Affinity binding entities against PSMA and methods of use thereof

Abstract

Aspects of the present disclosure include affinity binding entities targeting prostate specific membrane antigen (PSMA), chimeric antigen receptors (CARs) comprising the same, modified immune cells comprising the CARs, and compositions and methods comprising the same for treating conditions associated with PSMA expression. In embodiments, the modified immune cells are engineered [gamma] [delta] T cells.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Application Serial No. 63 / 397,296, filed on August 11, 2022, the disclosure of which is expressly incorporated herein by reference in its entirety. Technical Field

[0003] The present disclosure generally relates to affinity binding entities for prostate-specific membrane antigen (PSMA). Provided herein are chimeric antigen receptors (CARs) capable of binding to PSMA, polynucleotides, host cells comprising the polynucleotides and / or CARs, and methods for treating PSMA-related disorders in patients. Background Art

[0004] From early strategies focused on basic lymphokine activation and / or tumor infiltration to more recent strategies of engineering immune cells to express genetically engineered antigen receptors such as chimeric antigen receptors (CARs), adoptive cell therapy has undergone nearly continuous iterations for more than three decades (30). Although there have been some hints and signs along the way that indicate the curative potential of these approaches, much work remains to be done. In particular, the success of CAR-T lymphocytes in eradicating tumors depends on the persistence and effector function of CAR-T cells, either of which can trigger a graft-versus-host (GvH) effect in patients. In addition, while adoptive transfer of CAR-expressing T cells has shown some success in treating hematologic malignancies, it has shown only limited efficacy in other cancer types, particularly solid tumors. Compared with hematologic diseases, solid tumors face unique challenges, including but not limited to a highly immunosuppressive and metabolically challenged tumor microenvironment.

[0005] Prostate-specific membrane antigen (PSMA), also known as glutamate carboxypeptidase II, or N-acetylated alpha-linked acid dipeptidase 1 or folate hydrolase 1 (FOLH1), is a dimeric type 2 transmembrane glycoprotein. PSMA is a prostate cancer-associated cell membrane antigen that is frequently overexpressed in new blood vessels in prostatic intraepithelial neoplasia (PIN) (a condition in which some prostate cells begin to look and behave abnormally), primary and metastatic prostate cancer, and other solid tumors (e.g., breast, lung, bladder, kidney cancer). PSMA expression correlates with disease progression and Gleason score. PSMA expression is increased in metastatic disease, hormone-refractory cases, and high-grade lesions, and is further upregulated in androgen-insensitive tumors.

[0006] To date, adoptive cell therapy approaches targeting PSMA have toxicity issues, limiting the practical translation of such approaches. In August 2020, a Phase I clinical study conducted by Poseida Therapeutics was suspended due to the death of a patient treated with P-PSMA-101, an autologous CAR-T cell therapy using αβT cells designed to target prostate cancer cells expressing PSMA. The patient in this example developed symptoms consistent with macrophage activation syndrome (MAS), a severe and sometimes fatal immune system overactivation associated with CAR-T therapy. In March 2021, the results of a Phase I clinical trial conducted by the University of Pennsylvania were announced, which tested the efficacy of autologous CAR-T cells using αβT cells designed to target PSMA and equipped with dominant negative transforming growth factor (TGF)-β (Narayan et al., (2022) Nature Medicine.doi:10.1038). Results revealed that of the 13 patients who received all four dose levels, 5 experienced grade ≥2 cytokine release syndrome (CRS), including one patient who died of grade 4 CRS complicated by sepsis. Thus, to date, PSMA-targeted CAR-Ts have been examined in the context of αβT cells, where potential efficacy appears to be compromised by an overall higher alloreactive potential and their propensity to induce complications such as CRS and MAS.

[0007] Gamma delta (γδ) T cells are thymus-derived lymphocytes that differ from αβT cells in activation and functional mechanisms and anatomical distribution. Specifically, although αβT cells play a role in adaptive immunity, γδT cells are innate immune cells that recognize malignant cells in an MHC-independent manner through a series of activation receptors, similar to NK cells (Welsh et al., Immunol Rev. 1997; 159: 79-93). Therefore, and compared with αβT cells, γδT cells can potentially be used in allogeneic environments without the risk of causing graft-versus-host disease (GvHD). In addition, recent studies have shown that engineered γδ-T cells can produce less proinflammatory cytokines than αβ-T cells, thereby reducing the risk of CRS in patients (Harrer et al., BMC Cancer 2017; 17 (1): 551).

[0008] Despite the rapid and robust development of CAR-T therapy, the optimal parameters of CAR-T cell-target interactions that will lead to efficacy in vivo and in humans are unclear. Given the differences in the mechanism of action and function of αβT cells compared to γδT cells, CAR function and efficacy demonstrated in the context of αβT cells is not predictive of CAR function and efficacy in the context of γδT cells. Therefore, the actual conversion of γδT cells by PSMA-targeted CAR T therapy is uncertain at best.

[0009] Therefore, there is clearly still a need for improved strategies to increase the viability, survival and / or expansion of cells after administration while improving the safety of PSMA-targeted adoptive cell therapy approaches. Summary of the invention

[0010] The present disclosure provides methods, cells, compositions and kits for improving the safety and efficacy of adoptive cell therapy methods targeting PSMA. In one aspect, an affinity binding entity is provided, comprising an antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA). In an embodiment, the antigen binding domain comprises a heavy chain variable region / light chain variable region (HCVR / LCVR) sequence pair selected from the group consisting of: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34 and 35 / 36; or six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34 and 35 / 36; NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36. In the embodiments, the numbering system used is that of Kabat et al.

[0011] In an embodiment, the antigen binding domain comprises a HCVR / LCVR sequence pair selected from the group consisting of: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12 and 13 / 14; or six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12 and 13 / 14.

[0012] In an embodiment, the antigen binding domain specifically binds to an epitope within residues 574-686 of human PSMA, the residues being selected according to Fig.18BIn one embodiment, the antigen binding domain specifically binds to an epitope consisting of residues 574-686 of human PSMA, the residues being numbered according to Fig.18B In an embodiment, the antigen binding domain specifically binds to an epitope comprising or consisting of residues 574-580, 644-649, and 674-686 of human PSMA, the residues being numbered according to Fig.18B In an embodiment, the epitope is mapped by phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads. In an embodiment, the antigen binding domain comprises the HCVR / LCVR sequence pair of SEQ ID NO: 1 / 2.

[0013] In an embodiment, the antigen binding domain specifically binds to an epitope within residues 150-261 of human PSMA, the residues being determined according to Fig.18B In one embodiment, the antigen binding domain specifically binds to an epitope consisting of residues 150-261 of human PSMA, with the residues being numbered according to Fig.18B In an embodiment, the antigen binding domain specifically binds to an epitope comprising or consisting of residues 150-161, 167-172, and 256-261 of human PSMA, the residues being numbered according to Fig.18B In an embodiment, the epitope is mapped by phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads. In an embodiment, the antigen binding domain comprises the HCVR / LCVR sequence pair of SEQ ID NO: 9 / 10.

[0014] In an embodiment, the affinity binding entity is an antibody or antibody fragment. In an embodiment, the antibody or antibody fragment is bispecific. In an embodiment, the antibody or antibody fragment is chimeric, humanized or human. In an embodiment, the antibody or antibody fragment is monoclonal. In an embodiment, the affinity binding entity is selected from the group consisting of: scFv, Fab, Fab', Fv, F(ab') 2 , dsFv, dAb and any combination or multiple thereof.

[0015] According to one aspect of the present invention, there is provided a chimeric antigen receptor (CAR) comprising an affinity binding entity, the affinity binding entity comprising an antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the antigen binding domain comprises a HCVR / LCVR sequence pair selected from the group consisting of: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12 and 13 / 14; or six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12 and 13 / 14.

[0016] In an embodiment, the CAR further comprises a hinge domain. In an embodiment, the hinge domain comprises a glycine polymer, a glycine-serine polymer, a glycine-alanine polymer, an alanine-serine polymer, an immunoglobulin heavy chain hinge, or a receptor-derived hinge. In an embodiment, the receptor-derived hinge is a CD8α hinge domain. In an embodiment, the CD8α hinge domain comprises an amino acid sequence as shown in SEQ ID NO: 156.

[0017] In embodiments, CAR further comprises a transmembrane (TM) domain. In embodiments, the TM domain comprises the following TM region: 4-1BB / CD137, activated NK cell receptor, immunoglobulin, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154, CD100 (SEMA4D), CD103, CD160 (BY 55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276(B7-H3), CD28, CD29, CD3δ, CD3ε, CD3γ, CD3ζ, CD30, CD4, CD40, CD4 9a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96(Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRT AM, cytokine receptor, DAP10, DNAM1 (CD226), Fcγ receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell co-stimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGBl, KIRDS2, LAT, LFA-1, ligand that specifically binds to CD83, LIGHT, LTBR, ​​Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC Class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecules (SLAM proteins), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Ly108), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6 or fragments, truncations or combinations thereof. In an embodiment, the TM domain comprises a TM domain of CD8, preferably wherein the CD8 TM domain is a TM domain of CD8α.In an embodiment, the TM domain comprises the amino acid sequence shown in SEQ ID NO:158.

[0018] In embodiments, CAR further comprises a costimulatory domain. In embodiments, the costimulatory domain comprises the following costimulatory domains: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD 27. CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54(ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96(Tactile), CD100 (SEMA4D), CD103, CD134(OX40), CD137(4-1BB), CD152(CTLA-4), CD160(BY55), CD162(SELPLG), CD244(2B4), CD270(HVEM), CD2 26(DNAM1), CD229(Ly9), CD278(ICOS), ICAM-1, LFA-1(CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, Z AP70, GITR, BAFFR, LTBR, ​​LAT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, IT GB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2 or TRANCE / RANKL, or a portion thereof or a combination thereof. In embodiments, the costimulatory domain is a 4-1BB costimulatory domain. In embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence as shown in SEQ ID NO: 162.

[0019] In an embodiment, the CAR further comprises an intracellular signaling domain. In an embodiment, the intracellular signaling domain is a CD3 zeta intracellular signaling domain. In an embodiment, the CD3 zeta intracellular signaling domain comprises an amino acid sequence as shown in SEQ ID NO: 164, 166 or 167.

[0020] In embodiments, CAR further comprises a signal peptide. In embodiments, the signal peptide comprises an amino acid sequence as shown in SEQ ID NO: 152.

[0021] In one aspect of the present invention, an isolated polynucleotide is provided, comprising a nucleic acid sequence encoding any one of the aforementioned affinity binding entities. In an embodiment, an expression vector comprises the polynucleotide. In an embodiment, the polynucleotide is operably linked to a cis-acting regulatory element.

[0022] According to one aspect of the present invention, a cell is provided, comprising any one or more of the aforementioned affinity binding entities, polynucleotides and / or expression vectors.

[0023] According to one aspect of the present invention, a kind of isolated polynucleotide is provided, which comprises a nucleic acid sequence encoding any one of the aforementioned CARs. In embodiments, the polynucleotide further comprises a nucleic acid sequence encoding at least one polycistronic linker region. In some embodiments, the polycistronic region encodes a cleavage sequence. In embodiments, the cleavage sequence is selected from T2A, F2A, P2A, E2A, furin and furin-P2A (FP2A). In embodiments, the polycistronic linker region encodes an internal ribosome entry site (IRES).

[0024] In an embodiment, the isolated polynucleotide further comprises a nucleic acid sequence encoding one or more additional polypeptides. In an embodiment, the one or more additional polypeptides are selected from the group comprising or consisting of: lymphotoxin beta receptor (LTBR), low affinity nerve growth factor receptor (LNGFR), dominant negative (dn) receptor of TGF-β or Fas, truncated form of human epidermal growth factor receptor (EGFRt) and membrane-bound IL-12 (mbIL-12) or any combination thereof. In an embodiment, the one or more additional polypeptides are selected from fluorescent proteins, gamma chain cytokines, CD19, CD20, LNGFR, EGFRt, LTBR, ​​dnTGFβR2 and any combination thereof.

[0025] In embodiments, one or more additional polypeptides are dominant negative receptors for TGF-β. In embodiments, the dominant negative receptor for TGF-β is dnTGFβR2. In embodiments, dnTGFβR2 comprises an amino acid sequence as shown in SEQ ID NO:265. In embodiments, one or more additional polypeptides are lymphotoxin beta receptor (LTBR). In embodiments, the LTBR comprises an amino acid sequence as shown in SEQ ID NO:267. In embodiments, one or more additional polypeptides are truncated forms of epidermal growth factor receptor (EGFRt). In embodiments, EGFRt comprises an amino acid sequence as shown in SEQ ID NO:261. In embodiments, one or more additional polypeptides are low affinity nerve growth factor receptor (LNGFR). In embodiments, LNGFR comprises an amino acid sequence as shown in SEQ ID NO:273. In embodiments, one or more additional polypeptides are dominant negative Fas (dnFas). In embodiments, one or more additional polypeptides are membrane-bound IL-12 (mbIL-12). In embodiments, one or more additional polypeptides are CARs that bind to CD70.

[0026] In an embodiment, the one or more additional polypeptides are operably linked to a nucleic acid sequence encoding a signal peptide. In an embodiment, the signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271 and SEQ ID NO: 248.

[0027] In an embodiment, the isolated polynucleotide comprising a nucleic acid sequence encoding a CAR comprises a nucleic acid sequence of SEQ ID NO: 205, 209, 213, 217, 221, 225, 229 or 233. In an embodiment, an expression vector comprises an isolated polynucleotide comprising a nucleic acid sequence encoding a CAR. In an embodiment, the polynucleotide is operably linked to a cis-acting regulatory element.

[0028] According to one aspect, a γδT cell is provided herein, comprising a) a nucleic acid sequence encoding a chimeric antigen receptor (CAR), the CAR comprising an affinity binding domain that specifically binds to a prostate-specific membrane antigen (PSMA); and / or (b) a polypeptide comprising a CAR, the CAR comprising an amino acid sequence encoded by the nucleic acid sequence of (a), wherein the γδT cell functionally expresses the binding domain of the polypeptide or nucleic acid-encoded CAR on the surface of the γδT cell. In an embodiment, the γδT cell is a δ1, δ2, δ3 or δ4 γδT cell, preferably a δ2 - γδ T cells, more preferably δ1 γδ T cells.

[0029] According to one aspect, the present invention provides a modified immune cell comprising a CAR, an isolated polynucleotide comprising a nucleic acid sequence encoding a CAR, and / or an expression vector comprising a polynucleotide comprising a nucleic acid sequence encoding a CAR, as described herein. In an embodiment, the modified immune cell is a γδT cell, a γδNKT cell, an αβT cell, a NK cell, a NKT cell, or a macrophage. In an embodiment, the modified immune cell is a γδT cell. In an embodiment, the γδT cell is a δ1, δ2, δ3, or δ4 γδT cell, preferably a δ2 - γδ T cells, more preferably δ1 γδ T cells.

[0030] In embodiments, the modified immune cells or γδT cells exhibit in vitro and / or in vivo tumor cell killing activity for tumor cells that exhibit PSMA cell surface expression. In embodiments, the cell killing activity is greater than the innate level of in vitro and / or in vivo tumor cell killing activity in a control modified immune cell or control γδT cell of the same type that does not contain a CAR construct. In embodiments, the modified immune cells or γδT cells proliferate in response to contact with tumor cells that exhibit PSMA cell surface expression. In embodiments, the modified immune cells or γδT cells exhibit increased proliferation in response to contact with tumor cells that exhibit PSMA cell surface expression, compared to control modified immune cells or γδT cells of the same type that do not contain a CAR construct.

[0031] In embodiments, the modified immune cells or γδ T cells are proliferated in a host organism comprising tumor cells that exhibit cell surface expression of PSMA.

[0032] In embodiments, the modified immune cell or γδ T cell expresses a pro-inflammatory cytokine upon contact with a tumor cell exhibiting cell surface expression of PSMA.

[0033] In embodiments, the modified immune cell or γδT cell comprises at least one disrupted gene. In embodiments, the at least one disrupted gene is cytokine-induced SH2-containing protein (CISH). In embodiments, at least one disrupted endogenous gene is Cbl proto-oncogene B (CBL-B). In embodiments, at least one disrupted endogenous gene is zinc finger protein 91 (ZFP91). In embodiments, at least one disrupted endogenous gene is Roquin. In embodiments, at least one disrupted endogenous gene is CD58 and / or ICAM-1.

[0034] According to one aspect, a plurality of modified immune cells as disclosed herein are provided.

[0035] According to one aspect, a plurality of γδT cells as disclosed herein are provided, preferably wherein the γδT cells comprise (a) a nucleic acid encoding a CAR as disclosed herein, the CAR comprising an affinity binding domain that specifically binds to PSMA; and / or (b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid of (a), wherein the γδT cells functionally express the binding domain of the polypeptide or nucleic acid-encoded CAR on the surface of the γδT cells.

[0036] In an embodiment, the plurality of modified immune cells or the plurality of γδ T cells comprises at least 60%, 80%, or about 60%, or 80%, to about 90% or 95% δ1, δ2, δ3, or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2 - The composition is composed of γδ T cells, most preferably δ1 γδ T cells.

[0037] In an embodiment, the plurality of modified immune cells or the plurality of γδ T cells each comprises at least about 10 7 modified immune cells or γδT cells, preferably about 10 8 Modified immune cells or γδT cells to about 10 11 A modified immune cell or γδ T cell.

[0038] According to one aspect, a method for preparing a modified immune cell, a γδT cell, a plurality of modified immune cells, or a plurality of γδT cells is provided, wherein the method comprises transfecting an immune cell or γδT cell with an expression vector comprising a nucleic acid encoding a CAR as disclosed herein, optionally wherein the cell has at least one disrupted gene. In embodiments, the method comprises retroviral transduction. In embodiments, the method comprises ex vivo expansion of immune cells or γδT cells, wherein ex vivo expansion is performed before and / or after transfection of immune cells or γδT cells.

[0039] According to aspects of the present invention, there is provided an antibody-drug conjugate (ADC) comprising any one of the aforementioned affinity binding entities.

[0040] According to aspects of the present invention, there is provided a pharmaceutical composition comprising any one of the aforementioned affinity binding entities, modified immune cells, γδT cells or ADCs, and a pharmaceutically acceptable carrier.

