A method for modifying the envelope of lentivirus to improve the transduction efficiency of NK cells
Through directed modification of envelope proteins and receptor binding sites and codon optimization, baboon endogenous retroviral envelope glycoprotein BaEV was modified, and a lentiviral packaging system was constructed, which solved the problem of low transduction efficiency of NK cells and achieved efficient and safe NK cell transduction.
Patent Information
- Application Number
- CN202510512376.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-04-23
AI Technical Summary
The inefficient viral transduction of NK cells leads to the limitation of clinical application of CAR-NK therapy. The existing lentiviral envelope modification technology has bottlenecks in improving transduction efficiency, safety and industrial production.
Through bioinformatics technology, the key binding sites of envelope proteins and receptors are directed and combined with the optimization of human codon preferences, the endogenous retroviral envelope glycoprotein BaEV of baboons is modified to construct a lentiviral packaging system for infecting NK cells.
It significantly improves the transduction efficiency and safety of NK cells, overcomes the limitation of low expression of LDLR in NK cells, and achieves a balance between high infection efficiency and safety.
Smart Images

Figure CN120026060B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of cell transduction, and specifically relates to a method for modifying the envelope of lentivirus to improve the transduction efficiency of NK cells. Background Art
[0002] In the development of CAR-NK cell therapy, lentiviral vectors have become the mainstream tool due to their efficient gene integration ability and long-term expression characteristics. However, as a natural immune barrier, NK cells have long been restricted in their clinical application of CAR-NK therapy by the problem of low viral transduction efficiency.
[0003] In the prior art, the vesicular stomatitis virus envelope glycoprotein VSV-G envelope lentivirus is widely used, and its receptor is the low-density lipoprotein receptor LDLR. However, the expression level of LDLR on the surface of NK cells is extremely low, resulting in a significant decrease in transduction efficiency. In addition, the VSV-G envelope may activate the pattern recognition receptors of NK cells, triggering an antiviral immune response and further reducing the transduction efficiency.
[0004] In summary, although the existing lentiviral envelope modification technologies have made progress in improving the transduction efficiency of NK cells, they are still limited by the bottlenecks of transduction efficiency, safety, and industrial production. Based on this, the present invention provides a method for modifying the envelope of lentivirus to improve the transduction efficiency of NK cells. Summary of the Invention
[0005] In order to solve the problems raised in the background art, the present invention provides a method for modifying the envelope of lentivirus to improve the transduction efficiency of NK cells.
[0006] The object of the present invention can be achieved by the following technical solutions:
[0007] A method for modifying the envelope of lentivirus to improve the transduction efficiency of NK cells specifically includes the following steps:
[0008] S1. Using bioinformatics technology to directionally modify the amino acid sequence of the key binding site between the envelope protein and the receptor to obtain a modified envelope protein gene;
[0009] The envelope protein is baboon endogenous retrovirus envelope glycoprotein BaEV;
[0010] S2. Optimizing the coding sequence of the modified envelope protein according to human codon preference to obtain an optimized envelope protein gene; inserting the optimized envelope protein gene into a lentiviral vector to construct a lentiviral packaging system for infecting a cell line; the cell line is an NK cell line or primary NK cells.
[0011] Further preferably, a method for modifying the envelope of lentivirus to improve the transduction efficiency of NK cells specifically includes the following steps:
[0012] S1. Screen the envelope proteins corresponding to the natural ligands of receptors highly expressed on the cell surface, determine the key binding sites between the envelope proteins and the receptors through molecular docking simulation analysis, and perform directed amino acid sequence modification on the key binding sites to obtain a modified envelope protein gene;
[0013] The envelope protein is baboon endogenous retrovirus envelope glycoprotein BaEV;
[0014] S2. Optimize the coding sequence of the modified envelope protein according to human codon preference, modify the nucleic acid sequence using human codon preference, optimize the codons to obtain an optimized envelope protein gene; insert the optimized envelope protein gene into a lentiviral vector to replace the original envelope protein coding sequence, and construct a lentiviral packaging system for infecting cell lines; the cell lines are NK cell lines or primary NK cells.
[0015] Further, in step S1, the key binding site is the amino acid sequence at positions 130 - 140 at the binding site between BaEV and the receptor ASCT2.
[0016] Further, in step S1, the directed modification specifically changes the amino acids SDVQVLGSTNK to LDVKVIGSSTR.
[0017] Further, in step S1, the sequence of the modified envelope protein gene is specifically as shown in SEQ ID NO:1.
[0018] Further, in step S2, the sequence of the optimized envelope protein gene is specifically as shown in SEQ ID NO:2.
