03g118880 gene includes knocking out the Solyc03g118880 gene by at least one of meganuclease technology, ZFN technology, TALEN technology, CRISPR / Cas gene knockout technology, homologous recombination technology, and random insertion mutagenesis technology.

[0029] In some embodiments, the CRISPR / Cas gene knockout technology is CRISPR / Cas9 technology, and the guide RNA sequence used for CRISPR / Cas9 technology is shown in any one of SEQ ID NO.3-4.

[0030] In some embodiments, the knockout of the Solyc03g118880 gene comprises using an Agrobacterium transformation method, wherein the Agrobacterium is transformed with a CRISPR / Cas9 gene editing vector comprising at least one of the guide RNA sequences shown in SEQ ID NO.3-4.

[0031] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing a guide RNA sequence shown in SEQ ID NO.3.

[0032] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing a guide RNA sequence shown in SEQ ID NO.4.

[0033] In some embodiments, the reagent for knocking out the Solyc03g118880 gene includes a CRISPR / Cas9 gene editing vector containing the guide RNA sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0034] In some embodiments, the Agrobacterium is Agrobacterium of the GV3101 strain.

[0035] In some embodiments, the CRISPR / Cas9 gene editing vector further contains a nucleotide sequence encoding a Cas9 protease.

[0036] In some embodiments, the CRISPR / Cas9 gene editing vector is a pAGM4723 vector.

[0037] The third aspect of the present invention provides a method for obtaining a tomato plant, comprising using the method of the second aspect to obtain a tomato plant in which the expression of the Solyc03g118880 gene is blocked or weakened.

[0038] In some embodiments, the method further comprises screening for tomato Solyc03g118880 gene knockout plants that can be stably inherited.

[0039] In some embodiments, the screening includes extracting DNA from tomato plants, amplifying the target fragment using primers described in SEQ ID NO.6 and SEQ ID NO.7, and screening tomato Solyc03g118880 gene knockout plants that can be stably inherited based on sequence comparison with the wild type Solyc03g118880 after sequencing.

[0040] In some embodiments, the stably inherited tomato Solyc03g118880 gene knockout plant does not contain the Cas9 gene.

[0041] In some embodiments, the method further comprises hybridizing tomato plants in which the expression of the tomato Solyc03g118880 gene is blocked or weakened to obtain progeny plants.

[0042] In some embodiments, the method further comprises screening the progeny plants for homozygous plants.

[0043] The fourth aspect of the present invention provides a tomato plant or part, seed, cell or offspring thereof obtained by the method of the third aspect, wherein the part includes roots, stems, leaves, flowers and fruits of tomato.

[0044] The beneficial effects of the present invention are:

[0045] The present invention provides an application of the tomato Solyc03g118880 gene in accelerating the ripening of tomato fruits. By knocking out the Solyc03g118880 gene through gene editing, homozygous plants with significantly accelerated fruit ripening and no exogenous gene insertion can be quickly obtained in two generations, and parent materials for subsequent accelerated breeding of tomato fruits can be obtained. By identifying the edited homozygous fruits, the fruits not only mature normally, but also the time taken to reach the ripening period is significantly shortened, providing a new strategy for accelerating tomato production and breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Solyc03g118880 encodes a protein with a predicted structure.

[0047] Figure 2 The expression level of Solyc03g118880 gene changes in different stages of fruit development, MG: Mature green, Br: Breaker, Br+7: 7 days after Breaker.

[0048] Figure 3Gene editing produces Solyc03g118880 gene knockout mutation, where A shows gene knockout mutation, single base insertion in KO-1 strain, single base deletion in KO-2 strain, sgRNA used is shown in red sequence, start codon is shown in blue dashed box, dashed line indicates the position and length of mutant base deletion, B shows mutant protein changes. Solyc03g118880 contains 2 exons, wild-type protein contains 40 amino acids, single base insertion in KO-1 strain leads to premature termination of translation, resulting in truncated protein containing 10 amino acids, of which only 1 amino acid is the same as wild type, single base deletion in KO-2 strain leads to start codon deletion, unable to produce functional protein, red arrow indicates sgRNA position.

