Lentivirus envelope modification method for improving NK cell transduction efficiency

Abstract

The invention relates to a lentivirus envelope modification method for improving NK cell transduction efficiency, and belongs to the technical field of cell transduction, and the lentivirus envelope modification method specifically comprises the following steps: S1, carrying out directional modification on an amino acid sequence of a key binding site of an envelope protein and a receptor by using a bioinformatics technology to obtain a modified envelope protein gene; s2, performing human codon preference optimization on the modified envelope protein coding sequence to obtain an optimized envelope protein gene; and inserting the optimized envelope protein gene into a lentivirus vector to construct a lentivirus packaging system for infecting a cell line. According to the invention, a bioinformatics technology is utilized to change a coded BaEV glycoprotein sequence to replace an envelope protein VSVG protein on the surface of a lentivirus, and a codon optimization and plasmid construction technology is combined, so that a nucleic acid sequence of the virus is changed into a sequence more suitable for human cell expression, and it is ensured that the modified virus vector has both high infection efficiency and safety.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell transduction, and in particular, relates to a lentiviral envelope modification method for improving NK cell transduction efficiency. Background Art

[0002] In the development of CAR-NK cell therapy, lentiviral vectors have become the mainstream tool due to their efficient gene integration ability and long-term expression characteristics. However, as a natural immune barrier, the low efficiency of viral transduction of NK cells has long restricted the clinical application of CAR-NK therapy.

[0003] In the prior art, the most widely used is the vesicular stomatitis virus envelope glycoprotein VSV-G enveloped lentivirus, whose receptor is the low-density lipoprotein receptor LDLR. However, the expression level of LDLR on the surface of NK cells is extremely low, resulting in a significant decrease in transduction efficiency. In addition, the VSV-G envelope may activate the pattern recognition receptors of NK cells, triggering an antiviral immune response, further reducing the transduction efficiency.

[0004] In summary, although the existing lentiviral envelope modification technology has made progress in improving the transduction efficiency of NK cells, it is still limited by the bottlenecks of transduction efficiency, safety and industrial production. Based on this, the present invention provides a lentiviral envelope modification method for improving the transduction efficiency of NK cells. Summary of the invention

[0005] In order to solve the problems raised in the background technology, the present invention provides a method for modifying the lentiviral envelope for improving the transduction efficiency of NK cells.

[0006] The purpose of the present invention can be achieved through the following technical solutions: A method for modifying the lentiviral envelope to improve NK cell transduction efficiency comprises the following steps: S1. Use bioinformatics technology to modify the amino acid sequence of the key binding site between the envelope protein and the receptor to obtain the modified envelope protein gene; The envelope protein is the baboon endogenous retrovirus envelope glycoprotein BaEV; S2. Optimize the human codon preference of the modified envelope protein coding sequence to obtain an optimized envelope protein gene; insert the optimized envelope protein gene into a lentiviral vector to construct a lentiviral packaging system for infecting a cell line; the cell line is a NK cell line or a primary NK cell.

[0007] Further preferably, a method for modifying the lentiviral envelope to improve the NK cell transduction efficiency comprises the following steps: S1. Screen the envelope protein corresponding to the natural ligand of the receptor highly expressed on the cell surface, determine the key binding site between the envelope protein and the receptor through molecular docking simulation analysis, and perform targeted amino acid sequence modification on the key binding site to obtain the modified envelope protein gene; The envelope protein is the baboon endogenous retrovirus envelope glycoprotein BaEV; S2. Optimize the human codon preference of the modified envelope protein coding sequence, use human codon preference to modify the nucleic acid sequence, optimize the codons, and obtain an optimized envelope protein gene; insert the optimized envelope protein gene into a lentiviral vector to replace the original envelope protein coding sequence, and construct a lentiviral packaging system for infecting a cell line; the cell line is a NK cell line or a primary NK cell.

[0008] Furthermore, in step S1, the key binding site is the amino acid sequence at positions 130-140 where BaEV binds to the receptor ASCT2.

[0009] Furthermore, in step S1, the directed modification specifically changes the amino acid SDVQVLGSTNK to LDVKVIGSSTR.