[0041] According to aspects of the present invention, there is provided a method of inhibiting the growth of a cell exhibiting PSMA cell surface expression, comprising contacting the cell with any one of the aforementioned affinity binding entities, modified immune cells, γδ T cells, ADCs or pharmaceutical compositions.

[0042] According to aspects of the present invention, there is provided a method for killing tumor cells that exhibit PSMA cell surface expression, the method comprising contacting the tumor cells with a therapeutically effective amount of any of the aforementioned affinity binding entities, modified immune cells, γδT cells, ADCs or pharmaceutical compositions. In an embodiment, the method comprises introducing a therapeutically effective amount of an affinity binding entity, a modified immune cell, a γδT cell, an ADC or a pharmaceutical composition into a host organism comprising a tumor cell.

[0043] In embodiments of the method for killing tumor cells, the method further includes the simultaneous or sequential administration of one or more methods of raising shared γ chain cytokines. In embodiments, administering one or more methods of raising shared γ chain cytokines includes administering a certain amount of shared γ chain cytokines that effectively increase the proliferation, cytotoxic activity, persistence, or a combination thereof of the introduced modified immune cells or γδT cells simultaneously or sequentially before and / or after the introduction of modified immune cells or γδT cells. In embodiments, one or more methods of raising shared γ chain cytokines include lymphocyte depletion (lymphodepletion) before the introduction of modified immune cells or γδT cells. In embodiments, one or more methods of raising shared γ chain cytokines include secretion of one or more shared γ chain cytokines from the introduced modified immune cells or γδT cells.

[0044] In embodiments of the methods of inhibiting growth of cells expressing PSMA cell surface expression or methods of killing tumor cells expressing PSMA cell surface expression herein, the methods reduce the in vivo tumor burden of the host organism and / or increase the average survival time of the host organism compared to a control organism, wherein the control organism is not treated with the affinity binding entity, modified immune cell, γδ T cell, ADC or pharmaceutical composition. In embodiments, the host organism is a human. In embodiments, the method is a method of treating cancer in a subject in need thereof.

[0045] According to one aspect, there is provided a use of any of the aforementioned affinity binding entities, modified immune cells, γδ T cells, ADCs or pharmaceutical compositions in the preparation of a medicament for treating cancer.

[0046] On the one hand, a method for reducing or inhibiting a graft-versus-host reaction of an immune cell administered to a subject in need is provided, comprising administering a therapeutically effective amount of γδT cells according to the present invention. In an embodiment, the γδT cells may comprise a dual CAR bound to CD70 and PSMA, or the method may further comprise co-administering γδT cells according to the present invention simultaneously or sequentially with immune cells (e.g., T cells or NK cells) comprising a CAR bound to PSMA and a CAR bound to CD70.

[0047] Incorporated by Reference

[0048] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each independent publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The binding profiles of anti-PSMA antibodies to both PSMA-expressing 22Rv1 cells and 22Rv1 cells in which PSMA expression was knocked out are illustrated.

[0050] Figure 2A A table of EC50s of anti-PSMA antibodies against recombinant human PSMA protein is depicted.

[0051] Figure 2B Differential binding profiles of selected anti-PSMA antibodies to monomeric or dimeric states of recombinant human PSMA protein are illustrated.

[0052] Figures 3A-3H The present invention is to illustrate the various PSMACAR constructs disclosed herein against PSMA expressing cell lines (PSMA expressing 22Rv1 target cells, Figure 3A , 3C ; PC3 cells engineered to express PSMA, Figure 3E , 3G ) or the corresponding negative control (PSMA expression knockout 22Rv1, Figure 3B , 3D ; The parental PC3 cell line that does not express PSMA, Figure 3F , 3H ) in vitro cytotoxicity.

[0053] Figure 4A-4B is a graph illustrating the in vitro cytotoxicity profile of a PSMA CAR construct modified to express a dominant negative TGFβ receptor II (dnTGFβRII). The modified PSMA CAR construct cytotoxicity profile was comparable to that of a similar PSMA CAR construct lacking dnTGFβRII ( Figure 4A No cytotoxicity was observed against PSMA knockout cell lines ( Figure 4B ).

[0054] Figure 5A It is demonstrated that expression of the PSMACAR construct modified to express dnTGFβRII is unchanged relative to expression of the analogous PSMACAR lacking dnTGFβRII.

[0055] Figure 5BIt is demonstrated that expression of dnTGFβRII is detected in a PSMACAR construct modified to express dnTGFβRII, but not in a similar unmodified PSMACAR construct.

[0056] Figure 5C It was demonstrated that γδ T cells containing a PSMACAR construct modified to express dnTGFβRII had reduced CD103 expression compared to control cells containing a similar PSMACAR construct lacking dnTGFβRII.

[0057] Figure 5D It is demonstrated that pSMAD2 / 3 expression is reduced in γδ T cells containing a PSMACAR construct modified to express dnTGFβRII compared to control cells containing a similar PSMACAR construct lacking dnTGFβRII.

[0058] Figure 6 The 15-day cell expansion profile of anti-PSMACAR-transduced γδ T cells is illustrated.

[0059] Figure 7A-7B is a graph illustrating the in vivo efficacy of anti-PSMACAR transduced γδ T cells in the subcutaneous human xenograft 22Rv1 clone E7 model in NOD scidγ (NSG) mice.

[0060] Figure 8 is a graph illustrating the gene knockdown efficiency of two different guide RNAs targeting cytokine-induced SH2-containing protein (CISH).

[0061] Fig. 9A This is a graph showing that CISH-knockout Vδ1T cells can be enriched after αβT cell depletion.

[0062] Fig. 9B This is a graph showing the viability of CISH knockout Vδ1 T cells.

[0063] Fig. 10A The binding profiles of anti-PSMA antibodies to both PSMA-expressing 22Rv1 cells and 22Rv1 cells in which PSMA expression was knocked out are illustrated. Fig. 10B The binding profiles of anti-PSMA antibodies to three different PSMA+ prostate cancer (PCa) cell lines with different PSMA expression levels are summarized.

[0064] Fig.11A The EC50 of anti-PSMA antibodies against recombinant human PSMA protein is illustrated. Fig. 11B Differential binding profiles of some anti-PSMA antibodies to monomeric or dimeric states of recombinant human PSMA protein are illustrated.

[0065] Fig.12 The in vitro cytotoxicity of different PSMACAR constructs against the PSMA expressing PCa cell lines 22Rv1 and PC3-PSMA and the respective corresponding knockout or parental lines lacking PSMA expression are demonstrated.

[0066] Fig.13 The in vitro cytotoxicity of PSMACAR in the presence of TGFβ1 was demonstrated.

[0067] Fig.14A It was demonstrated that expression of CAR in the "bolt-on" modified PSMACAR construct remained unchanged relative to the naked CAR. Fig. 14B Demonstrated is the expression of dominant negative TGFβ receptor II (dnTGFβRII) in the "bolt-on" modified PSMACAR construct when compared to the unmodified naked CAR. Fig. 14C Demonstrated decreased CD103 expression in the “bolt-on” modified PSMACAR construct compared to naked CAR. Fig.14D It is demonstrated that pSMAD2 / 3 expression is reduced in the "bolt-on" modified pSMACAR constructs after addition of exogenous TGFβ compared to the unmodified naked CAR.

[0068] Fig.15 Depicted are the cell expansion profiles of γδ T cells transduced with and without “bolt-on” anti-PSMA CAR in 3 donors as well as the benchmark (J591).

[0069] FIG. 16 illustrates the in vivo efficacy of anti-PSMACAR transduced γδ T cells expanded in 3 donors in the subcutaneous human xenograft 22Rv1 clone E7 model in NOD scidγ (NSG) mice compared to benchmark J591 transduced γδ T cells.

[0070] FIG. 17 illustrates the in vivo efficacy of anti-PSMA CAR with and without dnTGFβRII “bolt-on” (including suboptimal doses) in a subcutaneous human xenograft PC3-PIP model in NSG mice.

[0071] Fig.18A Binder epitopes in two anti-PSMA CAR-transduced γδ T cells mapped to the crystal structure of human PSMA are illustrated. The predicted linear epitope of the benchmark (J591), the conformational epitopes of lead 1 and lead 2 are indicated. Fig.18B The sequences on human PSMA elucidated as binding epitopes in Leads 1 and 2 using cross-linking mass spectrometry (XL-MS) are listed (SEQ ID NOS:329-330).

[0072] Fig.19 CAR-mbIL-12 construct design is illustrated.

[0073] Figures 20A-20D The expansion and expression of CAR-mbIL-12 in Vδ1T cells are illustrated.

[0074] Fig.21 The enhanced in vitro cytotoxicity of CAR-mbIL-12 in Vδ1 T cells was demonstrated.

[0075] Fig. 22 The in vivo therapeutic efficacy of CAR-mbIL-12 in Vδ1 T cells in a subcutaneous human xenograft Raji cell NSG mouse model is demonstrated.

[0076] Figures 23A-23B It was shown that CISH KO enhanced the in vitro cytotoxicity of Vδ1T cells.

[0077] Figures 24A-24B It was shown that CBL-B KO enhanced the in vitro cytotoxicity of Vδ1T cells.

[0078] Figures 25A-25B It was shown that Roquin KO enhanced the in vitro cytotoxicity of Vδ1T cells.

[0079] Figures 26A-26B It was demonstrated that CD58 or ICAM-1 KO enhanced the in vitro cell survival of Vδ1 T cells in an allogeneic MLR assay. DETAILED DESCRIPTION

[0080] I. Definitions

[0081] For the purpose of interpreting this specification, the following definitions will apply, and whenever appropriate, terms used in the singular will also include the plural form and vice versa. If any definition set forth conflicts with any document incorporated herein by reference, the definition set forth below shall prevail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0082] As used herein, when referring to a measurable value such as an amount, duration, etc., "about" is intended to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% of the stated value, as such variations are suitable for performing the disclosed methods.

[0083] As used herein, "w / v" refers to the weight of a component in a given volume of a solution.

[0084] "Range": Throughout this disclosure, various aspects of the disclosure may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity, and should not be interpreted as an immutable limitation on the scope of the disclosure. Therefore, the description of a range should be considered to have explicitly disclosed all possible subranges and individual numerical values ​​within the range. For example, a range description such as 1 to 6 should be considered to have explicitly disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within the range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0085] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0086] As used herein, the term "diagnosis" or "diagnosing" refers to the process of identifying a disease (such as cancer) through its signs, symptoms, and / or the results of various tests. The conclusion drawn through this process is the diagnosis. Common forms of testing performed include blood tests, medical imaging, urine analysis, biopsy, etc.

[0087] As used herein, the term "agent" refers to any protein, nucleic acid molecule (including chemically modified nucleic acids), chemical compound, antibody, small molecule, organic compound, inorganic compound, other molecule of interest, or cell (e.g., a cell engineered to express a chimeric antigen receptor). An agent may include a therapeutic agent, a diagnostic agent, or a pharmaceutical agent. A therapeutic agent or pharmaceutical agent is a therapeutic agent or pharmaceutical agent that, when administered to a subject (including treating a subject suffering from cancer or other disease / disorder), induces a desired response (such as inducing a therapeutic or preventive effect) alone or with an additional agent.

[0088] The term "therapeutically effective amount" (or simply "effective amount") refers to the amount of an agent or composition (e.g., a composition comprising an agent) that will elicit a biological or medical response in a tissue, system, or subject that is sought by a researcher, veterinarian, medical doctor, or other clinician. The term "therapeutically effective amount" includes an amount of an agent or composition comprising an agent that, when administered, is sufficient to prevent the development of one or more signs or symptoms of the disorder or disease (e.g., prostate cancer) being treated or to alleviate the signs or symptoms to some extent. The therapeutically effective amount will vary according to the composition, the disease and its severity, and the age, weight, etc. of the subject to be treated.

[0089] As used herein, the term "γδT cells (gamma T cells)" refers to a subset of T cells that express a different T cell receptor (TCR), namely a γδTCR, on its surface, which is composed of a γ chain and a δ chain. The term "γδT cells" specifically includes all subsets of γδT cells, including but not limited to Vδ1 and Vδ2, Vδ3γδT cells, as well as initial, effector memory, central memory and terminally differentiated γδT cells. As another example, the term "γδT cells" includes Vδ4, Vδ5, Vδ7 and Vδ8γδT cells, as well as Vγ2, Vγ3, Vγ5, Vγ8, Vγ9, Vγ10 and Vγ11γδT cells. In the embodiment, the γδT cell is Vδ1 - 、Vδ2 - or Vδ1 - and Vδ2 - . Compositions and methods for making and using engineered and non-engineered γδT cells and / or subtypes thereof include, but are not limited to, those described in US2016 / 0175358; WO 2017 / 197347; US 9499788; US2018 / 0169147; US 9907820; US 2018 / 0125889 and US2017 / 0196910, the contents of each of which are incorporated by reference for all purposes, including compositions and methods for making and using engineered and non-engineered γδT cells and / or subtypes thereof. The present application further contemplates T cells or other engineered leukocytes or lymphocytes expressing one γ chain or one δ chain, optionally in combination with a second polypeptide to form a functional TCR. Such engineered leukocytes or lymphocytes expressing one γ chain or one δ chain can be used in the methods described herein or present in the compositions described herein.

[0090] The γδT cells described herein may be δ1, δ2, δ3, or δ4 γδT cells, or a combination thereof. In some cases, the γδT cells are predominantly (>50%), substantially (>90%), essentially all, or completely δ2 γδT cells. In some cases, the γδT cells are predominantly (>50%), substantially (>90%), essentially all, or completely δ1 γδT cells. In some cases, the γδT cells are predominantly (>50%), substantially (>90%), essentially all, or completely δ3 γδT cells.

[0091] γδT cells for use as used herein may be obtained from allogeneic or autologous donors. γδT cells may be partially or completely purified, or not purified, and may be expanded ex vivo. Methods and compositions for ex vivo expansion include, but are not limited to, those described in WO2017 / 197347. Amplification may be performed before or after, or before and after, the CAR polypeptides disclosed herein are introduced into γδT cells. Other additional or alternative amplification methods include the use of, for example, artificial antigen presenting cells (aAPCs), aminobisphosphonates, cytokine mixtures, and feeder cells (Cortés-Selva, D et al., (2021) Trends Pharmacol Sci. 42 (1): 45-59).

[0092] As used herein, the term "αβT cells" refers to T cells that express the α and β chains of the TCR as part of a complex with a CD3 chain molecule. Each α and β chain contains a variable domain and a constant domain. αβT cells primarily recognize peptide antigens presented by major histocompatibility complex (MHC) class I and class II molecules, with most of the receptor diversity contained within the third complementarity determining region (CDR3) of the TCR α and β chains.

[0093] As used herein, the term "natural killer (NK) cells" refers to CD56 + CD3 - Granular lymphocytes, which play an important role in antiviral immunity and tumor immune surveillance, and constitute a key cell subset of the innate immune system (Godfrey J et al. Leuk Lymphoma 2012 53: 1666-1676). NK cells express a remarkably diverse repertoire of inhibitory and activating receptors on their cell surface that regulate their immune response. NK cells can kill transformed or infected cells by releasing perforins and granzymes or by using effector molecules of the tumor necrosis factor (TNF) family (such as TNF, TNF-related apoptosis-inducing ligand (TRAIL) and Fas ligand, which induce apoptosis of target cells). In addition, NK cells rapidly produce chemokines and cytokines after activation, including interferon (IFN)-γ, GM-CSF and IL-10, which recruit hematopoietic and non-hematopoietic cells of the host and affect their function. Unlike cytotoxic CD8 +Unlike T lymphocytes, NK cells can produce cytotoxicity against tumor cells without prior sensitization, and can also eliminate MHC-I negative cells (Narni-Mancinelli E et al. Int Immunol 2011 23:427-431). NK cells are considered to be quite safe effector cells because they can avoid cytokine storms (Morgan RA et al. Mol Ther 201018:843-851), tumor lysis syndrome (Porter DL et al. N Engl J Med 2011365:725-733) and potentially fatal complications of on-target and off-tumor effects.

[0094] NK cells can be obtained from allogeneic or autologous donors. NK cells can be partially or completely purified, or not purified, and can be expanded in vitro. Methods and compositions for ex vivo expansion include but are not limited to those described in Becker et al., (2016) Cancer Immunol. Immunother. 65 (4): 477-84). Amplification can be performed before or after or before and after CAR is introduced into NK cells. In short, but not limited to, the expansion of NK cells may include the use of engineered feeder cells, cytokine mixtures (e.g., IL-2, IL-15) and / or aAPC (Cortés-Selva, D et al., (2021) Trends Pharmacol Sci. 42 (1): 45-59).

[0095] In some embodiments, natural killer (PNK) cells derived from placental hematopoietic stem cells or immortalized cell lines (e.g., NK-92) can be engineered to express the chimeric adapter polypeptide of the present disclosure. In other examples, NK cells that can be used to engineer the expression of CAR herein can be differentiated from human embryonic stem cells (hESC) and induced pluripotent stem cells (iPSC). As used herein, the term "natural killer T (NKT) cells" is a T lineage cell with the same morphology and functional characteristics as T cells and NK cells. NKT cells are rapid responders of the innate immune system and mediate powerful immunomodulation and effector functions in a variety of disease environments. Ligand recognition in NKT cells leads to rapid secretion of proinflammatory cytokines (such as IFN-γ and TNF-α) and anti-inflammatory cytokines (such as IL-4, IL-10 and IL-13), which enhance immune responses to, for example, cancer by directly targeting tumor cells and by indirectly regulating anti-tumor responses (by releasing different cytokines) or by changing TME. Upon activation, NKT cells can immediately begin cytokine secretion without first differentiating into effector cells. The rapidity of their response makes NKT cells play an important role in the first innate line of defense against some types of bacterial and viral infections. In addition, many cytokines secreted by NKT cells have a powerful effect on the differentiation and function of αβT cells, linking NKT cells to adaptive defense. NKT cells bridge the adaptive immune system with the innate immune system. Unlike conventional T cells that recognize peptide antigens presented by major histocompatibility complex (MHC) molecules, NKT cells recognize glycolipid antigens presented by a molecule called CD1d. NKT cells can be obtained from allogeneic or autologous donors. NKT cells can be partially or completely purified, or not purified, and can be expanded ex vivo. Briefly, NKT cells can be expanded through the use of ex vivo IL-2 and / or monoclonal antibodies specific for the TCR α chain CDR3 loop (Cortés-Selva, D et al., (2021) Trends Pharmacol Sci. 42(1):45-59).