[0049] Figure 4 The homozygous mutant fruits ripen normally but the ripening time is significantly shortened, among which A shows T 1 The homozygous strains KO-1 and KO-2 were isolated in the first generation. The time (days) required for the fruit to break color was significantly shorter than that of the wild type. B shows that the fruits of the homozygous strains KO-1 and KO-2 broke color normally (Breaker) and turned completely red 7 days after breaking color (Br+7), which was no different from the wild type. *** represents p < 0.001, and the scale bar is 2 cm. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below by specific examples. The raw materials, reagents or devices used in the examples can be obtained from conventional commercial sources or by prior art methods unless otherwise specified. Unless otherwise specified, the experiments or test methods are conventional methods in the art.

[0051] The Solyc03g118880 gene has a total of 1039 bases (the nucleotide sequence is shown in SEQ ID NO.1) and contains two exons. The ITAG4.0 gene model of the tomato genome (https: / / solgenomics.net / ) shows that Solyc03g118880 is located in the 62114142-62115180 interval of chromosome 3, and its protein contains 40 amino acids (the protein sequence is shown in SEQ ID NO.2). The online protein structure tool I-TASSER (https: / / zhanggroup.org / I-TASSER / ) predicts that the protein structure encoded by this gene is as follows Figure 1 The function of this gene has not been reported before.

[0052] SEQ ID NO.1:

[0053]

[0054] SEQ ID NO.2:

[0055] Met Ile Trp Ile Ser Leu Ser Thr Leu Pro Glu Glu Val Arg Leu Gln PheTyr Asn Arg Asp Ile Trp Thr Ser Ile Ser Lys Gln Ile Lys Lys Leu Ser Tyr AspIle Leu Gly Ser.

[0056] The CRISPR / Cas9 system, which combines clustered regularly interspaced shortpalindromic repeats (CRISPR) with Cas9 (CRISPR associated) protein, introduces mutations during the process of double-stranded DNA cutting and repair. This feature makes it an important gene editing tool and makes the acquisition of mutants more efficient and convenient.

[0057] The inventors used fluorescent quantitative PCR to find that the expression level of Solyc03g118880 was significantly upregulated during the fruit ripening period ( Figure 2 ). Solyc03g118880 was knocked out using CRISPR / Cas gene editing technology, resulting in two different mutation types, both of which resulted in the inability to produce normal active proteins. The homozygous mutant fruit not only matured normally, but also took significantly shorter time to reach maturity. This gene will be of great significance for the cultivation of new tomato breeding materials with controllable maturity, and has the potential to be used to accelerate tomato production and breeding.

[0058] The plant material used in the embodiment of the present invention is tomato (cv. Ailsa Craig), which is planted in the ecological greenhouse of the Zhongluotan Base of the Institute of Facility Agriculture of Guangdong Academy of Agricultural Sciences.

[0059] Example 1. Gene editing to generate tomato plants with Solyc03g118880 gene knockout mutation

[0060] Solyc03g118880 gene knockout mutation was generated by CRISPR / Cas gene editing, and two different mutation types were obtained. Figure 3 As shown in A, the KO-1 strain was obtained by single base insertion, and the KO-2 strain was obtained by single base deletion. Figure 3Figure B shows the changes in mutant proteins. The single base insertion in the KO-1 strain caused premature translation termination, resulting in a truncated protein containing 10 amino acids, of which only one amino acid was identical to the wild type. The single base deletion in the KO-2 strain resulted in the loss of the start codon, and no functional protein could be produced.

[0061] The specific steps are as follows:

[0062] 1. Design of sgRNA for Solyc03g118880 gene

[0063] Small guide RNA (sgRNA) was designed based on the DNA sequence and coding sequence (SEQ ID NO.1) of Solyc03g118880 using the online tool website CRISPOR (http: / / crispor.gi.ucsc.edu / ), and two were selected based on the work efficiency and off-target probability prediction.

[0064] sgRNA sequence:

[0065] sgRNA1: 5'-TGTGCTTGAAACACATGATT-3' (SEQ ID NO.3);

[0066] sgRNA2: 5'-CGACCTTACCTGAAGAGGTC-3' (SEQ ID NO. 4).