[0010] Furthermore, in step S1, the modified envelope protein gene sequence is specifically as shown in SEQ ID NO:1.

[0011] Furthermore, in step S2, the optimized envelope protein gene sequence is specifically as shown in SEQ ID NO:2.

[0012] Furthermore, in step S2, the specific operations for constructing the lentiviral packaging system are: S21, replacing the VSV-G sequence with the optimized envelope protein gene and constructing it into the pmd2g plasmid; connecting the CAR fragment after restriction digestion and the linearized PHIV-eGFP plasmid with T4 ligase to obtain the antiCD19-CAR-GFP recombinant plasmid; S22. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid obtained in step S21 are transferred into HEK293T cells. After culture, the lentivirus expressing the modified BaEV glycoprotein and CAR is collected to obtain a lentivirus packaging system.

[0013] Further preferably, in step S2, the specific operation of constructing the lentiviral packaging system is: S21, replacing the VSV-G sequence with the optimized envelope protein gene and constructing it into the pmd2g plasmid; digesting the CAR fragment and the linearized PHIV-eGFP plasmid with BamHI and XhoI restriction endonucleases at 37°C for 2 hours, respectively, and connecting the digested CAR fragment and the linearized PHIV-eGFP plasmid with T4 DNA ligase at 16°C for 24 hours, and optimizing the connection efficiency to CAR fragment: linearized PHIV-eGFP plasmid = 1:5, to obtain the antiCD19-CAR-GFP recombinant plasmid; S22. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid obtained in step S21 are transferred into HEK293T cells. After culture, the lentivirus expressing the modified BaEV glycoprotein and CAR is collected to obtain a lentivirus packaging system.

[0014] Furthermore, in step S21, the CAR fragment comprises a single-chain variable fragment anti-CD-19scFv targeting CD19, a CD8α hinge region (NCBI database NM_001768), a transmembrane region (NCBI database NM_007360.3), and a 2B4 cytoplasmic region (NCBI database NM_001166663.1).

[0015] Furthermore, in step S22, the specific operation of transferring the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid into HEK293T cells is as follows: The frozen HEK293T cells were revived and cultured for 12-24 hours for lentiviral packaging. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid were mixed, and then the transfection reagent was added to the system. After 5-7 hours of transfection, the medium was changed and cultured continuously. The system was precipitated overnight, and then centrifuged, filtered, purified, and stored for later use.

[0016] Further preferably, in step S22, the specific operation of transferring the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid into HEK293T cells is: The frozen HEK293T cells were placed in a 37°C water bath for 1-3 minutes, the cryopreserved tubes were sterilized and added to the pre-warmed complete growth medium, and lentivirus packaging was performed after culturing for 12-24 hours. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid were mixed, and then the transfection reagent was added to the system. The mass ratio of the transfection reagent to the total DNA amount was 3:1. After 6 hours of transfection, the medium was changed and cultured for 48 hours. The system was precipitated at 4°C overnight, and then centrifuged at 4000×g for 20 minutes, filtered using a 0.45μm filter, and the filtrate was concentrated and purified with lentivirus concentrate and stored at -80°C for later use.

[0017] Furthermore, in step S22, the mass ratio of pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid is (3-5):(2-4):3.

[0018] Beneficial effects of the present invention: In the technical solution of the present invention, the binding interface between BaEV envelope protein and ASCT2 is precisely located through molecular docking simulation and residue analysis. The ASCT2 targeting of BaEV envelope protein is significantly better than that of VSV-G's LDLR, overcoming the natural limitation of low LDLR expression in NK cells and achieving targeted transformation. Combining codon optimization and plasmid construction technology, taking human codon preference as a reference, the degeneracy of codons is used to change the nucleic acid sequence of the virus to a sequence more suitable for human cell expression, ensuring that the modified viral vector has both high infection efficiency and safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0020] Figure 1 This is the fluorescence intensity result of NK cells transduced by the lentiviral packaging vector prepared in Example 1 of the present invention.

[0021] Figure 2 This is the fluorescence intensity result of NK cells transduced by the lentiviral packaging vector prepared in Control Example 1 of the present invention.