[0096] As used herein, the term "γδ natural killer T cells" or "γδ NKT cells" refers to iPSC-derived cells that express γδ TCRs and NK receptors but lack the expression of hallmark γδ T cell markers (Cortés-Selva, D et al., (2021) Trends Pharmacol Sci. 42 (1): 45-59). These cells have been shown to have anti-tumor activity against a large number of cancer cell lines, but not against normal cells, and exhibit more potent killing than donor-derived γδ T cells or donor-derived NK cells (Zeng J et al., (2019) PLoS ONE 14 (5): e0216815). In the embodiments herein, CARs may be expressed in γδ NKT cells for use according to the methods disclosed herein.

[0097] As used herein, the term "myeloid cells" refers to a subpopulation of leukocytes represented by granulocytes, monocytes, macrophages, and dendritic cells (DCs). They circulate through the blood and lymphatic system and are rapidly recruited to tissue damage and infection sites via various chemokine receptors. Within the tissue, they are activated to perform phagocytosis and secrete inflammatory cytokines, thereby playing an important role in protective immunity. Myeloid cells are also found in tissues under steady-state conditions, where they control development, homeostasis, and tissue repair.

[0098] As used herein, the term "macrophage" refers to an innate cell with high plasticity, whose functional and phenotypic characteristics can be formed in response to various stimuli. Macrophage polarization is roughly simplified into two different states, the M1 phenotype (classical activation) in response to factors such as lipopolysaccharide (LPS) or IFN-γ, or the M2 phenotype in response to cytokines such as IL-4, IL-5 and IL-13. Examples of M1-like macrophages express iNOS and proinflammatory cytokines such as TNF-α, IL1-β, IL-6, IL-12 and IL-23. Examples of M2 macrophages show increased expression of CD209, CD200R, CD1a and CD1b in humans, and are associated with wound healing and anti-tumor responses. The ability of macrophages to infiltrate solid tumors and reprogram, as well as the anti-tumor effects associated with conversion to M1 phenotypes, makes macrophages related to the present disclosure in terms of engineered macrophages expressing CAR described herein. For example, it has been demonstrated that in a mouse ovarian cancer model, macrophages can be reprogrammed into anti-tumor M1 phenotype cells that are capable of producing nitric oxide and inducing IL-12-dependent NK-mediated anti-tumor effects by inhibiting NK-κB signaling (Zhang F et al., (2019) Nat Commun 10:3974).

[0099] Macrophages can be obtained from / derived from allogeneic or autologous donors. Macrophages can be partially or completely purified, or not purified, and can be cultured in vitro (see, e.g., Davies JQ and Gordon A (2005) Methods Mol Biol 290: 105016). In embodiments, the disclosure encompasses macrophages derived from hESC (Karlsson, KR et al., (2008) Exp Hematol 36: 1167-1175) or iPSC-derived macrophages (Takata K. et al., (2017) Immunity 47: 183-198).

[0100] As used herein, the term "T lymphocyte" or "T cell" refers to an immune cell that expresses or has expressed CD3 (CD3+) and T cell receptor (TCR+). T cells play a central role in cell-mediated immunity. T cells that "express" CD3 and TCR are engineered to eliminate CD3 and / or TCR cell surface expression.

[0101] As used herein, the term "TCR" or "T cell receptor" refers to a dimeric heterologous cell surface signaling protein that forms an α-β or γ-δ receptor or a combination thereof. αβTCR recognizes antigens presented by MHC molecules, while γδTCR can recognize antigens independent of MHC presentation.

[0102] The term "MHC" (major histocompatibility complex) refers to a subset of genes that encode cell surface antigen presenting proteins. In humans, these genes are called human leukocyte antigen (HLA) genes. In this article, the abbreviations MHC or HLA are used interchangeably.

[0103] As used herein, "prostate-specific membrane antigen" or "PSMA" refers to any native PSMA from any vertebrate source, including mammals, such as primates (e.g., humans, non-human primates, and rodents), unless otherwise indicated. The term encompasses "full-length" unprocessed PSMA as well as any form of PSMA produced by intracellular processing. The term also encompasses naturally occurring variants of PSMA, such as splice variants, allelic variants, and isoforms. PSMA is a type II membrane protein that was initially characterized by murine monoclonal antibody (mAb) 7E11-C5.3. The PSMA protein has a 3-part structure: an internal portion of 19 amino acids, a transmembrane portion of 24 amino acids, and an external portion (e.g., an extracellular domain) of 707 amino acids. An exemplary amino acid sequence of human PSMA is shown herein as SEQ ID NO: 150. An exemplary amino acid sequence of the extracellular domain of human PSMA is shown as SEQ ID NO: 151.

[0104] As used herein, "activation" refers to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cell" refers, among other things, to a T cell that is undergoing cell division.

[0105] The "costimulatory domain" in the context of the chimeric receptor of the present disclosure (also referred to herein as a chimeric antigen receptor (CAR)) enhances cell proliferation, cell survival and memory cell development of cytotoxic cells expressing chimeric receptors. The chimeric receptor of the present invention may include one or more costimulatory domains, which are selected from the costimulatory domains of proteins in the following TNFR superfamily: CD28, CD137 (4-1BB), CD134 (OX40), Dap10, CD27, CD2, CD7, CD5, ICAM-1, LFA-1 (CD1 la / CD18), Lck, TNFR-I, PD-1, TNFR-II, Fas, CD30, CD40, ICOS LIGHT, NKG2C, B7-H3 or a combination thereof. If the chimeric receptor includes more than one costimulatory domain, these domains may be arranged in series, optionally separated by a linker. The costimulatory domain is an intracellular domain that may be located between the (truncated or full-length) CD70 and the intracellular signaling domain within the chimeric receptor.

[0106] As used herein, the term "costimulatory domain" also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 20200129554; U.S. Patent Application No. 20200317777; WO2019010383; Li, W., et al., (2020) Immunity 53:456-470; and Li, G., et al., (2017) J Immunol 198(1 Supplement):198.4, the contents of each of which are incorporated herein in their entirety.

[0107] The "intracellular signaling domain" in the context of the chimeric receptors of the present disclosure converts effector function signals and directs cytotoxic cells to perform their specialized functions, i.e., to injure and / or destroy target cells. Examples of suitable intracellular signaling domains include, for example, the ζ chain of the T cell receptor complex or any homolog thereof, such as the η chain, FcsRly and β chain, MB 1 (Iga) chain, B29 (Ig) chain, etc., human CD3 ζ chain, CD3 polypeptide (Δ, δ and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.) and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. In an embodiment, the intracellular signaling domain of the chimeric receptor may be the human CD3 ζ chain, FcγRIII, FcsRI, the cytoplasmic tail of the Fc receptor, a cytoplasmic receptor carrying an immunoreceptor tyrosine activation motif (ITAM), and a combination thereof.

[0108] The intracellular signaling domain may include several types of intracellular signaling domains of various other immune signaling receptors, including but not limited to first, second, and third generation T cell signaling proteins, including CD3, B7 family co-stimulatory receptors, and tumor necrosis factor receptor (TNFR) superfamily receptors (Park et al., "Are all chimeric antigen receptors created equal?" J Clin Oncol., Vol. 33, pp. 651-653, 2015). Other intracellular signaling domains include signaling domains used by NK and NKT cells (Hermanson et al., "Utilizing chimeric antigen receptors to direct natural killer cell activity," Front Immunol., Vol. 6, p. 195, 2015), such as the signaling domain of NKp30 (B7-H6) (Zhang et al., "An NKp30-based chimeric antigen receptor promotes T cell effector functions and antitumor efficacy in vivo," J Immunol., Vol. 189, pp. 2290-2299, 2012) and DAP12 (Topfer et al., "DAP12-based activating chimeric antigen receptor for NK cell tumor immunotherapy," J Immunol., Vol. 194, pp. 3201-3212, 2015), NKG2D, NKp44, NKp46, DAP10, and CD3z. In addition, the intracellular signaling domain also includes the signaling domain of human immunoglobulin receptors containing immunoreceptor tyrosine-based activation motifs (ITAMs), such as FcgammaRI, FcgammaRIIA, FcgammaRIIC, FcgammaRIIIA, and FcRL5 (Gillis et al., "Contribution of Human Fc.gamma.Rsto Disease with Evidence from Human Polymorphisms and Transgenic Animal Studies," Front Immunol., Vol. 5, p. 254, 2014).

[0109] In an embodiment, the intracellular signaling domain comprises a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In an exemplary embodiment, the intracellular signaling domain in the chimeric receptor comprises a cytoplasmic signaling domain of human CD3 zeta. The term "intracellular signaling domain" as used herein also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 2020 / 0317777 and Roda-Navarro, P., and Reyburn, HT., (2009) J Biol Chem 284(24): 16463-16472; Giurisato, E., et al., (2007) Mol Cell Biol 27(24): 8583-8599; and Wu, J., et al., (2000) J Exp Med 192(7): 1059-1068, the contents of each of which are incorporated herein in their entirety.

[0110] The term "affinity binding entity" refers to an antigen that binds to a specific antigen with a higher affinity than that for a nonspecific antigen and that is endowed with at least 10 -6 The binding moiety has an affinity for 500 nM to 0.01 nM, 100 nM to 0.01 nM, 50 nM to 0.01 nM, 10 nM to 0.01 nM, 5 nM to 0.01 nM, as determined by assays well known in the art including surface plasmon resonance (SPR). According to specific embodiments, the affinity is 500 nM-0.01 nM, 100 nM-0.01 nM, 50 nM-0.01 nM, 10 nM-0.01 nM, 5 nM-0.01 nM.

[0111] According to an embodiment, the affinity binding entity is an antibody. The term "antibody" is used in the broadest sense and specifically covers, for example, a single anti-PSMA monoclonal antibody (including agonists, antagonists, neutralizing antibodies, full-length or intact monoclonal antibodies), anti-PSMA antibody compositions with multi-epitope specificity, polyclonal antibodies, multivalent antibodies, multispecific antibodies formed from at least two intact antibodies (e.g., bispecific antibodies, as long as they exhibit the desired biological activity), single-chain anti-PSMA antibodies, and fragments of anti-PSMA antibodies (see below) (including Fab, Fab', F(ab')2 and Fv fragments), diabodies, single domain antibodies (sdAb), as long as they exhibit the desired biological or immunological activity. Anti-PSMA antibodies, and in particular fragments, also include portions of anti-PSMA antibodies (and combinations of portions of anti-PSMA antibodies, such as scFv) that can be used as targeting arms, which are directed to, for example, PSMA epitopes in the chimeric antigen receptors of the present disclosure. Such fragments are not necessarily proteolytic fragments, but rather portions of the polypeptide sequence that can confer target affinity. The term "immunoglobulin" (Ig) is used interchangeably herein with antibody. The antibody can be, for example, a human antibody, a humanized antibody and / or an affinity matured antibody.

[0112] Methods for preparing antibodies and antibody fragments are known in the art (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).

[0113] Antibodies can be produced by immunizing various animals, including mice, rats, rabbits, goats, primates, humans, and chickens, with target antigens, such as PSMA or PSMA peptide fragments containing anti-PSMA epitopes of the present disclosure. Antibodies can also be isolated from phage antibody libraries using techniques described, for example, in Clackson et al., Nature, 352:624-8 (1991) and Marks et al., J. Mol. Biol., 222:581-97 (1991). The antibodies or antigen-binding fragments of the present invention can be purified by methods known in the art, such as gel filtration, ion exchange, affinity chromatography, and the like. Affinity chromatography or any of a number of other techniques known in the art can be used to isolate polyclonal or monoclonal antibodies from, for example, serum, ascites, or hybridoma supernatants.

[0114] The terms "anti-PSMA antibody," "PSMA antibody," and "antibody that binds to PSMA" are used interchangeably. The anti-PSMA antibody preferably is capable of binding with sufficient affinity to enable the antibody to be used as a diagnostic and / or therapeutic agent, whether isolated or as part of a fusion protein, cell, or cellular composition.

[0115] An "isolated antibody" is an antibody that has been identified and separated and / or recovered from components of its natural environment. Contaminant components of its natural environment are substances that may interfere with the therapeutic use of the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.

[0116] The basic 4-chain antibody unit is a heterotetrameric glycoprotein consisting of two identical light (L) chains and two identical heavy (H) chains. In the case of IgG, the 4-chain unit is generally about 150,000 daltons. Each L chain is connected to the H chain by a covalent disulfide bond, and the two H chains are connected to each other by one or more disulfide bonds according to the H chain isotype. Each H chain and L chain also have regularly spaced intrachain disulfide bridges. Each H chain has a variable domain (VH) at the N-terminus, followed by three constant domains (CH) of each of the α and γ chains, and four CH domains of μ and ε isotypes. Each L chain has a variable domain (VL) at the N-terminus, followed by a constant domain (CL) at the other end. VL is aligned with VH, and CL is aligned with the first constant domain (CH1) of the heavy chain. It is believed that specific amino acid residues form the interface between the light chain and the heavy chain variable domain. VH and VL are paired together to form a single antigen binding site. For the structure and properties of different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6.

[0117] L chains from any vertebrate species can be classified into one of two distinct types, called κ and λ, based on the amino acid sequence of their constant domains. Immunoglobulins are classified into different classes or isotypes based on the amino acid sequence of the constant domain of their heavy chains (CH). There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains designated α, δ, ε, γ, and μ, respectively. γ and α classes are further divided into subclasses based on relatively minor differences in CH sequence and function, for example, humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2.

[0118] The "variable region" or "variable domain" of an antibody refers to the amino terminal domain of the heavy chain or light chain of an antibody. The variable domain of the heavy chain may be referred to as "VH" or "V H The variable domain of the light chain may be referred to as "VL" or "V L ”. These domains are usually the most variable parts of antibodies and contain the antigen binding site.

[0119] The term "variable" refers to the fact that some segments of the variable domain are very different in sequence between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody to its specific antigen. However, variability is not evenly distributed within the 110 amino acids of the variable domain. Instead, the V region is composed of relatively invariant fragments known as framework regions (FRs), which have 15-30 amino acids and are separated by shorter regions of extreme variability known as "hypervariable regions" each of which is about 9-12 amino acids long. The variable domains of natural heavy and light chains each contain four FRs, mainly in a β-folded configuration, connected by three hypervariable regions, which form a loop that connects the β-folded structure and forms a part of the β-folded structure in some cases. The hypervariable regions in each chain are tightly bound together by FRs and contribute to the formation of the antigen binding site of the antibody together with the hypervariable regions from another chain (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition, Public Health Service, National Institutes of Health, Bethesda, MD. (1991)).

[0120] A "complete" antibody is an antibody that comprises an antigen binding site as well as CL and at least heavy chain constant domains CH1, CH2 and CH3. The constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variants thereof. Preferably, the complete antibody has one or more effector functions.

[0121] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding region or one or more variable regions of an intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies (see U.S. Pat. No. 5,641,870, Example 2; Zapata et al., Protein Eng. 8(10):1057-62 (1995)); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. In one embodiment, the antibody fragment comprises the antigen binding site of the intact antibody, thereby retaining the ability to bind antigen. Also included among the anti-PSMA antibody fragments are portions of the anti-PSMA antibody (and combinations of portions of the anti-PSMA antibody, such as scFv) that can be used as targeting arms, which are directed to, for example, the PSMA epitopes in the chimeric antigen receptors of the present disclosure. Such fragments are not necessarily proteolytic fragments, but rather portions of the polypeptide sequence that can confer affinity to the target.

[0122] Papain digestion of antibodies produces two identical antigen-binding fragments, known as "Fab" fragments, and a residual "Fc" fragment (the name reflects the ability to crystallize easily). The Fab fragment consists of an intact L chain as well as the variable region domains of the H chain (VH) and the first constant domain (CH1) of one heavy chain. Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen binding site. Pepsin treatment of antibodies produces a single large F(ab')2 fragment, which roughly corresponds to two disulfide-linked Fab fragments with divalent antigen-binding activity and is still able to cross-link antigen. The Fab' fragment differs from the Fab fragment in having several additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteines from the hinge region of the antibody. Fab'-SH is herein the name for Fab' in which the cysteine ​​residues of the constant domains carry free thiol groups. F(ab')2 antibody fragments were originally produced as pairs of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0123] The Fc fragment comprises the carboxyl terminal portions of two H chains held together by disulfide bonds. The effector functions of an antibody are determined by sequences in the Fc region, which is also the part recognized by Fc receptors (FcR) found on certain types of cells.

[0124] "Fv" is the smallest antibody fragment containing a complete antigen recognition and binding site. This fragment consists of a dimer of a heavy chain variable region domain and a light chain variable region domain in tight non-covalent association. In a single-chain Fv (scFv) substance, a heavy chain variable domain and a light chain variable domain can be covalently linked by a flexible peptide linker, so that the light chain and the heavy chain can associate in a "dimer" structure similar to that in a double-chain Fv substance. Six hypervariable loops (3 loops each from the H chain and the L chain) are produced by the folding of these two domains, which contribute amino acid residues to antigen binding and confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three CDRs specific for an antigen) has the ability to recognize and bind to an antigen, although the affinity is lower than that of the entire binding site.

[0125] "Single-chain Fv", also abbreviated as "sFv" or "scFv", is an antibody fragment comprising VH and VL antibody domains connected into a single polypeptide chain. In an embodiment, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the sFv to form a desired structure for antigen binding. For a review of sFv, see, for example, Pluckthun, The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994); Borrebaeck 1995, see below. In one embodiment, an anti-PSMA antibody-derived scFv is used as a targeting arm for a CAR-modified immune cell as disclosed herein. With respect to scFv antibody fragments in which certain orders of VH and VL regions in the binding domain are explicitly or implicitly described, the present disclosure also includes alternative embodiments in which the order of the VH and VL regions is reversed (e.g., in an scFv or CAR comprising an scFv binding domain). Thus, for example, in an scFv or CAR comprising an scFv binding domain, a description of a VH-VL sequence also describes an alternative VL-VH sequence. In addition, for example, in an scFv or CAR comprising an scFv binding domain, a description of a VL-VH sequence also describes an alternative VH-VL sequence. The VH region and the VL region may be joined directly or by a peptide-encoded linker that connects the N-terminus of the VH to the C-terminus of the VL, or connects the C-terminus of the VH to the N-terminus of the VL.