[0067] 2. Construction of CRISPR / Cas9 gene editing vector

[0068] sgRNA1 and sgRNA2 were connected to the Arabidopsis U6 promoter and inserted into the pICH47751 and pICH47761 vectors respectively, and transformed into Escherichia coli DH5a by electroporation. The plasmid was extracted after overnight culture in LB liquid medium containing 100 mg / L carbenicillin, and then sequenced using primer sgRNA-R (SEQ ID NO.5) to ensure that the sgRNA sequence was correct. The sgRNA and vector were digested with endonuclease BbsI-HF (New England Biolabs, Inc) and connected to the CRISPR / Cas9 gene editing vector pAGM4723, transformed into Escherichia coli DH5a by electroporation, and the plasmid was extracted after overnight culture in LB liquid medium containing 100 mg / L kanamycin. The plasmid was transformed into Agrobacterium strain GV3101 by electroporation, and then plated on LB plate medium containing 20 mg / L rifampicin and 100 mg / L kanamycin for screening. Monoclonal plaques were picked and cultured in LB liquid medium containing 20 mg / L rifampicin and 100 mg / L kanamycin. This method constructs two sgRNAs into one vector at the same time, and only one genetic transformation is required to obtain multiple different Solyc03g118880 gene knockout mutations located at different locations.

[0069] Primer sequence: sgRNA-R: 5′-GACCCTGTGTTGCATGCCAT-3′ (SEQ ID NO. 5).

[0070] 3. Genetic transformation of tomato

[0071] Tomato seeds were disinfected by soaking in 1% sodium hypochlorite solution, washed with sterile water, and inoculated in 1 / 2MS medium (MS + 1% sucrose + 0.8% agar), placed in a culture room, 16h light / 8h, 25°C for 5 days. Cotyledons were cut off and placed in medium (MS + 3% sucrose + 0.8% agar) for 1 day in the dark. Agrobacterium was cultured overnight to an OD600 of about 0.8, and the cotyledons were transferred to an Agrobacterium bacterial solution supplemented with 10 μM / mL acetosyringone for infection for 10 min. The cotyledons were then transferred to a sterilized filter paper, the bacterial solution was dried, and the cotyledons were then transferred to a co-culture medium (MS + 3% sucrose + 0.05% MES (2-N-morpholinoethanesulfonic acid) + 0.8% agar) for co-culture for 2 days. The cotyledons were then transferred to a meristem medium (MS + 1% glucose + 0.8% agar + 2 mg / L zeatin + 500 mg / L carbenicillin + 100 mg / L kanamycin) for culture for 7 to 8 weeks, during which the culture medium was replaced every 2 weeks. When the regenerated plants grew to about 1 cm, they were cut and placed in a rooting medium (MS + 15% sucrose + 0.8% agar + 0.25 mg / L Indole-3-butyric acid). acid (IBA) + 320mg / L timentin) to take root; about 2 weeks later, the well-rooted regenerated seedlings were transplanted to asbestos for further cultivation.

[0072] Example 2. Screening of Solyc03g118880 gene knockout mutant strains capable of stable inheritance

[0073] After about 7 days of culture in asbestos, the leaves of the transformed plants were collected and DNA was extracted using the Phire hot start PCR kit (ThermoFisher). Primers F1 (SEQ ID NO.6) and R1 (SEQ ID NO.7) were designed at about 200 bp upstream and downstream of the Solyc03g118880 gene, and Phire hot start II DNA polymerase was used to PCR amplify the DNA fragment containing the mutation region. After sequencing, the mutation was detected based on sequence comparison with the wild type Solyc03g118880. Plants containing mutations were retained and their seeds were collected for T1 generation Mendelian segregation.

[0074] Reaction system: 5×Phire buffer 4 μL, F1 1 μL, R1 1 μL, DNA 0.5 μL, Phire DNA polymerase 0.4 μL, sterile water 14.1 μL.

[0075] Reaction conditions: pre-denaturation at 98°C for 30 seconds; denaturation at 98°C for 5 seconds, annealing at 64.2°C for 5 seconds, extension at 72°C for 15 seconds, 40 cycles.

[0076] Primer sequences:

[0077] F1:5'-TGCAGGTTTCGTCAGATGGA-3' (SEQ ID NO.6);

[0078] R1: 5'-TGTGGACCATGATGATCGAGT-3' (SEQ ID NO. 7).

[0079] Leaves of T1 plants were collected, and DNA was extracted using the Phire hot start PCR kit (Thermo Fisher). Primers F1 and R1 were used to PCR amplify DNA fragments containing the mutation region, and sequencing was performed to detect whether the mutation was homozygous. At the same time, primers CAS9-F (SEQ ID NO.8) and CAS9-R (SEQ ID NO.9) were used to detect whether Cas9 was present, and homozygous mutant lines without Cas9 were selected for continued planting. This method can ensure that all homozygous mutant plants do not contain exogenous gene insertions.