[0022] Figure 3 The figure shows the picture of untransduced NK cells.

[0023] Figure 4 This is the positive rate test result of NK cell transduction by the lentiviral packaging vector prepared in Example 1 of the present invention.

[0024] Figure 5 This is the positive rate test result of NK cell transduction by the lentiviral packaging vector prepared in control 1 of the present invention.

[0025] Figure 6 This is the positive rate test result of non-transduced NK cells. DETAILED DESCRIPTION

[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] The specific implementation methods of this application involve: Transfection reagent: Thermo Fisher Lipofectamine 3000; Lentivirus concentrate: Heyuan Li Ji EZ Lentivirus concentrate.

[0028] Example 1 A method for modifying the lentiviral envelope to improve NK cell transduction efficiency comprises the following steps: S1. Screen the envelope protein corresponding to the natural ligand of the receptor highly expressed on the cell surface, determine the key binding site between the envelope protein and the receptor through molecular docking simulation analysis, and perform targeted amino acid sequence modification on the key binding site to obtain the modified envelope protein gene, the specific sequence of which is: Among them, the envelope protein is the baboon endogenous retrovirus envelope glycoprotein BaEV; The key binding site is the amino acid sequence at positions 130-140 where BaEV binds to the receptor ASCT2. Specifically, the amino acid SDVQVLGSTNK is changed to LDVKVIGSSTR, and reversely translated into ctggatgtgaaagtgattggcagcagcacccgc (specific sequence SEQ ID NO: 1); among them, the amino acid sequence before the change is shown in SEQ ID NO: 4, and the amino acid sequence after the change is shown in SEQ ID NO: 5.

[0029] S2. Optimize the human codon preference of the modified envelope protein coding sequence, modify the nucleic acid sequence using human codon preference, optimize the codons, and obtain an optimized envelope protein gene, the specific sequence of which is: Insert the optimized envelope protein gene into the lentiviral vector to replace the original envelope protein coding sequence, construct a lentiviral packaging system, and use it to infect cell lines. The specific operations are as follows: S21, replacing the VSV-G sequence with the optimized envelope protein gene and constructing it into the pmd2g plasmid; digesting the CAR fragment and the linearized PHIV-eGFP plasmid with BamHI and XhoI restriction endonucleases at 37°C for 2 hours, respectively, and connecting the digested CAR fragment and the linearized PHIV-eGFP plasmid with T4 DNA ligase at 16°C for 24 hours, and optimizing the connection efficiency to CAR fragment: linearized PHIV-eGFP plasmid = 1:5, to obtain the antiCD19-CAR-GFP recombinant plasmid; S22, the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid obtained in step S21 are transferred into HEK293T cells, and the lentivirus expressing the modified BaEV glycoprotein and CAR is collected after culture to obtain a lentivirus packaging system. The specific operation is as follows: The frozen HEK293T cells were placed in a 37°C water bath for 1-3 minutes, the cryopreserved tubes were sterilized and added to the pre-warmed complete growth medium, and lentivirus packaging was performed after culturing for 12-24 hours. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid were mixed in a mass ratio of 4:3:3, and then the transfection reagent was added to the system. The mass ratio of the transfection reagent to the total DNA amount was 3:1. After 6 hours of transfection, the medium was changed and cultured for another 48 hours. The system was precipitated at 4°C overnight, and then centrifuged at 4000×g for 20 minutes, filtered using a 0.45μm filter, and the filtrate was concentrated and purified with a lentivirus concentrate and stored at -80°C for later use.

