Method for identifying synchronous methane and nitrous oxide co-sink in anaerobic environment

Abstract

The invention discloses a method for indicating and identifying synchronous methane anaerobic sink and nitrous oxide sink by a decoupling relation of denitrifying anaerobic methane oxidation microorganisms, and relates to the field of environmental ecology, and the method comprises the following steps: collecting an environmental sample from a sampling point; extracting DNA (deoxyribonucleic acid); carrying out 16S rRNA cloning and full-length 16S rRNA sequencing, and carrying out real-time quantitative PCR (Polymerase Chain Reaction) analysis by using a specific primer. The method is used for indicating the decoupling relation of denitrifying anaerobic methane oxidation microorganisms and judging whether coupled methane oxidation and nitrous oxide reduction exist or not. The invention provides a method for indicating and identifying synchronous methane anaerobic convergence and nitrous oxide convergence by a decoupling relation of denitrifying anaerobic methane oxidation microorganisms, and a method for quickly judging greenhouse gas emission reduction characteristics possibly existing in an environment and a possible microbial metabolism path is constructed.

Description

Technical Field

[0001] The present invention relates to the field of environmental ecology, and in particular to a method for identifying synchronous anaerobic methane sinks and nitrous oxide sinks by indicating the decoupling relationship of denitrifying anaerobic methane oxidizing microorganisms. Background Art

[0002] Methane (CH 4 ) and nitrous oxide (N 2 O) are powerful greenhouse gases. The global warming potential of these two gases over a 100-year period is respectively 2 ) are 34 and 298 times higher than those of the previous studies. As the research progresses, it is found that under anaerobic conditions, methane oxidation can be accompanied by the simultaneous reduction of nitrous oxide, and the electron acceptor of the anaerobic methane oxidation (AOM) process can be extended to N 2 O, that is, AOM coupling N 2 O reduction. This means that we need to further clarify the relationship between the realization of this process and functional microorganisms.

[0003] Anaerobic methanotrophic archaea (ANME) are a group of bacteria that use nitrate (NO 3 - ), nitrite (NO 2 - ), sulfate (SO 4 2- ), iron (Fe(Ⅲ)), etc. are electron acceptors, CH 4 Methane-oxidizing microorganisms are electron donors. The realization of their methane oxidation process is often coupled with nitrate, nitrite reduction, sulfate reduction, etc. Among the methane oxidation processes combined with the nitrogen cycle, the most in-depth research is on the nitrate-driven anaerobic methane oxidation process, that is, a type of microorganism in the ANME-2d cluster of the ANME cluster evolutionary branch, named "Candidatus Methanoperedensnitroreducens (Candidatus M.nitroreducens)", which converts CH 4 Oxidation to CO 2 , while NO 3 - Nitrate is reduced to NO by catalysis of nitrate reductase (narH and narG) 2 -The commonly associated anaerobic methane-oxidizing bacteria are a type of bacteria belonging to the phylum NC10, named "Candidatus Methylomirabilis oxyfera (M.oxyfera). Its methane metabolism pathway is to complete methane oxidation through an endogenous oxygen production mechanism under the action of particulate methane monooxygenase (pMMO), while NO 2 - Nitrite is reduced to NO under the catalysis of nitrite reductase (nirSJFD / GH / L), and NO is further converted to oxygen (O) through the dismutation reaction under the action of NO dismutase (Nod). 2 ) and nitrogen (N 2 ), O 2 Used for methane oxidation. With the exploration of the metabolic process of ANME-2d, many different types of protein complexes and a large number of c-type cytochromes are involved in the metabolic pathway of ANME-2d. These proteins have been shown to be important electron carriers and play the role of ANME electron transfer. More and more evidence shows that ANME-2d can cooperate with denitrifying bacteria, Geobacter, iron-reducing bacteria, etc. through the extracellular electron transfer pathway to complete processes including nitrous oxide reduction, anaerobic ammonia oxidation, and organic matter reduction. What is usually observed is the decoupling phenomenon of ANME-2d and NC10, that is, the expansion and proliferation of ANME-2d does not occur while the expansion and proliferation of NC10 occurs.

[0004] Current research suggests that N 2 The reduction of O is achieved by typical denitrifying bacteria, 2 O is reduced to N by nitrous oxide reductase (nosZ). 2 . However, there is evidence that methane oxidation in anaerobic environments is coupled to N 2 The O reduction process is generally considered to be a cooperative pathway between methane oxidizing microorganisms and denitrifying microorganisms. However, how to identify the possible existence of AOM-coupled N 2 Therefore, clarifying the community changes corresponding to different metabolic pathways of microorganisms involved in the greenhouse gas sink process in different environments is conducive to quickly judging environmental characteristics and greenhouse gas emission characteristics.