[0126] scFv joints are usually rich in glycine to increase flexibility, and rich in serine or threonine to increase solubility. The joint can connect the heavy chain variable region and the light chain variable region of the extracellular antigen binding domain. Non-limiting examples of joints are disclosed in Shen et al., Anal.Chem.80 (6): 1910-1917 (2008) and WO 2014 / 087010, the contents of which are hereby incorporated by reference as a whole. Various joint sequences are known in the art, including but not limited to glycine serine (GS) joints, such as (GS) n, (GSGGS) n (SEQ ID NO: 275), (GGGS) n (SEQ ID NO: 276) and (GGGGS) n (SEQ ID NO: 277), wherein n represents an integer of at least 1. Exemplary linker sequences may include amino acid sequences, including but not limited to GG SG (SEQ ID NO: 278), GGSGG (SEQ ID NO: 279), GSGSG (SEQ ID NO: 280), GSGGG (SEQ ID NO: 281), GGGSG (SEQ ID NO: 282), GSSSG (SEQ ID NO: 283), GGGGS (SEQ ID NO: 284), GGGGSGGGGSGGGGS (SEQ ID NO: 154), etc. Those skilled in the art will be able to select appropriate linker sequences for use in the present invention. In one embodiment, the antigen-binding domains of the present invention comprise a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL are separated by a linker sequence having an amino acid sequence of GGGGSGGGGSGGGGS (SEQ ID NO: 154), which may be encoded by a nucleic acid sequence of GGAGGCGGAGGATCT GGTGGTGGTGGATCTGGCGGCGGAGGCTCT (SEQ ID NO: 155).

[0127] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population, i.e., except for possible naturally occurring mutations that may be present in small amounts, the individual antibodies constituting the population are identical. Monoclonal antibodies are highly specific and are directed to a single antigenic site. In addition, in contrast to polyclonal antibody preparations including different antibodies directed to different determinants (epitopes), each monoclonal antibody is directed to a single determinant on an antigen. The advantage of monoclonal antibodies in addition to their specificity is that they can be synthesized without being contaminated by other antibodies. The modifier "monoclonal" should not be interpreted as requiring antibodies to be produced by any particular method. For example, monoclonal antibodies that can be used in the present invention can be prepared by the hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or can be prepared using recombinant DNA methods in bacteria, eukaryotic animals or plant cells (e.g., U.S. Patent No. 4,816,567). "Monoclonal antibodies" can also be isolated from phage antibody libraries using, for example, the techniques described in Clackson et al., Nature, 352:624-8 (1991) and Marks et al., J. Mol. Biol., 222:581-97 (1991).

[0128] The term "hypervariable region", "HVR" or "HV" when used herein refers to a region of an antibody variable domain that is hypervariable in sequence and / or forms a structurally defined loop. Typically, an antibody comprises six hypervariable regions; three in VH (H1, H2, H3) and three in VL (L1, L2, L3). Many descriptions of hypervariable regions are in use and are covered herein. The Kabat complementarity determining region (CDR) is based on sequence variability and is the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, MD. (1991)). Chothia refers to the position of the structural loops (Chothia and Lesk J. Mol. Biol. 196: 901-917 (1987)). When numbering using the Kabat numbering convention, the ends of the Chothia CDR-H1 loop vary between H32 and H34, depending on the length of the loop (this is because the Kabat numbering scheme places the insertion at H35A and H35B; if both 35A and 35B are absent, the loop ends at 32; if only 35A is present, the loop ends at 33; if both 35A and 35B are present, the loop ends at 34). The AbM hypervariable region represents a compromise between the Kabat CDR and Chothia structural loops and is used by the AbM antibody modeling software of Oxford Molecular. The "contact" hypervariable region is based on an analysis of available complex crystal structures. The residues from each of these hypervariable regions are as follows.

[0129]

[0130] The hypervariable region may comprise the following "extended hypervariable region": 24-36 or 24-34 (L1), 46-56 or 50-56 (L2), and 89-97 (L3) in VL; and 26-35B (H1), 50-65, 47-65 or 49-65 (H2), and 93-102, 94-102, or 95-102 (H3) in VH. For each of these definitions, the variable domain residues are numbered according to Kabat et al., supra.

[0131] "Framework" or "FR" residues are those variable domain residues other than the hypervariable region residues as herein defined.

[0132] The term "variable domain residue numbering as in Kabat" or "amino acid position numbering as in Kabat" and variations thereof refer to the numbering system used for heavy chain variable domains or light chain variable domains in Kabat et al., supra for antibody compilations. Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to shortening of the FR or CDR of the variable domain or insertion into the FR or CDR of the variable domain. For example, the heavy chain variable domain may include a single amino acid insertion after residue 52 of H2 (residue 52a according to Kabat) and an inserted residue after heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c, etc. according to Kabat). For a given antibody, the Kabat numbering of the residues can be determined by sequence alignment in homologous regions of the antibody sequence with "standard" Kabat numbering.

[0133] When referring to residues in the variable domain (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain), the kabat numbering system is generally used (e.g., Kabat et al., supra). When referring to residues in the constant region of an immunoglobulin heavy chain, the "EU numbering system" or "EU index" is generally used (e.g., Kabat et al., EU index reported supra). The "EU index as in Kabat" refers to the residue numbering of human IgG1 EU antibodies. Unless otherwise specified herein, reference to the residue numbering in the variable domain of an antibody means that the residues are numbered by the Kabat numbering system.

[0134] A "blocking" antibody or "antagonist" antibody is an antibody that inhibits or reduces the biological activity of the antigen to which it binds. Preferred blocking antibodies or antagonist antibodies substantially or completely inhibit the biological activity of the antigen. In one embodiment, an anti-PSMA antibody is provided that is an antagonist antibody.

[0135] An antibody that "binds" an antigen or epitope of interest is one that binds to the antigen or epitope with sufficient affinity to be measurably different from nonspecific interactions. Specific binding can be measured, for example, by measuring the binding of a molecule compared to the binding of a control molecule, which is typically a molecule of similar structure that does not have binding activity.

[0136] As used herein, the term "antigen" or "Ag" is defined as a molecule that causes an immune response. This immune response may involve antibody production, or activation of specific immune competent cells, or both. Those skilled in the art will appreciate that any macromolecule, including proteins or peptides, may be used as an antigen.

[0137] The term "epitope" includes any protein determinant, lipid or carbohydrate determinant capable of specific binding to an immunoglobulin or T cell receptor. Epitope determinants are usually composed of reactive surface groups of molecules (such as amino acids, lipids or sugar side chains) and usually have specific three-dimensional structural characteristics as well as specific charge characteristics. Exemplary epitopes of certain anti-PSMA antigen binding domains according to the present invention are Fig.18B Shown in.

[0138] As used herein, the term "specific binding" refers to a receptor (which may include but is not limited to an antibody or antibody fragment) that recognizes a specific molecule / ligand, but does not substantially recognize or bind to other molecules in the sample. For example, a receptor that specifically binds to a molecule from one species may also bind to the molecule from one or more other species. However, this cross-species reactivity itself does not change a specific classification. In another example, a receptor that specifically binds to a molecule may also bind to different allelic forms of the molecule. However, this cross-reactivity itself does not change a specific classification. In some cases, the term "specific binding" or "specifically binding" may be used to refer to the interaction of a protein (or peptide) with a second chemical substance, meaning that the interaction depends on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical substance; for example, the receptor recognizes and binds to a specific structure rather than a common protein. If the receptor is specific for epitope "A", then in a reaction containing labeled "A" and a receptor, the presence of a molecule containing epitope A (or free unlabeled A) will reduce the amount of labeled A bound to the receptor.

[0139] In embodiments, specific binding may be at least about 1×10 -8 The specific binding of a molecule may be characterized by an equilibrium dissociation constant of M or less (eg, a smaller KD indicates tighter binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

[0140] As used herein, the term "anti-tumor effect" refers to a biological effect that can be manifested by a reduction in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancerous conditions. "Anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the present invention to initially prevent tumorigenesis.

[0141] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma), neuroendocrine tumors, mesothelioma, schwannoma, meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies. Cancer may include, but is not limited to, prostate cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, stomach cancer, breast cancer, ovarian cancer, kidney cancer, prostate cancer, bladder cancer, melanoma, and glioma.

[0142] As used herein, the term "autologous" refers to any material derived from an individual that is subsequently reintroduced into the same individual.

[0143] As used herein, the term "allogeneic" refers to material derived from an animal that is subsequently introduced into a different animal of the same species.

[0144] As used herein, "modification" of an amino acid residue / position refers to a change in the primary amino acid sequence compared to the starting amino acid sequence, wherein the change is caused by a sequence change involving the amino acid residue / position. For example, a typical modification includes a residue (or at the position) being replaced with another amino acid (e.g., conservative or non-conservative substitution), inserting one or more (usually less than 5 or 3) amino acids adjacent to the residue / position, and deleting the residue / position. "Amino acid substitution" or its variants refers to replacing an existing amino acid residue in a predetermined (starting) amino acid sequence with a different amino acid residue. Typically, compared to a polypeptide comprising an initial (or "wild type") amino acid sequence, modification results in a change in at least one physical and biochemical activity of the variant polypeptide. For example, in the case of an antibody, the physical and biochemical activity that is changed may be binding affinity, binding capacity, and / or binding effect to a target molecule.

[0145] As used herein, the term "treating or preventing" a disease means reducing the frequency or severity of at least one sign or symptom of a disease or condition experienced by a subject. In one example, therapy (e.g., administering a therapeutic agent of the present disclosure) treats a disease or condition by reducing one or more signs or symptoms associated with the disease or condition, such as compared to the response in the absence of therapy. For example, administration of a therapeutic agent may provide an anti-tumor effect that reduces one or more signs or symptoms associated with cancer. Treatment or prevention may refer to delaying the onset of symptoms, alleviating the severity of symptoms, alleviating the severity of acute attacks, reducing the number of symptoms, reducing the incidence of disease-related symptoms, reducing the latency of symptoms, improving symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, preventing disease recurrence, reducing the number or frequency of recurrent attacks, increasing the latency between symptom onsets, increasing the time of sustained progression, accelerating remission, inducing remission, enhancing remission, accelerating recovery, or improving the efficacy of alternative therapies or reducing resistance to alternative therapies. In one embodiment, "treatment" refers to therapeutic treatment and preventive or preventive measures, wherein the purpose is to prevent or alleviate target pathological disorders or conditions as described herein.

[0146] As used herein, the term "administering" means providing or giving one or more agents to a subject, such as an agent that treats one or more signs or symptoms associated with a disorder / condition or disease, including, but not limited to, cancer (e.g., lymphoma), viral infection, bacterial infection, etc., by any effective route. Exemplary routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes. Administration "in combination with one or more additional therapeutic agents" includes simultaneous (concurrent) administration and sequential administration in any order.

[0147] As used herein, the term "pharmaceutically acceptable" refers to a material (including but not limited to salt, carrier or diluent) that does not eliminate the biological activity or characteristics of a compound, and is relatively nontoxic, i.e., the material can be applied to an individual without causing an undesirable biological effect or interacting with any component contained in the composition in a harmful manner. Pharmaceutically acceptable carriers (vehicles) that can be used for the present disclosure are conventional. Remington's Pharmaceutical Sciences, by E.W.Martin, Mack Publishing Co., Easton, Pa., 19th edition (1995), describes compositions and preparations suitable for drug delivery of one or more agents (such as one or more regulators). Generally speaking, the properties of the carrier depend on the specific mode of administration adopted. For example, parenteral preparations may include injectable fluids, which include pharmaceutically and physiologically acceptable fluids (such as water, saline, balanced salt solution, dextrose aqueous solution, glycerol, etc.) as vehicles. In addition to the biological neutral carrier, the medicament to be administered may contain a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, preservatives and pH buffers, etc., for example, sodium acetate or sorbitan monolaurate, sodium lactate, potassium chloride, calcium chloride and triethanolamine oleate. For example, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and, for example, γδT cells as described herein, preferably γδT cells engineered to express a CAR against PSMA.

[0148] "Encoding" refers to the inherent properties and biological properties resulting from the specific sequence of nucleotides in a polynucleotide (such as a gene, cDNA or mRNA) that serves as a template for synthesizing other polymers and macromolecules with a defined nucleotide sequence (i.e., rRNA, tRNA and mRNA) or a defined amino acid sequence in a biological process. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, the gene encodes the protein. The coding strand of the nucleotide sequence that is identical to the mRNA sequence and is usually provided in the sequence table and the non-coding strand used as a transcription template for a gene or cDNA can both be referred to as encoding a protein or other product of the gene or cDNA.

[0149] "Isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein may exist in a substantially pure form, or may exist in a non-natural environment such as, for example, a host cell.

[0150] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNA may contain introns.

[0151] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0152] "Expression cassette" refers to a nucleic acid comprising an expression control sequence operably linked to a nucleic acid encoding a transcript or polypeptide to be expressed. The expression cassette comprises sufficient cis-acting expression elements; other expression elements may be provided by the host cell or in an in vitro expression system. The expression cassette may be a component of a vector such as a cosmid, a plasmid (e.g., naked or contained in a liposome), or a virus (e.g., a lentivirus, a retrovirus, an adenovirus, and an adeno-associated virus). The expression cassette may be in a host cell (such as a γδ T cell).

[0153] II. Compositions and Methods of the Invention

[0154] A. Anti-PSMA Antibodies

[0155] In one embodiment, the invention provides anti-PSMA antibodies that can be used as therapeutic agents herein. Exemplary antibodies include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized antibodies, and human antibodies.

[0156] 1. Polyclonal Antibodies

[0157] Polyclonal antibodies can be produced in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It may be useful to conjugate the relevant antigen (particularly when synthetic peptides are used) to a protein that is immunogenic in the species to be immunized. For example, the antigen can be conjugated to keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using bifunctional or derivatizing agents such as maleimidobenzoyl sulfosuccinimide ester (conjugated through cysteine ​​residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCl2, or R'N═C═NR, where R and R1 are different alkyl groups.

[0158] Animals are immunized against the antigen, immunogenic conjugate or derivative by combining, for example, 100 μg or 5 μg of protein or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites. One month later, the animals are boosted with 1 / 5 to 1 / 10 of the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later, the animals are bled and the antibody titer of the serum is determined. The animals are boosted until the titer reaches a stable level. The conjugates can also be prepared as protein fusions in recombinant cell culture. In addition, aggregating agents such as alum are suitably used to enhance the immune response.

[0159] 2. Monoclonal Antibodies

[0160] Monoclonal antibodies (mAbs) against the antigen of interest can be prepared by using any technique known in the art. These techniques include, but are not limited to, the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 495-497), human B cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4: 72), and EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Selective lymphocyte antibody method (SLAM) (Babcook, JS et al., A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. Proc Natl Acad Sci SA, 1996. 93 (15): p. 7843-8.) and (McLean G et al., 2005, J Immunol. 174 (8): 4768-78. Such antibodies may belong to any immunoglobulin class, including IgG, IgM, IgE, IgA and IgD and any subclass thereof. Hybridomas producing mAbs used in the present invention may be cultured in vitro or in vivo.

[0161] Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or may be made by recombinant DNA methods (US Pat. No. 4,816,567).

[0162] In the hybridoma method, mice or other appropriate host animals such as hamsters are immunized as described above to obtain lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes can be immunized in vitro. After immunization, lymphocytes are isolated and then fused with a myeloma cell line using a suitable fusing agent (such as polyethylene glycol) to form hybridoma cells (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)).

[0163] The hybridoma cells thus prepared are seeded and grown in an appropriate culture medium that may contain one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells (also referred to as the fusion partner). For example, if the parental myeloma cells lack the enzyme, hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), then the selective culture medium for the hybridomas will typically include hypoxanthine, aminopterin, and thymidine (HAT medium), which prevent the growth of cells lacking HGPRT.

[0164] Preferred fusion partner myeloma cells are those that fuse effectively, support the selected antibody-producing cells to stably produce antibodies at high levels, and are sensitive to the selective medium selected for the unfused parental cells. Preferred myeloma cell lines are murine myeloma cell lines, such as those derived from MOPC-21 and MPC-11 mouse tumors, which are available from the Salk Institute Cell Distribution Center, San Diego, Calif. USA; and SP-2 and derivatives, such as X63-Ag8-653 cells available from the American Type Culture Collection, Manassas, Va., USA. Human myeloma and mouse-human heteromyeloma cell lines have also been described for producing human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).

[0165] Culture medium in which hybridoma cells are grown is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

[0166] The binding affinity of the monoclonal antibody can be determined, for example, by Scatchard analysis as described in Munson et al., Anal. Biochem. 107:220 (1980).

[0167] Once hybridoma cells producing antibodies of the desired specificity, affinity and / or activity are identified, clones can be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, hybridoma cells can be grown in vivo as ascites tumors in animals, for example, by injecting the cells intraperitoneally into mice.

[0168] The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional antibody purification procedures such as affinity chromatography (e.g., using protein A or protein G-agarose) or ion exchange chromatography, hydroxyapatite chromatography, gel electrophoresis, dialysis, and the like.

[0169] DNA encoding monoclonal antibodies is easily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that specifically bind to genes encoding the heavy and light chains of mouse antibodies). Hybridoma cells are used as a preferred source of such DNA. Once isolated, the DNA can be placed in an expression vector, which is then transfected into a host cell, such as an E. coli cell, a monkey COS cell, a Chinese hamster ovary (CHO) cell, or a myeloma cell that does not otherwise produce antibody protein, to obtain the synthesis of monoclonal antibodies in a recombinant host cell. Review articles on recombinant expression of DNA encoding antibodies in bacteria include Skerra et al., Curr. Opinion in Immunol. 5: 256-62 (1993) and Plückthun, Immunol. Rev. 130: 151-88 (1992).