[0019] Further, in step S2, the specific operation for constructing the lentiviral packaging system is as follows:
[0020] S21. Replace the VSV - G sequence with the optimized envelope protein gene and construct it into the pmd2g plasmid; ligate the digested CAR fragment and the linearized PHIV - eGFP plasmid with T4 ligase to obtain an antiCD19 - CAR - GFP recombinant plasmid;
[0021] S22. Transfer the pmd2g plasmid, antiCD19 - CAR - GFP recombinant plasmid and shutter plasmid obtained in step S21 into HEK293T cells, and collect the lentivirus expressing the modified BaEV glycoprotein and CAR after culture to obtain a lentiviral packaging system.
[0022] More preferably, in step S2, the specific operation for constructing the lentiviral packaging system is as follows:
[0023] S21. Replace the VSV-G sequence with the optimized envelope protein gene and construct it into the pmd2g plasmid; digest the CAR fragment and the linearized PHIV-eGFP plasmid with BamHI and XhoI restriction endonucleases at 37°C for 2 hours, and ligate the digested CAR fragment and the linearized PHIV-eGFP plasmid with T4 DNA ligase at 16°C for 24 hours. Optimize the ligation efficiency to CAR fragment:linearized PHIV-eGFP plasmid = 1:5 to obtain the antiCD19-CAR-GFP recombinant plasmid.
[0024] S22. Transfer the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid, and shutter plasmid obtained in step S21 into HEK293T cells, and collect the lentivirus expressing the modified BaEV glycoprotein and CAR after culture to obtain a lentiviral packaging system.
[0025] Further, in step S21, the CAR fragment contains the single-chain variable fragment anti-CD-19scFv targeting CD19, the CD8α hinge region (NCBI database NM_001768), the transmembrane region (NCBI database NM_007360.3), and the 2B4 cytoplasmic region (NCBI database NM_001166663.1).
[0026] Further, in step S22, the specific operation of transferring the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid, and shutter plasmid into HEK293T cells is as follows:
[0027] Resuscitate the cryopreserved HEK293T cells and culture them for 12 - 24 hours for lentiviral packaging; mix the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid, and shutter plasmid, then add a transfection reagent to the system. After transfection for 5 - 7 hours, change the medium and continue culturing. Let the system precipitate overnight, then centrifuge, filter, and purify it for storage for later use.
[0028] Further preferably, in step S22, the specific operation of transferring the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid, and shutter plasmid into HEK293T cells is as follows:
[0029] Place the cryopreserved HEK293T cells in a 37°C water bath for 1 - 3 minutes. After sterilizing the cryotube, add it to the pre-warmed complete growth medium. After culturing for 12 - 24 hours, perform lentivirus packaging. Mix the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid, and shutter plasmid, and then add a transfection reagent to the system. The mass ratio of the transfection reagent to the total DNA amount is 3:1. After transfection for 6 hours, change the medium and continue culturing for 48 hours. Precipitate the system overnight at 4°C, then centrifuge at 4000×g for 20 minutes, filter using a 0.45μm filter, and concentrate and purify the filtrate with lentivirus concentrate. Store at -80°C for later use.
[0030] Further, in step S22, the mass ratio of the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid, and shutter plasmid is (3 - 5):(2 - 4):3.
[0031] Advantages of the present invention:
[0032] In the technical solution of the present invention, through molecular docking simulation and residue analysis, the binding interface between the BaEV envelope protein and ASCT2 is accurately located. The ASCT2 targeting of the BaEV envelope protein is significantly better than that of the LDLR of VSV-G, overcoming the natural limitation of low LDLR expression in NK cells and achieving directional modification. Combining codon optimization and plasmid construction techniques, using the human codon preference as a reference and utilizing the degeneracy of codons to change the nucleic acid sequence of the virus into a sequence more suitable for human cell expression, ensuring that the modified virus vector has both high infection efficiency and safety. Description of the Drawings
[0033] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0034] Figure 1 It is the fluorescence intensity result of the lentivirus packaging vector prepared in Example 1 of the present invention transducing NK cells.
[0035] Figure 2 It is the fluorescence intensity result of the lentivirus packaging vector prepared in Control Example 1 of the present invention transducing NK cells.
[0036] Figure 3 It is a picture of untransduced NK cells.
[0037] Figure 4 It is the detection result of the positive rate of the lentivirus packaging vector prepared in Example 1 of the present invention transducing NK cells.
[0038] Figure 5 This is the detection result of the positive rate of lentiviral packaging vector transduction of NK cells prepared in Control 1 of the present invention.