[0005] Therefore, technicians in this field are committed to developing a method for clarifying the decoupling relationship of denitrifying anaerobic methane oxidizing microorganisms and determining whether there is coupled methane oxidation and nitrous oxide reduction by identifying the relative abundance or gene expression profiles of anaerobic methane oxidizing archaea and bacteria. Summary of the invention

[0006] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to develop a method for clarifying the decoupling relationship of denitrifying anaerobic methane oxidizing microorganisms and determining whether there is coupled methane oxidation and nitrous oxide reduction by identifying the relative abundance or gene expression profiles of anaerobic methane oxidizing archaea and bacteria.

[0007] To achieve the above object, the present invention provides a method for identifying the relative abundance or gene expression profile of anaerobic methane-oxidizing archaea and bacteria, comprising the following steps:

[0008] Step 1: Collect environmental samples from sampling points;

[0009] Step 2, extracting DNA from the sample obtained in step 1;

[0010] Step 3: The DNA obtained in step 2 is subjected to 16S rRNA cloning and total bacterial 16S rRNA sequencing, and real-time quantitative PCR analysis is performed using specific primers.

[0011] Furthermore, the environmental samples in step 1 include river sediments and soil.

[0012] Furthermore, collect environmental samples (taking river sediments as an example), transport them to the laboratory as quickly as possible at low temperature (transported with ice packs), remove large stones and debris, and transfer them to 100mL anaerobic bottles for short-term incubation experiments (set up at least three parallel samples and one control sample). If it is a soil sample, you can directly proceed to step 3;

[0013] Furthermore, the river sediments need to be transferred into anaerobic bottles for short-term incubation experiments: The steps of the short-term incubation experiment are as follows:

[0014] Step 1), weighing sediment into an anaerobic bottle, adding culture solution, replacing the headspace gas of the anaerobic bottle with nitrogen to ensure anaerobic conditions, and then replacing the nitrogen in the headspace of the anaerobic bottle with standard gas to obtain a replaced anaerobic bottle; the standard gas is 85% methane, 10% nitrous oxide and 5% carbon dioxide.

[0015] Step 2), the anaerobic bottle replaced in step 1) is placed in an air bath shaker at 25°C and 150 rpm for incubation for 15 days.

[0016] Furthermore, the anaerobic bottle is 100 mL, the culture solution is 50 mL, and the standard gas is 20 mL.

[0017] Furthermore, the culture solution is the original water sample at the sampling point, and the culture solution should also include the following components:

[0018] The components of each liter of culture medium are: KH 2 PO 4 , 0.075 g; CaCl 2·2H 2 O, 0.300 g; MgCl 2 6H 2 O, 0.165g; alkaline trace element solution, 0.2mL; acidic trace element solution, 0.5mL.

[0019] Furthermore, the alkaline trace element solution contains 10 mM NaOH, and each liter of the alkaline trace element solution contains SeO 2 , 0.067g; Na 2 WO 4 ·2H 2 O, 0.050g; Na 2 MoO 4 , 0.242g.

[0020] The acidic trace element solution contains 100 mM HCl and each liter of the acidic trace element solution contains FeSO 4 7H 2 O, 5.560 g; ZnSO 4 7H 2 O, 0.068 g; CoCl 2 6H 2 O, 0.120 g; MnCl 2 ·4H 2 O, 0.500g; CuSO 4 , 1.600g; NiCl 2 6H2O, 0.095g; H 3 BO 3 , 0.014g.

[0021] Furthermore, the incubation medium must be deoxygenated with nitrogen.

[0022] Furthermore, the culture medium for the incubation experiment should be selected from the original water sample at the sampling point, transported to the laboratory at low temperature for ultraviolet disinfection and stored at 4°C for use. The culture medium of the control group uses simulated water, that is, ultrapure water for laboratory use, and the added components are consistent with the added components of the incubation culture medium.

[0023] Further, about 20 g of sediment was weighed into an anaerobic bottle, 50 mL of culture solution was added, and the gas in the headspace of the anaerobic bottle was replaced with nitrogen to ensure anaerobic conditions, and then the nitrogen in the headspace of the 20 mL anaerobic bottle was replaced with standard gas with a gas ratio of 85% methane, 10% nitrous oxide and 5% carbon dioxide.