[0170] In another embodiment, monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries produced using the techniques described in McCafferty et al., Nature, 348: 552-54 (1990). Clackson et al., Nature, 352: 624-28 (1991) and Marks et al., J. Mol. Biol., 222: 581-97 (1991) describe the use of phage libraries to separate mouse antibodies and human antibodies, respectively. Subsequent publications describe the production of high-affinity (nM range) human antibodies as a strategy for constructing very large phage libraries by chain shuffling (Marks et al., Bio / Technology, 10: 779-83 (1992)) and combined infection and in vivo recombination (Waterhouse et al., Nuc. Acids. Res. 21: 2265-6 (1993)). Therefore, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolating monoclonal antibodies.

[0171] The DNA encoding the antibody can be modified to produce chimeric or fusion antibody polypeptides, for example, by substituting the human heavy and light chain constant domains (CH and CO sequences) for the homologous murine sequences (U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851 (1984)), or by fusing the immunoglobulin coding sequence with all or part of the coding sequence for a non-immunoglobulin polypeptide (heterologous polypeptide). The non-immunoglobulin polypeptide sequences can replace the constant domains of the antibody, or they can replace the variable domains of one antigen-binding site of the antibody to produce a chimeric bivalent antibody comprising one antigen-binding site having specificity for an antigen and another antigen-binding site having specificity for a different antigen.

[0172] 3. Chimeric antibodies, humanized antibodies and human antibodies

[0173] In an embodiment, the anti-PSMA antibody is a chimeric antibody. Certain chimeric antibodies are described, for example, in U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-5 (1984). In one example, a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate such as a monkey) and a human constant region. In another example, a chimeric antibody is a "class switched" antibody in which the class or subclass has been changed from that of a parent antibody. Chimeric antibodies include antigen-binding fragments thereof.

[0174] In embodiments, chimeric antibodies are humanized antibodies. Typically, non-human antibodies are humanized to reduce immunogenicity to people while retaining the specificity and affinity of the parent non-human antibody. Typically, humanized antibodies include one or more variable domains, wherein HVR, such as CDR (or a portion thereof) are derived from non-human antibodies, and FR (or a portion thereof) are derived from human antibody sequences. Humanized antibodies are optionally also comprised of at least a portion of a human constant region. In embodiments, some FR residues in humanized antibodies are replaced by corresponding residues from non-human antibodies (e.g., antibodies from which CDR residues are derived), for example, to restore or improve antibody specificity or affinity.

[0175] The anti-PSMA antibodies of the present invention may comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., mouse or rabbit) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) that contain minimal sequences derived from non-human immunoglobulins. Humanized antibodies include human immunoglobulins (recipient antibodies) in which residues from the complementary determining regions (CDRs) of the receptor are replaced with residues from CDRs of non-human species (donor antibodies) such as mice, rats or rabbits with the desired specificity, affinity and capacity. In some cases, Fv framework residues of human immunoglobulins are replaced with corresponding non-human residues. Humanized antibodies may also contain residues that are not found in the receptor antibody or in the imported CDR or framework sequences. In general, humanized antibodies will contain substantially all of at least one, usually two, variable domains, wherein all or substantially all of the CDR regions correspond to the CDR regions of non-human immunoglobulins, and all or substantially all of the FR regions are FR regions of human immunoglobulin consensus sequences. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321:522-5 (1986); Riechmann et al., Nature, 332:323-9 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-6 (1992)).

[0176] The humanized antibodies of the present invention may include one or more human and / or human consensus non-hypervariable region (e.g., framework) sequences in their heavy chain and / or light chain variable domains. In an embodiment, there are one or more additional modifications in human and / or human consensus non-hypervariable region sequences. In one embodiment, the heavy chain variable domain of an antibody of the present invention includes a consensus framework sequence for humans, which in one embodiment is a consensus framework sequence for subgroup III. In one embodiment, an antibody of the present invention includes a consensus framework sequence for a variant subgroup III modified at at least one amino acid position.

[0177] As known in the art, the amino acid position / boundary defining the hypervariable region of an antibody can vary, depending on the context and various definitions known in the art. Some positions in the variable domain can be considered as hybrid hypervariable positions, because these positions can be considered as being in the hypervariable region under a set of standards, and are considered as being outside the hypervariable region under another set of standards. One or more of these positions can also be found in the hypervariable region of extension (as further defined below). The invention provides antibodies comprising modifications in these hybrid hypervariable positions. In one embodiment, these hypervariable positions include one or more positions 26-30, 33-35B, 47-49, 57-65, 93, 94, and 101-102 in the heavy chain variable domain. In one embodiment, these hybrid hypervariable positions include one or more of positions 24-29, 35-36, 46-49, 56, and 97 in the light chain variable domain. In one embodiment, the antibody of the present invention is included in the human variant human subgroup consensus framework sequence modified at one or more hybrid hypervariable positions.

[0178] The antibodies of the invention may comprise any suitable human or human consensus light chain framework sequence, so long as the antibody exhibits the desired biological properties (e.g., desired binding affinity). In one embodiment, the antibodies of the invention comprise at least a portion (or all) of the framework sequence of a human κ light chain. In one embodiment, the antibodies of the invention comprise at least a portion (or all) of the human κ subgroup I framework consensus sequence.

[0179] Methods for humanizing non-human antibodies are well known in the art. As discussed, humanized antibodies generally have one or more amino acid residues introduced therein from a non-human source. These non-human amino acid residues are generally referred to as "import" residues, which are generally taken from the "import" variable domain. Humanization can be performed essentially according to the method of Winter and colleagues (Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)), by replacing the corresponding sequence of a human antibody with a rodent CDR or CDR sequence. Therefore, this type of "humanized" antibody is a chimeric antibody (U.S. Patent No. 4,816,567), in which substantially less than a complete human variable domain has been replaced by a corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

[0180] When the antibody is intended for human therapeutic use, the choice of human variable domains (both light and heavy chains) to be used in making the humanized antibodies is very important to reduce antigenicity and HAMA response (human anti-mouse antibody). Reduction or elimination of the HAMA response is an important aspect of the clinical development of suitable therapeutic agents (see, e.g., Khaxzaeli et al., J. Natl. Cancer Inst. (1988), 80:937; Jaffers et al., Transplantation (1986), 41:572; Shawler et al., J. Immunol. (1985), 135:1530; Sears et al., J. Biol. Response Mod. (1984), 3:138; Miller et al., Blood (1983), 62:988; Hakimi et al., J. Immunol. (1991), 147:1352; Reichmann et al., Nature (1988), 332:323; Junghans et al., Cancer Res. (1990), 50:1495). As described herein, the present invention provides humanized antibodies such that the HAMA response is reduced or eliminated. Variants of these antibodies can be further obtained using conventional methods known in the art, some of which are further described below. According to the so-called "best fit" method, the sequence of the variable domain of a rodent antibody is screened for the entire library of known human variable domain sequences. The human V domain sequence closest to the rodent is confirmed, and the human framework region (FR) therein is accepted for humanized antibodies (Sims et al., J. Immunol. 151: 2296 (1993); Chothia et al., J. Mol. Biol., 196: 901 (1987)). Another method uses a specific framework region of the consensus sequence of all human antibodies derived from a specific light chain or heavy chain subgroup. The same framework can be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89: 4285 (1992); Presta et al., J. Immunol. 151: 2623 (1993)).

[0181] For example, the amino acid sequence from an antibody as described herein can be used as a diversified starting (parent) sequence for a framework and / or hypervariable sequence. The selected framework sequence to which the starting hypervariable sequence is connected is referred to herein as an acceptor human framework. Although the acceptor human framework can be derived from or is derived from human immunoglobulin (its VL and / or VH region), it is preferred that the acceptor human framework is derived from or is derived from a human consensus framework sequence, because such frameworks have been shown to have minimal immunogenicity or no immunogenicity in human patients.

[0182] In cases where the acceptor is derived from a human immunoglobulin, a human framework sequence can optionally be selected based on its homology to the donor framework sequence by aligning the donor framework sequence with various human framework sequences in a collection of human framework sequences and selecting the most homologous framework sequence as the acceptor.

[0183] In one embodiment, the human consensus framework herein is from or derived from a VH subgroup III and / or VL kappa subgroup I consensus framework sequence.

[0184] Although the receptor can be identical in sequence to the selected human framework sequence, whether it is from a human immunoglobulin or a human consensus framework, the invention contemplates that the receptor sequence can contain pre-existing amino acid substitutions relative to the human immunoglobulin sequence or the human consensus framework sequence. These pre-existing substitutions are preferably minimal; typically only four, three, two or one amino acid differences relative to the human immunoglobulin sequence or the consensus framework sequence.

[0185] The hypervariable region residues of the non-human antibody are incorporated into the VL and / or VH acceptor human framework. For example, residues corresponding to Kabat CDR residues, Chothia hypervariable loop residues, Abm residues and / or contact residues can be incorporated. Optionally, the following extended hypervariable region residues are incorporated: 24-34 (L1), 50-56 (L2) and 89-97 (L3), 26-35B (H1), 50-65, 47-65 or 49-65 (H2) and 93-102, 94-102 or 95-102 (H3).

[0186] Although "incorporation" of hypervariable region residues is discussed herein, it will be appreciated that this can be accomplished in a variety of ways, for example, by mutating a nucleic acid encoding a mouse variable domain sequence to produce a nucleic acid encoding the desired amino acid sequence such that the framework residues are changed to acceptor human framework residues, or by mutating a nucleic acid encoding a human variable domain sequence such that the hypervariable domain residues are changed to non-human residues, or by synthesizing a nucleic acid encoding the desired sequence, etc.

[0187] As described herein, hypervariable region grafted variants can be generated by Kunkel mutagenesis of nucleic acids encoding human receptor sequences, using separate oligonucleotides for each hypervariable region. Kunkel et al., Methods Enzymol. 154: 367-382 (1987). Appropriate changes can be introduced into the framework and / or hypervariable regions to correct and reestablish appropriate hypervariable region-antigen interactions using conventional techniques.

[0188] Phage(mid) display (also referred to herein as phage display in some cases) can be used as a convenient and rapid method for producing and screening many different potential variant antibodies in a library generated by sequence randomization. However, methods for preparing and screening altered antibodies are available to the skilled person.

[0189] Phage (mid) display technology provides a powerful tool for the production and selection of novel proteins that bind to ligands such as antigens. The use of phage (mid) display technology allows the generation of large libraries of protein variants that can quickly sort those sequences that bind to target molecules with high affinity. Usually, the nucleic acid encoding the variant polypeptide is fused with the nucleic acid sequence encoding the viral coat protein such as gene III protein or gene VIII protein. Monovalent phagemid display systems have been developed in which the nucleic acid sequence encoding the protein or polypeptide is fused with the nucleic acid sequence encoding a portion of the gene III protein. (Bass, S., Proteins, 8: 309 (1990); Lowman and Wells, Methods: A Companion to Methods in Enzymology, 3: 205 (1991)). In the monovalent phagemid display system, the gene fusion is expressed at a low level, and the wild-type gene III protein is also expressed, so that the infectivity of the particles is retained. Methods for generating peptide libraries and screening these libraries have been disclosed in numerous patents (eg, U.S. Pat. No. 5,723,286, U.S. Pat. No. 5,432,018, U.S. Pat. No. 5,580,717, U.S. Pat. No. 5,427,908, and U.S. Pat. No. 5,498,530).

[0190] Libraries of antibodies or antigen-binding polypeptides have been prepared in a variety of ways, including by inserting random DNA sequences to change a single gene or by cloning a family of related genes. Methods for displaying antibodies or antigen-binding fragments using phage (mid) display have been described in U.S. Patents Nos. 5,750,373, 5,733,743, 5,837,242, 5,969,108, 6,172,197, 5,580,717, and 5,658,727. Libraries of antibodies or antigen-binding proteins expressing desired properties are then screened.

[0191] Methods for substituting selected amino acids into template nucleic acids are well established in the art, some of which are described herein. For example, methods for introducing modifications into nucleic acid sequences can include the use of various commercially available kits (e.g., QuickChange site-directed mutagenesis kit, Agilent, Santa Clara, CA). As another example, hypervariable region residues can be substituted using the Kunkel method (e.g., Kunkel et al., Methods Enzymol. 154:367-382 (1987)).

[0192] Importantly, the antibody is humanized, retaining high binding affinity to the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by analyzing the process of parental sequences and various conceptual humanized products using three-dimensional models of parental sequences and humanized sequences. Three-dimensional immunoglobulin models are generally available and are familiar to those skilled in the art. Computer programs that illustrate and display the possible three-dimensional conformational structures of selected candidate immunoglobulin sequences can be obtained. Inspection of these displays allows analysis of the possible role of residues in the functioning of candidate immunoglobulin sequences, i.e., analysis of residues that affect the ability of candidate immunoglobulins to bind their antigens. In this way, FR residues can be selected from receptors and imported sequences and combined to obtain desired antibody properties, such as achieving increased affinity for target antigens. In general, hypervariable region residues directly and most substantially participate in affecting antigen binding.

[0193] Various forms of humanized anti-PSMA antibodies are contemplated. For example, the humanized antibody can be an antibody fragment, such as Fab. Alternatively, the humanized antibody can be a complete antibody, such as a complete IgG1 antibody.

[0194] As an alternative to humanization, human antibodies can be produced. For example, it is now possible to produce transgenic animals (e.g., mice) that are able to produce a complete human antibody repertoire in the absence of endogenous immunoglobulin production after immunization. For example, homozygous deletions of antibody heavy chain joining region (JH) genes in chimeric and germline mutant mice have been described to result in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array into such germ-line mutant mice will result in the production of human antibodies upon antigen challenge (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-8 (1993); Bruggemann et al., Year in Immuno. 7:33 (1993); U.S. Pat. Nos. 5,545,806; 5,569,825; 5,591,669; 5,545,807; and WO 97 / 17852).

[0195] Alternatively, phage display technology (McCafferty et al., Nature 348:552-53 (1990)) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable (V) domain gene libraries from unimmunized donors. According to this technology, antibody V domain genes are cloned in-frame into the major or minor coat protein genes of filamentous phages (such as M13 or fd) and displayed as functional antibody fragments on the surface of phage particles. Because filamentous particles contain single-stranded DNA copies of phage genomes, selection based on the functional properties of antibodies also leads to selection of genes encoding antibodies that exhibit these properties. Therefore, phages simulate some characteristics of B cells. Phage display can be performed in a variety of forms, and reviews are found in, for example, Johnson, Kevin S and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). V gene segments from several sources can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated a variety of anti-oxazolone antibodies from a small random combinatorial library of V genes from the spleen of immunized mice. V gene libraries from unimmunized human donors can be constructed and antibodies to a variety of antigens (including self-antigens) can be isolated essentially according to the techniques described by Marks et al., J. Mol. Biol. 222:581-97 (1991) or Griffith et al., EMBO J. 12:725-34 (1993) (see also U.S. Pat. Nos. 5,565,332 and 5,573,905).

[0196] Human antibodies can also be generated by in vitro activated B cells (see, eg, US Pat. Nos. 5,567,610 and 5,229,275).

[0197] Thus, in embodiments, transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system can be used to generate such human monoclonal antibodies to PSMA.

[0198] HuMAb Mouse TM (Medarex, Inc.) contains a human immunoglobulin gene minilocus encoding unrearranged human heavy chain (μ and γ) and κ light chain immunoglobulin sequences, as well as targeted mutations that inactivate the endogenous μ and κ chain loci (see, e.g., Lonberg et al., (1994) Nature 368(6474):856-9). Thus, the mice exhibit reduced expression of mouse IgM or κ, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to produce high-affinity human IgGκ monoclonal antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49-101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. 13:65-93; and Harding, F. and Lonberg, N. (1995) Ann. NY Acad. Sci. 764:536-46). HuMAb Mouse is further described in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295; Chen, J. et al. (1993) International Immunology 5:647-656; Tuaillon et al. (1993) Proc. Natl. Acad. Sci. USA 90:3720-4; Choi et al. (1993) Nature Genetics 4:117-23; Chen, J. et al. (1993) EMBO J. 12:21-830; Tuaillon et al., (1994) J. Immunol. 152:2912-20; Taylor, L. et al. (1994) International Immunology 6:579-91; and Fishwild, D. et al. (1996) Nature Biotechnology 14:845-51. TMThe preparation and use of mice, and the genomic modifications carried by such mice, the contents of all of which are hereby expressly incorporated by reference in their entirety. See also, U.S. Pat. Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299; and 5,770,429; U.S. Pat. No. 5,545,807; PCT Publications WO 92 / 03918, WO 93 / 12227, WO 94 / 25585, WO 97 / 13852, WO 98 / 24884, and WO 99 / 45962; and PCT Publication WO 01 / 14424.

[0199] In another embodiment, a mouse or mouse interface called "KM Mouse" may be used. TM The human antibodies of the present disclosure are produced by using mice that carry human immunoglobulin sequences on a transgene and a transchromosome, as described in detail in PCT Publication WO 02 / 43478.

[0200] In another embodiment, an alternative transgenic system known as the Xenomouse (Abgenix, Inc.) can be used; such mice are described, for example, in U.S. Pat. Nos. 5,939,598; 6,075,181; 6,114,598; 6,150,584; and 6,162,963.

[0201] Additional related transchromosomal animal systems expressing human immunoglobulin genes are available in the art and can be used to produce the anti-PSMA antibodies of the present disclosure. For example, mice carrying both human heavy chain transchromosomes and human light chain transchromosomes, referred to as "TC mice," can be used; such mice are described in Tomizuka et al. (2000) Proc. Natl. Acad. Sci. USA 97:722-7. As another example, cows carrying human heavy and light chain transchromosomes have been described in the art (e.g., Kuroiwa et al. (2002) Nature Biotechnology 20:889-94 and PCT Application No. WO 2002 / 092812) and can be used to produce the anti-PSMA antibodies of the present disclosure. Other examples of transgenic animals that can be used to produce anti-PSMA antibodies include OmniRat TM and OmniMouse TM(See, e.g., Osborn M. et al. (2013) Journal of Immunology 190:1481-90; Ma B. et al. (2013) Journal of Immunological Methods 400-401:78-86; Geurts A. et al. (2009) Science 325:433, U.S. Pat. No. 8,907,157; ​​European Patent No. 2152880B1; European Patent No. 2336329B1). Yet another example includes the use of Technology (see, e.g., U.S. Pat. No. 6,596,541, Regeneron Pharmaceuticals, ). In short, The technology involves producing a transgenic mouse with a genome comprising human heavy and light chain variable regions operably linked to endogenous mouse constant region loci, so that the mouse produces antigen-binding proteins, such as antibodies, comprising human variable regions and mouse constant regions in response to antigenic stimulation. DNA encoding the variable regions of the heavy and light chains of the antibodies is separated and operably linked to DNA encoding human heavy and light chain constant regions. The DNA is then expressed in cells capable of expressing fully human antibodies.