[0080] Reaction conditions: pre-denaturation at 98°C for 30 seconds; denaturation at 98°C for 5 seconds, annealing at 65°C for 5 seconds, extension at 72°C for 10 seconds, 40 cycles.

[0081] Primer sequences:

[0082] CAS9-F:CTTTGGCAATATCGTGGACG(SEQ ID NO.8);

[0083] CAS9-R:CGTTCTTCTTTCCCCAGGG (SEQ ID NO. 9).

[0084] Example 3. Statistics of fruit ripening time of mutant strains

[0085] For each homozygous mutant strain, the 2nd, 3rd, and 4th flower branches were selected, and 4 flowers were marked on each branch. On the day when the petals were fully unfolded, the flowers were marked and vibrated to assist pollination. The time required for the development of 12 flowers to the fruit breaking color was recorded to indicate the time required for maturity (days). Figure 4 As shown, T 1 The homozygous strains KO-1 and KO-2 were isolated in the first generation. The time (days) required for the fruits to break color was significantly shorter than that of the wild type. The fruits of the homozygous strains KO-1 and KO-2 broke color normally (Breaker) and turned completely red 7 days after breaking color (Br+7), which was no different from the wild type.

[0086] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of the reagent for blocking or attenuating the expression of the tomato Solyc03g118880 gene in any of the following aspects: Accelerate the ripening of tomato fruits; Preparation of a product for accelerating the ripening of tomato fruit.

2. The use according to claim 1, characterized in that: The reagent for blocking or weakening the expression of the tomato Solyc03g118880 gene includes at least one of a reagent for knocking down the Solyc03g118880 gene and a reagent for knocking out the Solyc03g118880 gene.

3. The use according to claim 2, characterized in that: The reagent for knocking down the Solyc03g118880 gene includes at least one reagent used in RNA interference technology, antisense RNA technology, CRISPR / Cas13 technology, target gene analog technology or short tandem target analog technology for the Solyc03g118880 gene; Preferably, the reagent for knocking out the Solyc03g118880 gene includes at least one reagent used in the giant nuclease technology, ZFN technology, TALEN technology, CRISPR / Cas gene knockout technology, homologous recombination technology, and random insertion mutagenesis technology for the Solyc03g118880 gene.

4. The use according to claim 3, characterized in that: The CRISPR / Cas gene knockout technology is CRISPR / Cas9 technology, and the guide RNA sequence used for CRISPR / Cas9 technology is shown in any one of SEQ ID NO.3-4.

5. A method for accelerating the ripening of tomato fruits, comprising: Block or weaken the expression of Solyc03g118880 gene in tomato cells; A tomato plant in which the expression of the Solyc03g118880 gene is blocked or weakened is developed or regenerated from the tomato cell.

6. The method according to claim 5, characterized in that The blocking or weakening of the expression of the Solyc03g118880 gene in tomato cells comprises at least one of knocking down the Solyc03g118880 gene and knocking out the Solyc03g118880 gene.

7. The method according to claim 6, characterized in that The knocking down of the Solyc03g118880 gene comprises knocking down the Solyc03g118880 gene by at least one of RNA interference technology, antisense RNA technology, CRISPR / Cas13 technology, target gene analog technology or short tandem target analog technology; Preferably, the knocking out of the Solyc03g118880 gene includes knocking out the Solyc03g118880 gene by at least one of meganuclease technology, ZFN technology, TALEN technology, CRISPR / Cas gene knockout technology, homologous recombination technology, and random insertion mutagenesis technology.

8. The method according to claim 7, characterized in that The CRISPR / Cas gene knockout technology is CRISPR / Cas9 technology, and the guide RNA sequence used for CRISPR / Cas9 technology is shown in any one of SEQ ID NO.3-4.

9. A method for obtaining a tomato plant, the method comprising obtaining a tomato plant in which the expression of the Solyc03g118880 gene is blocked or weakened using the method according to any one of claims 5 to 8; Preferably, the method further comprises hybridizing the tomato plants in which the expression of the Solyc03g118880 gene is blocked or weakened to obtain progeny plants; Preferably, the method further comprises selecting homozygous plants among the progeny plants.

10. A tomato plant obtained by the method of claim 9 or a part, seed, cell or progeny thereof.

Images