[0030] Comparative Example 1 The difference between this control example and Example 1 is that the sequence of the wild-type BAEV protein is used to construct the lentiviral packaging system. The specific sequence of the wild-type BAEV protein is:

[0031] The primary NK cells were transduced using the lentiviral packaging system prepared in Example 1 and Control Example 1, and the primary NK cells after virus transduction were detected by cell immunofluorescence and flow cytometry. The specific operations were as follows: the 24-well plate was taken out from the incubator, and the cells were transferred to a 1.5 mL centrifuge tube; the EP tube was marked, and 1 mL of PBS solution was added to each EP tube and mixed; the supernatant was discarded after centrifugation at 300 rpm for 6 minutes, and 1 mL of solution was added again to mix; the supernatant was discarded after centrifugation at 300 rpm for 6 minutes, and 200 uL PBS was added to the transduced cells to form a cell solution; each sample was detected by a Cytek NL-CLC flow cytometer in a flow tube, and the cell solution was mixed by a dot motion, and then tested on the machine to obtain the positive rate of different virus transductions. The specific results are shown as follows: Figure 1-Figure 6 shown.

[0032] Depend on Figure 1-Figure 3 The results show that the fluorescence intensity of NK cells transduced by the lentiviral packaging system prepared using the modified and optimized BaEV envelope protein gene is higher than that of the wild-type BaEV protein virus transduction result, indicating that the modified and optimized BaEV envelope protein has a higher transduction efficiency.

[0033] Depend on Figure 4-Figure 6 The results show that the GFP positive rate of NK cells transduced by the modified and optimized BaEV envelope protein virus detected by flow cytometry is higher than that of wild-type BaEV protein virus transduction, indicating that the modified and optimized BaEV envelope protein virus has higher transduction efficiency.

[0034] In the description of the specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0035] The above contents are merely examples and explanations of the concept of the present invention. The technicians in this technical field may make various modifications or additions to the specific embodiments described or replace them in a similar manner. As long as they do not deviate from the concept of the invention or exceed the scope defined by the claims, they should all fall within the protection scope of the present invention.

Claims

1. A method for modifying the lentiviral envelope to improve NK cell transduction efficiency, characterized in that: The specific steps include: S1. Use bioinformatics technology to modify the amino acid sequence of the key binding site between the envelope protein and the receptor to obtain the modified envelope protein gene; The envelope protein is the baboon endogenous retrovirus envelope glycoprotein BaEV; S2. Optimize the human codon preference of the modified envelope protein coding sequence to obtain an optimized envelope protein gene; insert the optimized envelope protein gene into a lentiviral vector to construct a lentiviral packaging system for infecting a cell line; the cell line is a NK cell line or a primary NK cell.

2. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 1, characterized in that: In step S1, the key binding site is the amino acid sequence at positions 130-140 where BaEV binds to the receptor ASCT2.

3. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 1, characterized in that: In step S1, the directed modification specifically changes the amino acid sequence SDVQVLGSTNK to LDVKVIGSSTR.

4. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 1, characterized in that: In step S1, the modified envelope protein gene sequence is specifically shown as SEQ ID NO:

1.

5. The method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 1, characterized in that: In step S2, the optimized envelope protein gene sequence is specifically shown as SEQ ID NO:

2.

6. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 1, characterized in that: In step S2, the specific operations for constructing the lentiviral packaging system are as follows: S21, replacing the VSV-G sequence with the optimized envelope protein gene and constructing it into the pmd2g plasmid; connecting the CAR fragment after restriction digestion and the linearized PHIV-eGFP plasmid with T4 ligase to obtain the antiCD19-CAR-GFP recombinant plasmid; S22. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid obtained in step S21 are transferred into HEK293T cells. After culture, the lentivirus expressing the modified BaEV glycoprotein and CAR is collected to obtain a lentivirus packaging system.

7. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 6, characterized in that: In step S21, the CAR fragment comprises a single-chain variable fragment anti-CD-19scFv targeting CD19, a CD8α hinge region, a transmembrane region, and a 2B4 cytoplasmic region.

8. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 6, characterized in that: In step S22, the specific operation of transferring the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid into HEK293T cells is as follows: The frozen HEK293T cells were revived and cultured for 12-24 hours for lentiviral packaging. The pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid were mixed, and then the transfection reagent was added to the system. After 5-7 hours of transfection, the medium was changed and cultured continuously. The system was precipitated overnight, and then centrifuged, filtered, purified, and stored for later use.

9. A method for modifying the lentiviral envelope for improving NK cell transduction efficiency according to claim 6, characterized in that: In step S22, the mass ratio of pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid is (3-5):(2-4):3.

Images