[0202] 4. Antibody fragments

[0203] Embodiments of the present disclosure encompass antibody fragments.

[0204] A variety of techniques for producing antibody fragments have been developed. Traditionally, these fragments are obtained via proteolytic digestion of intact antibodies (see, for example, Morimoto et al., Journal of Biochemical and Biophysical Methods 24: 107-7 (1992); and Brennan et al., Science, 229: 81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and scFv antibody fragments can all be expressed in Escherichia coli and secreted therefrom, thus allowing large amounts of these fragments to be easily produced. Antibody fragments can be isolated from the antibody phage library discussed above. Alternatively, Fab′-SH fragments can be directly recovered from Escherichia coli and chemically coupled to form F(ab′)2 fragments (Carter et al., Bio / Technology 10: 163-7 (1992)). According to another method, F(ab′)2 fragments can be isolated directly from recombinant host cell cultures. Fab and F(ab')2 fragments with increased in vivo half-life are described in U.S. Patent No. 5,869,046, which contain salvage receptor binding epitope residues. Other techniques for producing antibody fragments will be apparent to the skilled person. In other embodiments, the antibody of choice is a single-chain Fv fragment (scFv) (see WO 93 / 16185; U.S. Patent No. 5,571,894; and U.S. Patent No. 5,587,458). Fv and sFv are the only species with complete binding sites lacking constant regions; therefore, they are suitable for reduced nonspecific binding during in vivo use. sFv fusion proteins can be constructed to produce fusions of effector proteins at the amino or carboxyl termini of sFv (see Antibody Engineering, Borrebaeck, ed., supra). Antibody fragments can also be "linear antibodies", for example, as described in U.S. Patent No. 5,641,870.

[0205] In one embodiment, scFv derived from anti-PSMA antibodies is used in the CAR of the present disclosure. Anti-PSMA antibody fragments include portions of anti-PSMA antibodies that can be used as targeting arms (and combinations of portions of anti-PSMA antibodies, such as scFv), which are directed to PSMA epitopes in one or more CAR-modified immune cells of the present disclosure. Such fragments are not necessarily proteolytic fragments, but portions of polypeptide sequences that can confer target affinity.

[0206] 5. Multispecific Antibodies

[0207] In any aspect of the present disclosure, the anti-PSMA antibodies provided herein are multispecific antibodies, such as bispecific antibodies. Bispecific antibodies are antibodies that have binding specificity for at least two different epitopes. Exemplary bispecific antibodies can bind to two different epitopes of the PSMA protein as described herein. Other such antibodies can combine the PSMA binding site with the binding site of another protein. In some examples, the anti-PSMA arm can be combined with an arm that binds to a trigger molecule on a leukocyte, such as a T cell receptor molecule (e.g., CD3) or an Fc receptor (FcγR) of IgG, such as FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), so as to focus and localize the cell defense mechanism to PSMA-expressing cells. Bispecific antibodies can also be used to localize cytotoxic agents to cells expressing PSMA. These antibodies have a PSMA binding arm and an arm that binds a cytotoxic agent (e.g., saporin, anti-interferon-α, vinca alkaloids, ricin A chain, methotrexate, or a radioactive isotope hapten). Bispecific antibodies can be prepared as full-length antibodies or antibody fragments (eg, F(ab')2 bispecific antibodies).

[0208] Methods for preparing bispecific antibodies are known in the art. The traditional production method of full-length bispecific antibodies is based on the coexpression of two immunoglobulin heavy chain-light chain pairs, wherein the two chains have different specificities (Millstein et al., Nature 305:537-9 (1983)). Due to the random assortment of immunoglobulin heavy chains and light chains, these hybridomas (quadruple tumors) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule usually completed by the affinity chromatography step is quite troublesome, and the product yield is low. Similar procedures are disclosed in WO 93 / 08829 and Traunecker et al., EMBO J.10:3655-3659 (1991).

[0209] Other methods for preparing bispecific antibodies are known. One method is the "knob into the hole" or "protrusion into the cavity" method (see, for example, U.S. Patent No. 5,731,168). In this method, two immunoglobulin polypeptides (e.g., heavy chain polypeptides) each comprise an interface. The interface of one immunoglobulin polypeptide interacts with the corresponding interface on another immunoglobulin polypeptide, thereby associating the two immunoglobulin polypeptides. These interfaces can be engineered so that the "knob" or "protrusion" (these terms are used interchangeably herein) located in the interface of one immunoglobulin polypeptide corresponds to the "hole" or "cavity" (these terms are used interchangeably herein) located in the interface of another immunoglobulin polypeptide. In an embodiment, the size of the hole is the same or similar to the knob, and is appropriately positioned so that when the two interfaces interact, the knob of one interface can be positioned in the corresponding hole of the other interface. Without being bound by theory, this is believed to stabilize heteropolymers and facilitate the formation of heteropolymers relative to other substances (e.g., homopolymers). In embodiments, this method can be used to promote heteromultimerization of two different immunoglobulin polypeptides, thereby generating a bispecific antibody comprising two immunoglobulin polypeptides with binding specificities for different epitopes.

[0210] According to different methods, antibody variable domains (antibody-antigen combination sites) with desired binding specificity are fused with immunoglobulin constant domain sequences. Fusion is preferably performed with immunoglobulin heavy chain constant domains, including at least part of hinge region, CH2 region and CH3 region. Typically, the first heavy chain constant region (CH1) contains the necessary site for light chain binding and is present in at least one of the fusions. DNA encoding immunoglobulin heavy chain fusions and (if necessary) immunoglobulin light chains are inserted into separate expression vectors and co-transfected into suitable host organisms. When three polypeptide chains with unequal ratios are used in the construction to provide optimal yields, this provides great flexibility for adjusting the mutual ratio of the three polypeptide fragments in the embodiment. However, when expressing at least two polypeptide chains in equal ratios to produce high yields or when the ratio has no special meaning, the coding sequences of two or all three polypeptide chains can be inserted into one expression vector.

[0211] In one embodiment of this method, the bispecific antibody is composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. Studies have found that this asymmetric structure is conducive to separating the desired bispecific compound from the unwanted immunoglobulin chain combination, because only half of the immunoglobulin light chain is present in the bispecific molecule, providing a simple separation method. This method is disclosed in WO 94 / 04690. For more details on the generation of bispecific antibodies, see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).

[0212] According to another approach described in WO96 / 27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers recovered from recombinant cell culture. One interface comprises the C H In some embodiments, the first antibody molecule is a first antibody molecule that is provided with a plurality of small amino acid side chains, each of which is a portion of a plurality of 3 domains. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced by larger side chains (e.g., tyrosine or tryptophan). By replacing the large amino acid side chains with smaller amino acid side chains (e.g., alanine or threonine), a compensating "cavity" that is the same or similar in size to the large side chain is produced on the interface of the second antibody molecule. This provides a mechanism for improving the yield of heterodimers relative to other unwanted final products (such as homodimers).

[0213] Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin and the other antibody can be coupled to biotin. For example, such antibodies have been proposed for targeting immune system cells to unwanted cells (U.S. Patent No. 4,676,980), and for treating HIV infection (WO91 / 00360, WO 92 / 200373 and EP 03089). Heteroconjugate antibodies can be prepared using any convenient cross-linking method. Suitable cross-linking agents are well known in the art and are disclosed in U.S. Patent No. 4,676,980, with many cross-linking techniques disclosed.

[0214] Techniques for producing bispecific antibodies from antibody fragments are also described in the literature. For example, chemical linkage can be used to prepare bispecific antibodies. Brennan et al., Science, 229:81 (1985) described a procedure in which an intact antibody is proteolytically cleaved to produce F(ab′) 2Fragments. These fragments are reduced in the presence of a dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The resulting Fab′ fragments are then converted into thionitrobenzoate (TNB) derivatives. One of the Fab′-TNB derivatives is then reconverted to Fab′-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of another Fab′-TNB derivative to form a bispecific antibody. The resulting bispecific antibody can be used as a selective immobilization agent for enzymes. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) described a fully humanized bispecific antibody F(ab′) 2 Production of molecules. Each Fab' fragment was individually secreted from E. coli and underwent directed chemical coupling in vitro to form the bispecific antibody.

[0215] Various techniques for preparing and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol., 148(5):1547-1553 (1992). Leucine zipper peptides from Fos and Jun proteins are linked to the Fab' portions of two different antibodies by gene fusion. Antibody homodimers are reduced to form monomers at the hinge region and then reoxidized to form antibody heterodimers. This method can also be used to produce antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993) provides an alternative mechanism for preparing bispecific antibody fragments. The fragments contain a light chain variable domain (V L ) connected to the heavy chain variable domain (V H ), the linker is too short to allow the two domains on the same chain to pair. H and V L The domain is forced to align with the complementary V L and V H The domains pair to form two antigen binding sites. Another strategy for preparing bispecific antibody fragments using single-chain Fv (sFv) dimers has also been reported. See Gruber et al., J. Immunol, 152: 5368 (1994).

[0216] Another technique for making bispecific antibody fragments is "bispecific T cell engagers" or Methods (see, e.g., WO2004 / 106381, WO2005 / 061547, WO2007 / 042261, and WO2008 / 119567). This method utilizes two antibody variable domains arranged on a single polypeptide. For example, a single polypeptide chain includes two single-chain Fv (scFv) fragments, each having a variable heavy chain (V H ) and variable light chain (V L ) domains, the two domains being separated by a polypeptide linker of sufficient length to enable intramolecular association between the two domains. The single polypeptide further comprises a polypeptide spacer sequence between the two scFv fragments. Each scFv recognizes a different epitope, and these epitopes may be specific to different cell types, so that when each scFv engages with its cognate epitope, cells of two different cell types are brought close together or tethered together. A specific embodiment of this method comprises a scFv that recognizes a cell surface antigen expressed by an immune cell (e.g., a CD3 polypeptide on a T cell) connected to another scFv that recognizes a cell surface antigen expressed by a target cell (such as a malignant tumor cell or a tumor cell).

[0217] Since it is a single polypeptide, the bispecific T cell engager can be expressed using any prokaryotic or eukaryotic cell expression system known in the art (e.g., CHO cell line). However, specific purification techniques (see, e.g., EP1691833) may be required to separate the monomeric bispecific T cell engager from other polymeric substances, which may have biological activity other than the expected activity of the monomer. In an exemplary purification scheme, a solution containing the secreted polypeptide is first subjected to metal affinity chromatography, and then the polypeptide is eluted with an imidazole concentration gradient. This eluent is further purified using anion exchange chromatography, and the polypeptide is eluted using a sodium chloride concentration gradient. Finally, this eluent is subjected to size exclusion chromatography to separate the monomer from the polymeric substance.

[0218] Other related bispecific antibody fragment formats include, but are not limited to, dual affinity retargeting proteins (DARTs) and tandem diabodies (TandAbs). DART consists of two Fv fragments that form two unique antigen binding sites when the two Fv fragments are heterodimerized (Holliger et al., Proc. Natl. Acad. Sci. USA. 90: 6444–6448 (1993). Specifically, Fv1 consists of VH from antibody "A" and VL from antibody "B", while Fv2 consists of VH from antibody "B" and VL from antibody "A". Unlike BiTE antibodies connected by polypeptide linkers, this combination allows DART to mimic IgG molecules. The addition of another cysteine ​​residue at the end of each heavy chain can improve stability by forming a C-terminal disulfide bridge. TandAbs are tetravalent bispecific antibodies that provide two binding sites for each antigen to maintain the affinity of natural bivalent antibodies. In addition, the molecular weight of TandAbs (approximately 105 kDa) exceeds the first-pass renal clearance threshold, so its half-life is longer than that of smaller antibody constructs (Reusch et al., Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 22: 5829–5838 (2016); Reusch et al., MAbs. 6: 728–739 (2014); Compte et al., Oncoimmunology. 3: e28810 (2014). For a recent review of common formats of bispecific antibodies, including scFv-based antibodies and full-length IgG-like asymmetric antibodies and methods for their production, see Wang et al., Antibodies (Basel), 8 (3): 43 (2019).

[0219] 6. Antibody variants and modifications

[0220] a) Substitution, insertion and deletion variants

[0221] In addition to the anti-PSMA antibodies described herein, it is contemplated that anti-PSMA antibody variants may be prepared. Anti-PSMA antibody variants may be prepared by introducing appropriate nucleotide changes into the encoding DNA, and / or by synthesizing the desired antibody or polypeptide. One skilled in the art will appreciate that amino acid changes may alter post-translational processing of the anti-PSMA antibody, such as changing the number or location of glycosylation sites, or altering membrane anchoring characteristics.

[0222] The variation of the anti-PSMA antibodies described herein can be performed, for example, using any of the techniques and guidelines for conservative and non-conservative mutations described in, for example, U.S. Pat. No. 5,364,934. The variation can be a substitution, deletion or insertion of one or more codons encoding an antibody or polypeptide, which results in a change in the amino acid sequence compared to the native sequence antibody or polypeptide. Optionally, the variation is by replacing at least one amino acid with any other amino acid in one or more domains of the anti-PSMA antibody. By comparing the sequence of the anti-PSMA antibody with the sequence of a homologous known protein molecule and minimizing the number of amino acid sequence changes made in highly homologous regions, guidance can be established to determine which amino acid residues can be inserted, substituted or deleted without adversely affecting the desired activity. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structure and / or chemical properties, such as replacing leucine with serine, i.e., conservative amino acid substitutions. Insertions or deletions can optionally be within the range of about 1 to 5 amino acids. The allowed variation can be determined by systematically inserting, deleting or substituting amino acids in the sequence and testing the activity exhibited by the resulting variants by the full-length or mature native sequence.

[0223] Anti-PSMA antibody fragments are provided herein. For example, such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues when compared to the full-length native antibody or protein. Certain fragments lack amino acid residues that are not essential for the desired biological activity of the anti-PSMA antibody.

[0224] Anti-PSMA antibody fragments can be prepared by any of a variety of conventional techniques. The desired peptide fragments can be chemically synthesized. Alternative methods involve generating antibody or polypeptide fragments by enzymatic digestion, for example by treating the protein with an enzyme known to cleave the protein at a site defined by a specific amino acid residue, or by digesting the DNA with a suitable restriction enzyme and isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired antibody or polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are used at the 5' and 3' primers in the PCR. Preferably, the anti-PSMA antibody fragment shares at least one biological activity and / or immunological activity with the natural anti-PSMA antibodies disclosed herein.

[0225] In specific embodiments, conservative substitutions of interest are shown under the heading of preferred substitutions in Table 1. If such substitutions result in a change in biological activity, more substantial changes, i.e., the exemplary substitutions named in Table 1, or as further described below with reference to amino acid classes, are introduced and the products screened.

[0226] Table 1

[0227]

[0228]

[0229] Substantial modification of the function or immunological properties of the anti-PSMA antibodies is achieved by selecting substitutions that vary significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of ​​the substitution, such as a folded or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into several groups based on common side chain properties:

[0230] (1) Hydrophobic: norleucine, met, ala, val, leu, ile;

[0231] (2) neutral hydrophilic: cys, ser, thr;

[0232] (3) Acidic: asp, glu;

[0233] (4) Basic: Asn, Gln, His, Lys, Arg;

[0234] (5) Residues that affect chain orientation: gly, pro; and

[0235] (6) Aromatic: trp, tyr, phe.

[0236] Non-conservative substitutions will entail exchanging a member of one of these classes for a member of another class. Such substituted residues may also be introduced at conservative substitution sites or, more preferably, at the remaining (non-conservative) sites.

[0237] Variations can be generated using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)), cassette mutagenesis (Wells et al., Gene, 34:315 (1985)), restriction-selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London Ser A, 317:415 (1986)) or other known techniques can be performed on cloned DNA to generate anti-PSMA antibody variant DNA.

[0238] Scanning amino acid analysis can also be used to confirm one or more amino acids along a continuous sequence. Preferred scanning amino acids include relatively small neutral amino acids. Such amino acids include alanine, glycine, serine and cysteine. Alanine is usually the preferred scanning amino acid in this group because it eliminates side chains other than the β-carbon and is unlikely to change the main chain conformation of the variant (Cunningham and Wells, Science, 244: 1081-5 (1989)). Alanine is also usually preferred because it is the most common amino acid. In addition, it is often found in buried and exposed positions (Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol., 150: 1 (1976)). If alanine substitution does not produce a sufficient amount of variants, isoplasmic amino acids can be used.

[0239] Any cysteine ​​residue that is not involved in maintaining the correct conformation of the anti-PSMA antibody may also be substituted, typically with serine, to improve the oxidative stability of the molecule and prevent abnormal cross-linking. Conversely, cysteine ​​bonds may be added to the anti-PSMA antibody to improve its stability (particularly when the antibody is an antibody fragment such as an Fv fragment).

[0240] A particularly preferred type of substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g., a humanized antibody or a human antibody). Typically, the resulting variants selected for further development have improved biological properties relative to the parent antibody from which they were generated. A convenient method for generating such substitutional variants involves affinity maturation using phage display. Briefly, several hypervariable region sites (e.g., 6-7 sites) are mutated to generate all possible amino substitutions at each site. The antibody variants so generated are displayed in a monovalent manner from filamentous phage particles as fusions to the gene III product of M13 packaged within each particle. The phage-displayed variants are then screened for biological activity (e.g., binding affinity) as disclosed herein. To identify candidate hypervariable region sites for modification, alanine scanning mutagenesis can be performed to identify hypervariable region residues that contribute significantly to antigen binding. Alternatively or additionally, it may be beneficial to analyze the crystal structure of the antigen-antibody complex to identify contact points between the antibody and the PSMA polypeptide. Such contact residues and neighboring residues are candidates for substitution according to the techniques detailed herein. Once such variants are generated, the panel of variants is subjected to screening as described herein, and antibodies with superior properties in one or more relevant assays may be selected for further development.