[0039] Figure 6 This is the detection result of the positive rate of untransduced NK cells. Specific implementation manners
[0040] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts shall fall within the protection scope of the present invention.
[0041] Those involved in the specific implementation manners of the present application:
[0042] Transfection reagent: Thermo Fisher Lipofectamine 3000; Lentivirus concentrate: Heyuan LiJi EZ Lentivirus Concentrate.
[0043] Example 1
[0044] A method for modifying the lentiviral envelope to improve the transduction efficiency of NK cells specifically includes the following steps:
[0045] S1. Screen the envelope protein corresponding to the natural ligand with high expression of the receptor on the cell surface, determine the key binding site between the envelope protein and the receptor through molecular docking simulation analysis, and perform directed amino acid sequence modification on the key binding site to obtain the modified envelope protein gene, and the sequence is specifically:
[0046]
[0047] Among them, the envelope protein is the baboon endogenous retrovirus envelope glycoprotein BaEV;
[0048] The key binding site is the amino acid sequence at positions 130-140 where BaEV binds to the receptor ASCT2. Specifically, the amino acids SDVQVLGSTNK are changed to LDVKVIGSSTR, and the reverse translation is ctggatgtgaaagtgattggcagcagcacccgc (specific sequence SEQ ID NO:1); among them, the amino acid sequence before the change is as shown in SEQ ID NO:4, and the amino acid sequence after the change is as shown in SEQ ID NO:5.
[0049] S2. Optimize the coding sequence of the modified envelope protein for human codon preference, modify the nucleic acid sequence using human codon preference, and optimize the codons to obtain the optimized envelope protein gene. The specific sequence is:
[0050]
[0051] The optimized envelope protein gene was inserted into the lentiviral vector to replace the original envelope protein coding sequence, and a lentiviral packaging system was constructed for infecting cell lines. The specific operation is as follows:
[0052] S21. Replace the VSV-G sequence with the optimized envelope protein gene and construct it into the pmd2g plasmid; Digest the CAR fragment and the linearized PHIV-eGFP plasmid with BamHI and XhoI restriction endonucleases at 37°C for 2 hours respectively. Then ligate the digested CAR fragment and the linearized PHIV-eGFP plasmid with T4 DNA ligase at 16°C for 24 hours. Optimize the ligation efficiency to CAR fragment:linearized PHIV-eGFP plasmid = 1:5 to obtain the antiCD19-CAR-GFP recombinant plasmid;
[0053] S22. Transfer the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid obtained in step S21 into HEK293T cells. After culturing, collect the lentivirus expressing the modified BaEV glycoprotein and CAR to obtain the lentiviral packaging system. The specific operation is as follows:
[0054] Place the cryopreserved HEK293T cells in a 37°C water bath for 1 - 3 minutes. After sterilizing the cryotube, add it to the pre-warmed complete growth medium and culture for 12 - 24 hours before lentiviral packaging. Mix the pmd2g plasmid, antiCD19-CAR-GFP recombinant plasmid and shutter plasmid according to a mass ratio of 4:3:3. Then add a transfection reagent to the system, and the mass ratio of the transfection reagent to the total DNA amount is 3:1. After transfection for 6 hours, change the medium and continue culturing for 48 hours. Precipitate the system overnight at 4°C, then centrifuge at 4000×g for 20 minutes, filter using a 0.45μm filter, and concentrate and purify the filtrate with a lentivirus concentrate, and store it at -80°C for later use.
[0055] Control Example 1
[0056] The difference between this control example and Example 1 is that a lentiviral packaging system was constructed using the sequence of wild-type BAEV protein. The specific sequence of wild-type BAEV protein is:
[0057]
[0058] Now, the primary NK cells were transduced using the lentiviral packaging systems prepared in Example 1 and Control Example 1, and the primary NK cells after virus transduction were detected by cellular immunofluorescence and flow cytometry. The specific operation was as follows: Take out the 24-well plate from the incubator, and transfer the cells to a 1.5 mL centrifuge tube; Label the EP tubes, and add 1 mL of PBS solution to each EP tube and mix well; Use a centrifuge to centrifuge at a rate of 300 rpm for 6 minutes, then discard the supernatant, and add 1 mL of solution again and mix well; Use the centrifuge to centrifuge at a rate of 300 rpm for 6 minutes again, discard the supernatant, and add 200 uL of PBS, and add the transduced cells to form a cell solution; Detect each sample using a Cytek NL-CLC flow cytometer in a flow tube. After gently mixing the cell solution, load it onto the machine for detection to obtain the positive rates of different virus transductions. The specific results are as Figures 1-6 shown.