[0024] Furthermore, the primers used for 16S rRNA cloning in step 3 are total bacterial 16S RNA amplification primers 926F and 1392R, the nucleotide sequence of primer 926F is: AAACTYAAAKGAATTGRCGG; the nucleotide sequence of primer 1392R is: ACGGGCGGTGWGTRC.

[0025] Further, the specific primers in step 3 are primer ANME-mcrA for anaerobic methane-oxidizing archaea and primers NC10-pmoA and NC10-nod for anaerobic methane-oxidizing bacteria; primer ANME-mcrA is McrA159F and McrA345R; the nucleotide sequence of primer McrA159F is: ACGGGCGGTGWGTRC; the nucleotide sequence of primer McrA345R is: TCGTCCCATTCCTGCTGCATTGC; primer NC10-pmoA is A189-bF and Cmo682R; the nucleotide sequence of primer A189-bF is: GGNGACTGGGACTTYTGG; the nucleotide sequence of primer Cmo682R is: AAAYCCGGCRAAGAACGA; primer NC10-nod is nodM1432F and nodM1884R, the nucleotide sequence of primer nodM1432F is: TTCCGCGCKGTSAAGCCSTG; the nucleotide sequence of primer nodM1884R is: MCGCTCCGTCSGCATCTTCC.

[0026] Furthermore, if conditions permit, four sediment samples can be extracted, DNA can be extracted, metagenomic and metatranscriptomic sequencing can be performed, metagenomic assembly, binning and genome analysis can be performed on the metagenomic sequencing results, and transcriptome analysis can be performed on the metatranscriptomic sequencing results, and step five can be omitted.

[0027] The present invention also provides a method for identifying the relative abundance or gene expression profile of anaerobic methane-oxidizing archaea and bacteria, which is applied to indicate the decoupling relationship of denitrifying anaerobic methane-oxidizing microorganisms.

[0028] The present invention also provides a method for identifying the relative abundance or gene expression profile of anaerobic methane-oxidizing archaea and bacteria, which is applied to determine whether coupled methane oxidation and nitrous oxide reduction exist.

[0029] In a preferred embodiment of the present invention, methods and applications for identifying the relative abundance or gene expression profiles of anaerobic methane-oxidizing archaea and bacteria are described in detail.

[0030] The beneficial technical effects of the present invention are as follows:

[0031] The present invention innovatively uses the indicator function of anaerobic methane-oxidizing archaea (ANME-2d), combines the community differences of functional microorganisms in different environments and the existence characteristics of associated microorganisms, and determines whether there is AOM-coupled NC10 in the environment by identifying the difference in the relative abundance of ANME-2d and NC10 or the typical gene copy number. 2 The O reduction process and the cooperation form of anaerobic methane-oxidizing archaea and denitrifying bacteria can be quickly determined to quickly identify the microbial metabolic pathways that may exist as greenhouse gas sinks. The substrate-symbiotic anaerobic methane-oxidizing microorganisms (ANME and NC10) are decoupled, and the anaerobic methane-oxidizing archaea strengthen their cooperation with denitrifying microorganisms through extracellular electron transfer, quickly identifying the phenomenon of greenhouse gas co-sinking in the environment, and at the same time determining the metabolic mechanism of the microorganisms.

[0032] By making more judgments on the co-sinking of methane and nitrous oxide in the environment, we can find more conditions for greenhouse gas emission control, strengthen the research on greenhouse gas emission control technologies, and derive more ecological and environmental governance technologies that are conducive to greenhouse gas emission control.

[0033] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is a preferred embodiment of the present invention that the relative abundance of microorganisms in the sample by 16sRNA sequencing function and the gene copy number obtained by quantitative PCR analysis;

[0035] Figure 2 It is a sketch of the gene expression difference of ANME-2d and NC10 in a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0036] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0037] Example 1: Methods and applications for identifying relative abundance or gene expression profiles of anaerobic methane-oxidizing archaea and bacteria

[0038] 1. Take 3 1.5L reactors, take 3 samples of environmental sediments, each with a mass of 720g ± 2g, inoculate into the reactors, one of which is recorded as control group C, and the other two are recorded as E1 and E2. Prepare incubation culture medium containing trace elements required for microbial growth and simulated water for the control group, and deoxygenate with nitrogen;