[0241] Nucleic acid molecules encoding amino acid sequence variants of anti-PSMA antibodies are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from natural sources (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of variant or non-variant forms of an earlier prepared anti-PSMA antibody.

[0242] b) Modification

[0243] Covalent modification of anti-PSMA antibodies is included within the scope of the present invention. One type of covalent modification includes reacting targeted amino acid residues of the anti-PSMA antibody with an organic derivatizing agent that is capable of reacting with selected side chains or N-terminal or C-terminal residues of the anti-PSMA antibody. Derivatization with a bifunctional agent is useful, for example, for crosslinking an anti-PSMA antibody to a water-insoluble support matrix or surface for use in methods of purifying anti-PSMA antibodies, and vice versa. Commonly used crosslinking agents include, for example, 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters (e.g., esters with 4-azidosalicylic acid), homobifunctional imino esters (including disuccinimide esters such as 3,3'-dithiobis(succinimidyl propionate)), bifunctional maleimides (such as bis-N-maleimido-1,8-octane) and agents such as methyl-3-[(p-azidophenyl)dithio]propionimidate.

[0244] Other modifications include deamidation of glutamine and asparagine residues to the corresponding glutamyl and asparagine residues, respectively, hydroxylation of proline and lysine, phosphorylation of the hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine and histidine side chains (TECreighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.

[0245] Another type of covalent modification of anti-PSMA antibodies included within the scope of the present invention includes altering the native glycosylation pattern of the antibody or polypeptide. For purposes herein, "altering the native glycosylation pattern" means deleting one or more carbohydrate moieties present in a native sequence anti-PSMA antibody (by removing potential glycosylation sites or deleting glycosylation by chemical and / or enzymatic means) and / or adding one or more glycosylation sites not present in a native sequence anti-PSMA antibody. In addition, the phrase includes qualitative changes in the glycosylation of the native protein, involving changes in the nature and proportions of the various carbohydrate moieties present.

[0246] Glycosylation of antibodies and other polypeptides is usually either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine (where X is any amino acid except proline) are recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of any of these tripeptide sequences in a polypeptide creates a potential glycosylation site. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used.

[0247] Addition of glycosylation sites to the anti-PSMA antibody is conveniently accomplished by altering the amino acid sequence so that it contains one or more of the above tripeptide sequences (for N-linked glycosylation sites). The alteration may also be made by addition of one or more serine or threonine residues to the sequence of the original anti-PSMA antibody or substitution of the sequence of the original anti-PSMA antibody with one or more serine or threonine residues (for O-linked glycosylation sites). The anti-PSMA antibody amino acid sequence may optionally be altered by changes at the DNA level, particularly by mutating the DNA encoding the anti-PSMA antibody at preselected bases such that codons are generated that will translate into the desired amino acids.

[0248] Another method of increasing the number of carbohydrate moieties on the anti-PSMA antibody is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example, in WO 87 / 05330 published September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).

[0249] Removal of carbohydrate moieties present on the anti-PSMA antibody can be accomplished chemically or enzymatically or by mutational substitution of codons encoding amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and are described, for example, by Hakimuddin et al., Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118:131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by using a variety of endo- and exo-glycosidases, as described by Thotakura et al., Meth. Enzymol., 138:350 (1987).

[0250] c) Fc region variants

[0251] It may be desirable to modify the antibodies of the present invention in terms of effector functions, for example, to enhance the antigen-dependent cell-mediated cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC) of the antibody. This can be achieved by introducing one or more amino acid substitutions in the Fc region of the antibody. Alternatively or in addition, cysteine ​​residues may be introduced in the Fc region to allow the formation of interchain disulfide bonds in this region. The homodimeric antibodies thus produced may have improved internalization capacity and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) (see Caron et al., J. Exp Med. 176: 1191-5 (1992); Shopes, BJ Immunol. 148: 2918-22 (1992)). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as described in Wolff et al., Cancer Research 53: 2560-5 (1993). Alternatively, the antibody can be engineered to have dual Fc regions, thereby having enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-30 (1989). In order to increase the serum half-life of the antibody, a salvage receptor binding epitope can be incorporated into the antibody (particularly an antibody fragment), for example as described in U.S. Patent No. 5,739,277. As used herein, the term "salvage receptor binding epitope" refers to an epitope of the Fc region of an IgG molecule (e.g., IgG1, IgG2, IgG3, or IgG4) that is responsible for increasing the in vivo serum half-life of the IgG molecule.

[0252] d) Cysteine ​​engineered antibody variants

[0253] In certain embodiments, it may be desirable to produce cysteine ​​engineered antibodies, e.g., "thioMAbs," in which one or more residues of an antibody are replaced with cysteine ​​residues. In specific embodiments, the substituted residues are present at accessible sites of the antibody. By replacing those residues with cysteine, reactive thiol groups are thereby localized to accessible sites of the antibody and can be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create immunoconjugates, as further described herein. Cysteine ​​engineered antibodies can be produced as described, e.g., in U.S. Patent No. 7,521,541.

[0254] e) Immunoconjugates

[0255] The subject matter disclosed herein also provides immunoconjugates, which include antibodies disclosed herein conjugated to one or more cytotoxic agents (such as chemotherapeutic agents or drugs), growth inhibitory agents, proteins, peptides, toxins (e.g., protein toxins, enzymatic toxins of bacterial, fungal, plant or animal origin or fragments thereof), or radioactive isotopes. For example, an antibody of the disclosed subject matter can be functionally linked (e.g., by chemical coupling, genetic fusion, non-covalent association or otherwise) to one or more other binding molecules (such as another antibody, antibody fragment, peptide or binding mimetic).

[0256] In certain embodiments, the immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody of the disclosure is conjugated to one or more drugs, including but not limited to maytansinoids (see U.S. Pat. Nos. 5,208,020, 5,416,064, and European Patent No. 0 425 235). Bl); auristatins, such as the monomethyl auristatin drug moieties DE and DF (MMAE and MMAF) (see U.S. Pat. Nos. 5,635,483 and 5,780,588 and 7,498,298); dolastatin; calicheamicin or its derivatives (see U.S. Pat. Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701, 5,770,710, 5,773,001 and 5,877,296; Hinman et al., Cancer Res. 53:3336-3342 (1993); and Lode et al., Cancer Res. 58:2925-2928 (1998)); anthracyclines, such as daunomycin or doxorubicin (see Kratz et al., Current Med. Chem. 13:477-523 (2006); Jeffrey et al., Bioorganic & Med. Chem. Letters 16:358-362 (2006); Torgov et al., Bioconj. Chem. 16:717-721 (2005); Nagy et al., Proc. Natl. Acad. Sci. USA 97:829-834 (2000); Dubowchik et al., Bioorg. & Med. Chem. Letters 12:1529-1532 (2002); King et al., J. Med. Chem. 45:4336-4343 (2002); and U.S. Pat. No. 6,630,579); methotrexate; vindesine; taxanes, such as docetaxel, paclitaxel, larotaxel, tesetaxel, and octataxel; trichothecenes; and CC1065. In certain embodiments, the immunoconjugate includes an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria A chain, a non-binding active fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modicin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolacca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curculin, crotonin, saponin inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and tricyclic deoxyenol toxins.

[0257] In certain embodiments, the immunoconjugate includes an antibody described herein conjugated to a radioactive atom to form a radioconjugate. A variety of radioactive isotopes can be used to prepare radioconjugates. Non-limiting examples include At 211 ,Ac 225 , 1 131 , 1 125 , Y 90 、Re 186 、Re 188 、Sm 153 、Bi 212 , P 32 , Pb 212 When the radioconjugate is used for detection, it may include a radioactive atom for scintigraphic studies, such as tc99m or I 123 , or spin labels for nuclear magnetic resonance (NMR) imaging (also called magnetic resonance imaging, MRI), such as iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese, or iron.

[0258] Conjugates of antibody fragments and cytotoxic agents can be prepared using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCl), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate) and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugating radionucleotides to antibodies. The linker can be a "cleavable linker" that promotes the release of cytotoxic drugs in cells. For example, acid-labile linkers, peptidase-sensitive linkers, photolabile linkers, dimethyl linkers, or disulfide-containing linkers can be used (Chari et al., Cancer Res. 52: 127-131 (1992); U.S. Pat. No. 5,208,020). Non-limiting examples of linkers are disclosed above. The immunoconjugates disclosed herein expressly encompass, but are not limited to, such conjugates prepared with cross-linking agents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, and SVSB (succinimidyl-(4-vinyl sulfone) benzoate), which are commercially available (e.g., from Pierce Biotechnology, Inc., Rockford, IL., USA).

[0259] f) Antibody Fusions

[0260] The subject matter disclosed herein also encompasses antibody fusions. For example, the proteins can be linked together by chemical or genetic manipulation using methods known in the art. See, for example, Gillies et al., Proc. Nat'l Acad. Sci. USA 89:1428-1432 (1992) and U.S. Pat. No. 5,650,150.

[0261] In one example, the present disclosure encompasses anti-PSMA antibody-cytokine fusion proteins. In principle, anti-PSMA antibodies as disclosed herein are fused to any cytokine using recombinant molecular biology techniques. As an example, anti-PSMA antibodies can be fused to IL-2 (Gillies, S., Protein Engineering, Design and Selection 26(10):561-569 (2013); Klein, C. et al., OncoImmunology 6:3 (2017)).

[0262] In another example, the present disclosure encompasses anti-PSMA antibody-T cell engager fusion proteins. The anti-PSMA antibody-T cell engager fusion proteins discussed herein comprise a fusion between an anti-PSMA antibody and a ligand of a receptor expressed on a T cell. Examples of such ligands include, but are not limited to, CD40L, OX40L, 4-1BBL, CD80 / 86, ICOSL, and the like. In an embodiment, the ligand is fused to the Fc portion of an anti-PSMA antibody. In an embodiment, the ligand is fused to the C-terminus of the light chain of an anti-PSMA antibody. Such methods are described with respect to 4-1BBL (Dafne M. et al., Journal of Immunotherapy 38(8):714-722(2008)), and similar methods can be used to produce other antibody-T cell engager fusion proteins.

[0263] B. Recombinant Methods and Compositions

[0264] The anti-PSMA antibodies or antigen-binding fragments of the present disclosure can be produced using recombinant methods and compositions, such as those described in U.S. Pat. No. 4,816,567. In embodiments, the present invention also provides transformed cells and progeny thereof, into which nucleic acid molecules encoding antibodies or antigen-binding fragments have been introduced in vitro, ex vivo or in vivo by recombinant DNA technology. The transformed eukaryotic or prokaryotic cells can be used to produce recombinant antibodies or antibody fragments for purification, or for in situ or secretory expression for various purposes, such as diagnosis or treatment of tumors. The transformed cells can proliferate and the introduced nucleic acid can be transcribed or the encoded protein can be expressed. It should be understood that the progeny cells may not be identical to the parent cells because mutations may occur during replication. Transformed cells include, but are not limited to, prokaryotic cells and eukaryotic cells, such as bacteria, fungi, plants, insects, and animals (e.g., mammals, including humans) cells. The cells may be present in culture, cells, tissues or organs in vitro or in the body of a subject. In one embodiment, the antibody or antibody fragment is displayed on the surface of yeast cells; in another embodiment, the antibody or antibody fragment is coated on the surface of nanoparticles; in another embodiment, the antibody or antibody fragment is displayed on the surface of mammalian cells, such as T cells, NK cells or other human or other mammalian cells; in another embodiment, the antibody or antibody fragment is produced by yeast, E. coli or mammalian cells as a secreted protein.

[0265] Typically, cell transformation uses a vector. The term "vector" refers to, for example, a plasmid, a virus (such as a viral vector), or other vectors known in the art, which can be manipulated by inserting or incorporating nucleic acids - genetic manipulation (i.e., "cloning vectors"), or can be used to transcribe or translate inserted polynucleic acids (i.e., "expression vectors"). Such vectors can be used to introduce nucleic acids, including nucleic acids encoding antibodies or antibody antigen-binding fragments operably linked to expression control elements, and express the encoded protein in vitro (e.g., in solution or solid phase), in cells, or in vivo.

[0266] In one embodiment, the expression vector is transferred to a host cell by conventional techniques, and the transfected cells are then cultured by conventional techniques to produce antibodies or antigen-binding fragments of the present invention. Therefore, the present invention includes host cells containing polynucleic acids encoding antibodies of the present invention (e.g., whole antibodies, heavy chains or light chains thereof, or portions thereof, or single-chain antibodies, or fragments or variants thereof), which are operably linked to heterologous promoters. In other embodiments, in order to express the entire antibody molecule, the vector encoding the heavy chain and the light chain is co-expressed in the host cell to express the entire immunoglobulin molecule.

[0267] A variety of host-expression vector systems can be used to express the antibody molecules of the present invention. Such host-expression systems represent vehicles by which the coding sequences of interest can be produced and subsequently purified, and also represent cells that can express the antibody molecules of the present invention in situ when transformed or transfected with appropriate nucleic acid coding sequences. These include, but are not limited to, phage particles engineered to express antibody fragments or variants thereof (single-chain antibodies), microorganisms transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences, such as bacteria (e.g., Escherichia coli, Bacillus subtilis); yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant viral expression vectors containing antibody coding sequences (e.g., baculovirus); recombinant viral expression vectors containing antibody coding sequences (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus (tobacco mosaic virus)) transformed with recombinant yeast expression vectors containing antibody coding sequences. The recombinant antibody molecules are preferably expressed in a plant cell system infected with a recombinant plasmid expression vector (e.g., Ti plasmid) containing an antibody coding sequence (e.g., TMV) or transformed with a recombinant plasmid expression vector (e.g., Ti plasmid) containing an antibody coding sequence; or a mammalian cell system (e.g., COS, CHO, BHK, 293, 3T3, NSO cells) containing a recombinant expression construct containing a promoter derived from the genome of a mammalian cell (e.g., metallothionein promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter; vaccinia virus 7.5K promoter; CMV promoter or EF1a promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells (particularly for the expression of whole recombinant antibody molecules) are used to express the recombinant antibody molecules. For example, the combination of mammalian cells such as Chinese hamster ovary cells (CHO) and vectors such as the major intermediate early gene promoter element from human cytomegalovirus is an effective antibody expression system (Foecking et al., Gene 45: 101 (1986); Cockett et al., Bio / Technology 8: 2 (11990); Bebbington et al., Bio / Techniques 10: 169 (1992); Keen and Hale, Cytotechnology 18: 207 (1996)). These references are incorporated herein by reference in their entirety.

[0268] The vector or host expression vector used for transforming cells usually contains at least one replication origin for increasing value in the cell. The control elements (comprising expression control elements as set forth herein) present in the vector are included to promote transcription and translation. The term "expression control element" is intended to include at least one or more components that its presence can affect expression, and can include components except promoter or enhancer, such as leader and fusion partner sequences, internal ribosome binding site (IRES) elements for creating multi-gene or multi-cistronic information, splicing signals of introns, maintenance of the correct reading frame of genes (allowing in-frame translation of mRNA), polyadenylation signals (correct polyadenylation of interested gene transcripts is provided), stop codons, etc.

[0269] The vector may include a selection marker. As known in the art, a "selection marker" means a gene that allows the selection of cells containing a gene. "Positive selection" refers to a process in which only cells containing a selection marker can survive when exposed to positive selection. Drug resistance is an example of a positive selection marker; cells containing the marker will survive in a culture medium containing a selection drug, while cells that do not contain the marker will die. Such markers include drug resistance genes, such as neo that confers resistance to G418, hygr that confers resistance to hygromycin, or puro that confers resistance to puromycin, etc. Other positive selection marker genes include genes that allow identification or screening of cells containing markers. These genes include fluorescent protein (GFP) genes, lacZ genes, alkaline phosphatase genes, and surface markers such as CD8, etc.

[0270] The vector may contain a negative selection marker. "Negative selection" refers to the process in which cells containing a negative selection marker are killed when exposed to an appropriate negative selection agent. For example, cells containing the herpes simplex virus-thymidine kinase (HSV-tk) gene (Wigler et al., Cell 11:223 (1977)) are sensitive to the drug ganciclovir (GANC). Similarly, the gpt gene makes cells sensitive to 6-thioxanthine.

[0271] Mammalian expression systems further include vectors specifically designed for in vivo and ex vivo expression. Such systems include adeno-associated virus (AAV) vectors (U.S. Patent No. 5,604,090). AAV vectors have previously been shown to provide expression of factor IX at levels sufficient to produce therapeutic benefits in humans and mice (Kay et al., Nat. Genet. 24: 257 (2000); Nakai et al., Blood 91: 4600 (1998)). Adenoviral vectors (U.S. Pat. Nos. 5,700,470, 5,731,172, and 5,928,944), herpes simplex virus vectors (U.S. Pat. No. 5,501,979), and retroviral (e.g., lentiviral vectors can be used to infect dividing cells as well as non-dividing cells and foamy viruses) vectors (U.S. Pat. Nos. 5,624,820, 5,693,508, 5,665,577, 6,013,516, and 5,674,703 and WIPO publications WO92 / 05266 and WO92 / 14829), and papillomavirus vectors (e.g., human and bovine papillomavirus) have all been used for gene therapy (U.S. Pat. No. 5,719,054). Vectors also include cytomegalovirus (CMV)-based vectors (U.S. Pat. No. 5,561,063). Vectors that effectively deliver genes to intestinal cells have been developed and can also be used (see, e.g., U.S. Patent Nos. 5,821,235, 5,786,340, and 6,110,456). In yeast, for example, vectors that facilitate integration of foreign nucleic acid sequences into chromosomes via homologous recombination are known in the art and can be used. When the inserted nucleic acid is too large (e.g., greater than about 12 kb) for more conventional vectors, yeast artificial chromosomes (YACs) are typically used.

[0272] In one embodiment, the phagemid vectors used for the present invention include any phagemid vectors suitable for producing the antibody / antibody template / FR library of the present invention available in the art, and include phagemid vectors pCB04, pIT1, pIT2, CANTAB 6, pComb 3HS. Filamentous vectors and phagemid construction methods are described in, for example, U.S. Patent No. 6,054,312 and U.S. Patent No. 6,803,230, each of which is incorporated herein by reference. Phage display systems involving non-filamentous phage vectors (referred to as cytoplasmic phage or lytic phage) can also be utilized, as described, for example, in U.S. Patent No. 5,766,905, which is incorporated herein by reference.