[0059] From Figures 1-3 the results in, it can be seen that for the lentiviral packaging system prepared using the genetically modified and optimized BaEV envelope protein gene, the fluorescence intensity of the NK cells transduced by it is higher than that of the wild-type BaEV protein virus transduction result, indicating that the transduction efficiency of the genetically modified and optimized BaEV envelope protein is higher.
[0060] From Figures 4-6 the results in, it can be seen that the proportion of GFP positive rate detected by flow cytometry for the NK cells transduced by the genetically modified and optimized BaEV envelope protein virus is higher than that of the wild-type BaEV protein virus transduction result, indicating that the transduction efficiency of the genetically modified and optimized BaEV envelope protein virus is higher.
[0061] In the description of the specification, the description referring to terms such as "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in connection with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in a suitable manner in any one or more embodiments or examples.
[0062] The above content is only an example and illustration of the concept of the present invention. Those skilled in the art of this technology can make various modifications or supplements to the specific embodiments described or use similar methods to substitute, as long as they do not deviate from the concept of the invention or exceed the scope defined by this claim book, they should all fall within the protection scope of the present invention.
Claims
1. A lentiviral envelope modification method for improving the transduction efficiency of NK cells, characterized in that, Specifically, it includes the following steps: S1. Use bioinformatics technology to perform directed modification on the amino acid sequence of the key binding site between the envelope protein and the receptor to obtain a modified envelope protein gene; the directed modification specifically changes the amino acid sequence SDVQVLGSTNK to LDVKVIGSSTR, and the specific sequence of the modified envelope protein gene is as shown in SEQ ID NO:1; The envelope protein is the baboon endogenous retrovirus envelope glycoprotein BaEV; S2. Optimize the coding sequence of the modified envelope protein according to human codon preference to obtain an optimized envelope protein gene; insert the optimized envelope protein gene into a lentiviral vector to construct a lentiviral packaging system for infecting cell lines; the cell lines are NK cell lines or primary NK cells.
2. The lentiviral envelope modification method for improving the transduction efficiency of NK cells according to claim 1, characterized in that, In step S1, the key binding site is the amino acid sequence at positions 130 - 140 where BaEV binds to the receptor ASCT2.
3. The lentiviral envelope modification method for improving the transduction efficiency of NK cells according to claim 1, characterized in that In step S2, the specific sequence of the optimized envelope protein gene is as shown in SEQ ID NO:
2.
4. A lentiviral envelope modification method for improving the transduction efficiency of NK cells according to claim 1, characterized in that, In step S2, the specific operation for constructing the lentiviral packaging system is as follows: S21. Replace the VSV - G sequence with the optimized envelope protein gene and construct it into the pmd2g plasmid; ligate the digested CAR fragment and the linearized PHIV - eGFP plasmid with T4 ligase to obtain an antiCD19 - CAR - GFP recombinant plasmid; S22. Transfer the pmd2g plasmid, antiCD19 - CAR - GFP recombinant plasmid, and shutter plasmid obtained in step S21 into HEK293T cells. After culturing, collect the lentivirus expressing the modified BaEV glycoprotein and CAR to obtain the lentiviral packaging system.
5. A lentiviral envelope modification method for improving the transduction efficiency of NK cells according to claim 4, characterized in that, In step S21, the CAR fragment contains a single - chain variable fragment anti - CD - 19scFv targeting CD19, a CD8α hinge region, a transmembrane region, and a 2B4 cytoplasmic region.
6. A lentiviral envelope modification method for improving the transduction efficiency of NK cells according to claim 4, characterized in that, In step S22, the specific operation for transferring the pmd2g plasmid, antiCD19 - CAR - GFP recombinant plasmid, and shutter plasmid into HEK293T cells is as follows: Resuscitate the cryopreserved HEK293T cells and culture them for 12 - 24 hours for lentiviral packaging; mix the pmd2g plasmid, antiCD19 - CAR - GFP recombinant plasmid, and shutter plasmid, then add a transfection reagent to the system. After transfection for 5 - 7 hours, change the medium and continue culturing. Let the system precipitate overnight, then centrifuge, filter, and purify for storage for later use.
7. A lentiviral envelope modification method for improving the transduction efficiency of NK cells according to claim 4, characterized in that, In step S22, the mass ratio of the pmd2g plasmid, antiCD19 - CAR - GFP recombinant plasmid, and shutter plasmid is (3 - 5):(2 - 4):3.
Citation Information
Patent Citations
Method for improving NK cell lentivirus transduction efficiency
CN115820742A
Method for efficiently infecting human natural killer cells and other immune cells with pseudovirus
US20250018035A1