[0039] Second, add incubation culture medium and simulated water, seal the reactor and aerate with nitrogen through the water inlet for 10 minutes to achieve an anaerobic environment. After that, pass standard gas into the incubation culture medium and simulated water to saturate the solution with methane and nitrous oxide;

[0040] 3. The reactor is incubated for 200 days. During this period, the gas concentration in the reactor headspace and liquid phase can be monitored, and the changes in the concentration of gas-phase methane and nitrous oxide can be measured using a gas chromatograph;

[0041] 4. After the incubation, the sediment microbial samples were extracted, and the extracted DNA was amplified with 926_F / 1392_R primers for the V6-V8 region of the 16S rRNA gene, and the marker gene 16S rRNA amplicon was sequenced. At the same time, quantitative PCR analysis was performed using McrA159_F / McrA345_R primers for ANME-mcrA gene, A189-b_F / Cmo682_R primers for NC10-pmoA gene, and nodM1432F / nodM1884R primers for NC10-nod gene to obtain gene copy number.

[0042] 5. Sequencing of microbial samples by metagenomics and metatranscriptomes can clarify microbial metabolic pathways.

[0043] 6. 16S rRNA cloning and full-length 16S rRNA sequencing. Metagenomic assembly, binning and genome analysis were performed on the metagenome sequencing results. Transcriptome analysis was performed on the metatranscriptome sequencing results.

[0044] Incubation medium and simulated water components per liter: KH 2 PO 4 , 0.075 g; CaCl 2 ·2H 2 O, 0.300 g; MgCl 2 6H 2 O, 0.165g; alkaline trace element solution, 0.2mL; acidic trace element solution, 0.5mL.

[0045] The alkaline trace element solution contains 10 mM NaOH and SeO per liter. 2 , 0.067g; Na 2 WO 4 ·2H 2 O, 0.050g; Na 2 MoO 4 , 0.242g;

[0046] The acidic trace element solution contains 100 mM HCl and 100 mM FeSO 4 7H 2O, 5.560 g; ZnSO 4 7H 2 O, 0.068 g; CoCl 2 6H 2 O, 0.120 g; MnCl 2 ·4H 2 O, 0.500g; CuSO 4 , 1.600g; NiCl 2 6H 2 O, 0.095 g; H 3 BO 3 , 0.014g.

[0047] The relative abundance of microbial 16sRNA sequencing function and the gene copy number obtained by quantitative PCR analysis obtained by the method of this embodiment are as follows: Figure 1As shown, part (a) shows the difference in relative abundance of microorganisms, G1:ANME-2d, G2:NC10, G3:Psendarthrobacter, G4:un_Caldilineaceae, G5:un_JG30-KF-CM45, G6:Hyphomicrobium, G7:un_Rhodobacteraceae, G8:un_Rhizobiales_Incertae_Sedis, G9:Haliangium, G10:Anaeromyxobacter, G11:Bacillus, G12:Paenisporosarcina, G13:un_Comamonadaceae, G14:un_PHOS-HE36. These included anaerobic methane oxidizing microorganisms (G1: ANME-2d and G2: NC10) and denitrifying bacteria (G3: Pseudarthrobacter, G4: un_Caldilineaceae, G5: un_JG30-KF-CM45, etc.). The relative abundance of ANME-2d increased compared with the control group, while the relative abundance of NC10 decreased compared with the control group. (b) shows the gene abundance of the ANME-2d specific gene mcrA, (c) shows the gene abundance of the NC10 specific gene pmoA, and (d) shows the gene abundance of the NC10 specific gene nod. C: control group, E1 and E2: experimental group. It can be seen that the anaerobic ANME gene copy number in the sediment sample after incubation is higher than that in the sediment sample of the control group, while the NC10 gene copy number is lower than that in the sediment sample of the control group, which indicates that ANME may have a cooperative relationship with denitrifying microorganisms to form an anaerobic methane oxidation coupled with denitrification phenomenon. The lowercase letters "a, b, c" in parts (b), (c), and (d) indicate that there are significant differences in gene copy numbers between different groups after Tukey's significance test. "a" represents the highest copy number, "b" the second highest, and "c" the lowest copy number.

[0048] ANME-2d and NC10 gene expression profiles Figure 2 As shown, the numbers shown in the figure represent the log2-transformed RPKM fold change values ​​calculated according to the equation. It can be seen that the expression of methane oxidation pathway, denitrification pathway, electron respiratory chain pathway and related genes and gene clusters for electron transfer in ANME-2d were significantly upregulated, while the expression of methane oxidation pathway-related genes and gene clusters in NC10 were significantly downregulated. It can be considered that NC10 is restricted in this environment, and ANME-2d cooperates with other denitrifying microorganisms through extracellular electron transfer to complete the anaerobic methane oxidation coupled nitrous oxide reduction process.

[0049] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A method for identifying the relative abundance or gene expression profile of anaerobic methane-oxidizing archaea and bacteria, characterized in that: The method comprises the following steps: Step 1: Collect environmental samples from sampling points; Step 2, extracting DNA from the sample obtained in step 1; Step 3: The DNA obtained in step 2 is subjected to 16S rRNA cloning and total bacterial 16S rRNA sequencing, and real-time quantitative PCR analysis is performed using specific primers.

2. The method according to claim 1, characterized in that The environmental samples in step 1 include river sediments and soil.

3. The method according to claim 2, characterized in that The river sediments also need to be transferred into anaerobic bottles for short-term incubation experiments: the steps of the short-term incubation experiment are as follows: Step 1), weighing the sediment into an anaerobic bottle, adding culture solution, replacing the headspace gas of the anaerobic bottle with nitrogen to ensure anaerobic conditions, and then replacing the nitrogen in the headspace of the anaerobic bottle with standard gas to obtain a replaced anaerobic bottle; the standard gas is 85% methane, 10% nitrous oxide and 5% carbon dioxide; Step 2), the anaerobic bottle replaced in step 1) is placed in an air bath shaker at 25°C and 150 rpm for incubation for 15 days.

4. The method according to claim 3, characterized in that The anaerobic bottle is 100 mL, the culture solution is 50 mL, and the standard gas is 20 mL.

5. The method according to claim 4, characterized in that The culture solution is the original water sample at the sampling point, and the culture solution should also include the following components: Each liter of the culture solution contains KH2PO4, 0.075 g; CaCl2·2H2O, 0.300 g; MgCl2·6H2O, 0.165 g; alkaline trace element solution, 0.2 mL; Acidic trace element solution, 0.5mL.

6. The method according to claim 5, characterized in that The alkaline trace element solution contains 10mM NaOH, and each liter of the alkaline trace element solution contains 0.067g SeO2, 0.050g Na2WO4·2H2O, and 0.242g Na2MoO4; the acidic trace element solution contains 100mM HCl, and each liter of the acidic trace element solution contains 5.560g FeSO4·7H2O, 0.068g ZnSO4·7H2O, 0.120g CoCl2·6H2O, 0.500g MnCl2·4H2O, 1.600g CuSO4, 0.095g NiCl2·6H2O, and 0.014g H3BO3.

7. The method according to claim 1, characterized in that The primers used for the 16S rRNA cloning in step 3 are total bacterial 16S RNA amplification primers 926F and 1392R, the nucleotide sequence of the primer 926F is: AAACTYAAAKGAATTGRCGG; the nucleotide sequence of the primer 1392R is: ACGGGCGGTGWGTRC.

8. The method according to claim 1, characterized in that The specific primers in step 3 are primers ANME-mcrA for anaerobic methane-oxidizing archaea and primers NC10-pmoA and NC10-nod for anaerobic methane-oxidizing bacteria; the primers ANME-mcrA are McrA159F and McrA345R; the nucleotide sequence of the primer McrA159F is: ACGGGCGGTGWGTRC; the nucleotide sequence of the primer McrA345R is: TCGTCCCATTCCTGCTGCATTGC; the primers NC10-pmoA are A189-bF and C mo682R; the nucleotide sequence of the primer A189-bF is: GGNGACTGGGACTTYTGG; the nucleotide sequence of the primer Cmo682R is: AAAYCCGGCRAAGAACGA; the primer NC10-nod is nodM1432F and nodM1884R, the nucleotide sequence of the primer nodM1432F is: TTCCGCGCKGTSAAGCCSTG; the nucleotide sequence of the primer nodM1884R is: MCGCTCCGTCSGCATCTTCC.

9. The method for identifying the relative abundance or gene expression profile of anaerobic methane-oxidizing archaea or bacteria as described in any one of claims 1 to 8 is applied to indicate the decoupling relationship of denitrifying anaerobic methane-oxidizing microorganisms.

10. The method for identifying the relative abundance or gene expression profile of anaerobic methane-oxidizing archaea and bacteria as described in any one of claims 1 to 8 is used to determine whether coupled methane oxidation and nitrous oxide reduction exist.

Images