[0273] Bacterial expression constructs suitable for use in the present invention include, but are not limited to, pCAL, pUC, pET, pETBlue TM(Novagen), pBAD, pLEX, pTrcHis2, pSE280, pSE380, pSE420 (Invitrogen), pKK223-2 (Clontech), pTrc99A, pKK223-3, pRIT2T, pMC1871, pEZZ 18 (Pharmacia), pBluescript IISK (Stratagene), pALTER-Ex1, pALTER-Ex2, pGEMEX (Promega), pFivE (MBI), pQE (Qiagen) commercially available expression constructs and their derivatives, as well as other constructs known in the art. In embodiments of the present invention, the construct may also include a virus, a plasmid, a bacmid, a phagemid, a cosmid or a bacteriophage.

[0274] The use of liposomes to introduce various compositions (including nucleic acids) into cells is known to those skilled in the art (see, e.g., U.S. Pat. Nos. 4,844,904, 5,000,959, 4,863,740, and 4,975,282). Carriers comprising natural polymers or derivatives or hydrolysates of natural polymers described in WO 94 / 20078 and U.S. Pat. No. 6,096,291 are suitable for mucosal delivery of molecules, such as polypeptides and polynucleic acids, and piperazinyl amphiphilic cationic lipids that can be used for gene therapy are also known (see, e.g., U.S. Pat. No. 5,861,397). Cationic lipid systems are also known (see, e.g., U.S. Pat. No. 5,459,127). Thus, methods of delivering viral and non-viral vectors to cells or tissues (in vitro, in vivo, and ex vivo) are included.

[0275] In one embodiment, nucleotide sequence can be "operably connected", i.e. located, to ensure the function of expression control sequence. These expression constructs can be replicated in cells usually, can be used as episomes, can also be used as an indispensable part of cell chromosome DNA, and may contain the appropriate replication origin of the corresponding prokaryotic strain for expression. Usually, expression construct contains selection marker, such as for example tetracycline resistance, ampicillin resistance, kanamycin resistance or chloramphenicol resistance, thereby is conducive to detecting and / or selecting those bacterial cells transformed with required nucleotide sequence (see for example, U.S. Patent number 4,704,362). However, these markers are not exclusive, and known to those skilled in the art, many other markers can be used. In another embodiment of the present invention, expression construct contains positive selection marker and negative selection marker simultaneously.

[0276] Similarly, a reporter gene may be incorporated into the expression construct to facilitate identification of the transcribed product. Thus, in one embodiment of the present invention, the reporter gene utilized is selected from the group consisting of β-galactosidase, chloramphenicol acetyltransferase, luciferase and fluorescent protein.

[0277] Prokaryotic promoter sequences regulate the expression of the encoded polynucleotide sequences, and in some embodiments of the present invention, are operably connected to the polynucleic acids encoding polypeptides of the present invention. In additional embodiments of the present invention, these promoters are constitutive or inducible, and provide means for high-level and low-level expression of polypeptides of the present invention, and in some embodiments, are used to regulate the expression of various polypeptides of the present invention, which are expressed as fusion proteins in some embodiments.

[0278] Many well-known bacterial promoters can be used, including T7 promoter system, lactose promoter system, tryptophan (Trp) promoter system, Trc / Tac promoter system, β-lactamase promoter system, tetA promoter system, arabinose regulated promoter system, phage T5 promoter or promoter system from phage lambda, and other promoter systems, and constitute embodiments of the present invention. The promoter usually controls expression, optionally with an operator sequence, and may include a ribosome binding site sequence, for example, for initiating and completing transcription and translation. According to additional embodiments, the vector may also contain expression control sequences, enhancers that can regulate the transcriptional activity of the promoter, appropriate restriction sites for cloning inserts near the promoter, and other necessary information processing sites, such as RNA splicing sites, polyadenylation sites, and transcription termination sequences, as well as any other sequences that can facilitate the expression of the inserted nucleic acid.

[0279] C. Purification of anti-PSMA antibodies

[0280] The anti-PSMA antibody form can be recovered from the culture medium or host cell lysate. If membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells used to express anti-PSMA antibodies can be disrupted by various physical or chemical means, such as freeze-thaw cycles, sonication, mechanical disruption, or cell lysing agents.

[0281] It may be desirable to purify the anti-PSMA antibody from a recombinant cell protein or polypeptide. The following procedures are exemplary of suitable purification procedures: by fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica gel or a cation exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelate columns to bind epitope-tagged forms of the anti-PSMA antibody. A variety of protein purification methods may be used, and such methods are known in the art and described, for example, in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). The purification step selected will depend, for example, on the nature of the production method employed and the specific anti-PSMA antibody produced.

[0282] When adopting recombinant technology, antibody can be produced in intracellular, periplasmic space, or directly secreted into culture medium.If antibody is produced in cell, as the first step, particle debris is removed, whether it is host cell or dissolved fragment, for example, by centrifugation or ultrafiltration.Carter et al., Bio / Technology 10:163-7 (1992) describes the procedure for separating the antibody secreted into the periplasmic space of Escherichia coli.In brief, cell paste is thawed for more than about 30 minutes in the presence of sodium acetate (pH 3.5), EDTA and phenylmethylsulfonyl fluoride (PMSF).Cell debris can be removed by centrifugation.In the case where antibody is secreted into culture medium, the supernatant from this type of expression system is usually first concentrated using commercially available protein concentration filter (such as Amicon or Millipore Pellicon ultrafiltration unit).Protease inhibitors, such as PMSF, can be included in any of the aforementioned steps to inhibit proteolysis, and antibiotics can be included to prevent the growth of foreign contaminants.

[0283] The antibody composition prepared by the cell can be purified by, for example, hydroxyapatite chromatography, gel electrophoresis, dialysis and affinity chromatography, wherein affinity chromatography is a preferred purification technique. The applicability of protein A as an affinity ligand depends on the type and isotype of any immunoglobulin Fc domain present in the antibody. Protein A can be used to purify antibodies based on human γ1, γ2 or γ4 heavy chains (Lindmark et al., J.Immunol.Meth.62:1-13 (1983)). Protein G is recommended for all mouse isotypes and human γ3 (Guss et al., EMBO J.5:15671575 (1986)). The matrix to which the affinity ligand is attached is usually agarose, but other matrices are also available. Mechanically stable matrices such as controlled pore glass or poly (styrene divinyl) benzene allow for faster flow rates and shorter processing times than with agarose. In the case where the antibody comprises a CH3 domain, Bakerbond ABX TM Resin (JT Baker, Phillipsburg, NJ) can be used for purification. Depending on the antibody to be recovered, other protein purification techniques are also available, such as ion exchange column fractionation, ethanol precipitation, reverse phase HPLC, silica gel chromatography, heparin SEPHAROSE TM Chromatography, chromatography on anion or cation exchange resins (such as polyaspartic acid columns), chromatofocusing, SDS-PAGE and ammonium sulfate precipitation.

[0284] Following any preliminary purification steps, the mixture comprising the antibody of interest and contaminants can be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH between about 2.5-4.5 and typically at a low salt concentration (e.g., about 0-0.25 M salt).

[0285] D. Determination

[0286] The antibodies of the present invention can be used in any known assay method, such as ELISA, competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Zola, (1987) Monoclonal Antibodies: A Manual of Techniques, pp. 147-158, CRC Press, Inc.).

[0287] Detection labels can be used to locate, visualize and quantify binding or recognition events. The labeled antibodies of the present invention can detect cell surface receptors or antigens. Another use of detectably labeled antibodies is a bead-based immunocapture method, including conjugating beads to fluorescently labeled antibodies and detecting fluorescent signals when ligands bind. Similar binding detection methods utilize surface plasmon resonance (SPR) effects to measure and detect antibody-antigen interactions.

[0288] Detection labels such as fluorescent dyes and chemiluminescent dyes (Briggs et al. (1997) J. Chem. Soc., Perkin-Trans. 1: 1051-8) provide a detectable signal and are generally suitable for labeling antibodies, preferably having the following properties: (i) the labeled antibody should produce a very high signal with low background so that small amounts of the antibody can be sensitively detected in cell-free and cell-based assays; and (ii) the labeled antibody should be photostable so that the fluorescent signal can be observed, monitored, and recorded without significant photobleaching. For applications involving cell surface binding of the labeled antibody to membranes or cell surfaces (particularly living cells), the label preferably (iii) has good water solubility to achieve effective conjugate concentration and detection sensitivity, and (iv) is nontoxic to living cells so as not to disrupt the normal metabolic processes of the cells or cause premature cell death.

[0289] Direct quantification of cellular fluorescence intensity and counting of fluorescent labeling events (e.g., cell surface binding of peptide-dye conjugates) can be performed in systems that automate mixing and reading of non-radioactive assays performed with live cells or beads ( 8100 HTS System, Applied Biosystems, Foster City, Calif.) (Miraglia, "Homogeneous cell-and bead-based assays for high throughput screening using fluorometric microvolume assay technology", (1999) J. of Biomolecular Screening 4: 193-204). Uses of labeled antibodies also include cell surface receptor binding assays, immunocapture assays, fluorescence-linked immunosorbent assays (FLISA), caspase cleavage (Zheng, "Caspase-3 controls both cytoplasmic and nuclear events associated with Fas-mediated apoptosis invivo", (1998) Proc. Natl. Acad. Sci. USA 95: 618-23; US 6372907), apoptosis (Vermes, "A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V" (1995) J. Immunol. Methods 184: 39-51) and cytotoxicity assays. Fluorometric microvolume assay technology can be used to confirm upregulation or downregulation of molecules targeted to the cell surface (Swartzman, "A homogeneous and multiplexed immunoassay for high-throughput screening using fluorometric microvolumeassay technology", (1999) Anal. Biochem. 271: 143-51).

[0290] The labeled antibodies of the present invention can be used as imaging biomarkers and probes by various methods and techniques of biomedical and molecular imaging, such as: (i) MRI (magnetic resonance imaging); (ii) MicroCT (computed tomography); (iii) SPECT (single photon emission computed tomography); (iv) PET (positron emission tomography) Chen et al. Bioconjugate Chem. 15: 41-9 (2004); (v) bioluminescence; (vi) fluorescence; and (vii) ultrasound. Immunoscintigraphy is an imaging procedure in which antibodies labeled with radioactive substances are administered to animals or human patients, and photographs are taken of the sites in the body where the antibodies are localized (US 6528624). Imaging biomarkers can be objectively measured and evaluated as indicators of normal biological processes, pathogenic processes, or pharmacological responses to therapeutic interventions.

[0291] Peptide labeling methods are well known (e.g., Haugland, 2003, Molecular Probes Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes, Inc.; Brinkley, 1992, Bioconjugate Chem. 3:2; Garman, (1997) Non-Radioactive Labelling: A Practical Approach, Academic Press, London; Means (1990) Bioconjugate Chem. 1:2; Glazer et al. (1975) Chemical Modification of Proteins. Laboratory Techniques in Biochemistry and Molecular Biology (TS Work and E. Work, eds.) American Elsevier Publishing Co., New York; Lundblad, RL and Noyes, CM (1984) Chemical Reagents for Protein Modification, Vols. I and II, CRC Press, New York, NY). De Leon-Rodriguez et al. (2004) Chem. Eur. J. 10: 1149-1155; Lewis et al. (2001) Bioconjugate Chem. 12: 320-324; Li et al. (2002) Bioconjugate Chem. 13: 110-115; Mier et al. (2005) Bioconjugate Chem. 16:240-237).

[0292] Peptides and proteins labeled with two parts (fluorescent reporter molecules and quenchers) undergo fluorescence resonance energy transfer (FRET) when they are close enough. The reporter group is usually a fluorescent dye, which is excited by light of a certain wavelength and transfers energy to an acceptor or quencher group, with an appropriate Stokes shift to emit at maximum brightness. Fluorescent dyes include molecules with extended aromaticity, such as fluorescein and rhodamine and their derivatives. The fluorescent reporter molecule can be partially or significantly quenched by the quencher part in the intact peptide. After the peptide is cleaved by a peptidase or protease, a detectable increase in fluorescence can be measured (Knight, C. (1995) "Fluorimetric Assays of Proteolytic Enzymes", Methods in Enzymology, Academic Press, 248: 18-34).

[0293] The labeled antibody of the present invention can also be used as an affinity purification agent. In this process, the labeled antibody is fixed on a solid phase such as a Sephadex resin or filter paper using methods well known in the art. The fixed antibody is contacted with a sample containing the antigen to be purified, and thereafter the support is washed with a suitable solvent, which will substantially remove all substances in the sample except the antigen to be purified, and the antigen to be purified is combined with the fixed polypeptide variant. Finally, the support is washed with another suitable solvent such as a glycine buffer (pH 5.0), which will release the antigen from the polypeptide variant.

[0294] 1. Activity Assay

[0295] In one aspect, assays are provided for identifying anti-PSMA antibodies that have biological activity. Biological activity can include, for example, the ability to inhibit cell growth or proliferation (e.g., "cell killing" activity) or the ability to induce cell death, including programmed cell death (apoptosis). Antibodies that have such biological activity in vivo and / or in vitro are also provided.

[0296] In certain embodiments, the anti-PSMA antibody is tested for its ability to inhibit cell growth or proliferation in vitro. Assays for inhibiting cell growth or proliferation are well known in the art. Certain cell proliferation assays, such as "cell killing" assays, measure cell viability. One such assay is the CellTiter-GloTM luminescent cell viability assay, which is commercially available from Promega (Madison, WI). The assay determines the number of viable cells in culture based on the quantification of the ATP present, which is an indicator of metabolically active cells. See Crouch et al. (1993) J. Immunol. Meth. 160: 81-8, U.S. Pat. No. 6,602,677. The assay can be performed in a 96-well or 384-well format, making it suitable for automated high-throughput screening (HTS) (see Cree et al. (1995) AntiCancer Drugs 6: 398-404). The assay procedure involves the addition of a single reagent ( The luciferase activity of the luciferase is measured by adding a luminescent reagent (e.g., a luciferase reagent) directly to the cultured cells. This results in cell lysis and the generation of a luminescent signal generated by the luciferase reaction. The luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells present in the culture. Data can be recorded by a luminometer or CCD camera imaging device. Luminescent output is expressed in relative light units (RLU).

[0297] Another cell proliferation assay is the "MTT" assay, a colorimetric assay that measures the oxidation of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide to formazan by mitochondrial reductase. Similar to the CellTiter-Glo™ assay, this assay indicates the number of metabolically active cells present in a cell culture (see, e.g., Mosmann (1983) J. Immunol. Meth. 65:55-63, and Zhang et al. (2005) Cancer Res. 65:3877-82).

[0298] In one aspect, the ability of anti-PSMA antibodies to induce cell death in vitro is tested. Assays for inducing cell death are well known in the art. In embodiments, such assays measure, for example, the loss of membrane integrity, as indicated by the uptake of propidium iodide (PI), trypan blue (see Moore et al. Cytotechnology, 17: 1-11 (1995)) or 7AAD. In an exemplary PI uptake assay, cells are cultured in Dulbecco's Modified Eagle Medium (D-MEM): Ham's F-12 (50:50) supplemented with 10% heat-inactivated FBS (Hyclone) and 2mM L-glutamine. Therefore, the assay is performed in the absence of complement and immune effector cells. Cells are plated at 3 x 10 6The cells were seeded at a density of 100 x 20 mm in a 100 x 20 mm culture dish and allowed to attach overnight. The culture medium was removed and replaced with a separate fresh culture medium or a culture medium containing antibodies at various concentrations. The cells were incubated for a period of 3 days. After treatment, the monolayer was washed with PBS and detached by trypsin digestion. The cells were then centrifuged at 1200 rpm for 5 minutes at 4 ° C, and the pellet was resuspended in 3 mL of cold Ca2+ binding buffer (10 mM Hepes, pH7.4, 140 mM NaCl, 2.5 mM CaCl2) and aliquoted into 35 mm 12 × 75 mm tubes with filter caps (1 mL per tube, 3 tubes per treatment group) to remove cell clumps. The tubes then received PI (10 μg / mL). Using FACSCAN TM Flow Cytometry and FACSCONVERT TM Samples were analyzed using CellQuest software (Becton Dickinson). Antibodies that induced statistically significant levels of cell death as determined by PI uptake were thus identified.

[0299] In one aspect, the ability of anti-PSMA antibodies to induce apoptosis (programmed cell death) in vitro is tested. An exemplary assay for antibodies that induce apoptosis is an annexin binding assay. In an exemplary annexin binding assay, cells are cultured and seeded in a culture dish as discussed in the previous paragraph. The culture medium is removed and replaced with fresh culture medium alone or with culture medium containing 0.001 to 10 μg / mL of the antibody. After a three-day incubation period, the monolayer is washed with PBS and detached by trypsin digestion. The cells are then centrifuged, resuspended in Ca2+ binding buffer, and aliquoted into test tubes as discussed in the previous paragraph. The tubes then receive labeled annexin (e.g., annexin V-FITC) (1 μg / mL). Using FACSCAN TM Flow Cytometry and FACSCONVERT TM CellQuest software (BD Biosciences) was used to analyze the samples. Antibodies that induced statistically significant levels of annexin binding relative to controls were thus identified. Another exemplary assay for antibodies that induce apoptosis is a histone DNA ELISA colorimetric assay for detecting internucleosomal degradation of genomic DNA. Such an assay can be performed using, for example, a cell death detection ELISA kit (Roche, Palo Alto, CA).

[0300] Cells used in any of the above in vitro assays include cells or cell lines that naturally express PSMA or have been engineered to express PSMA. Such cells include tumor cells that overexpress PSMA relative to normal cells of the same tissue source. Such cells also include cell lines (including tumor cell lines) that express PSMA and cell lines that do not normally express PSMA but have been transfected with nucleic acids encoding PSMA.

[0301] In one aspect, the ability of its anti-PSMA antibodies to inhibit cell growth or proliferation in vivo is tested. In certain embodiments, the ability of its anti-PSMA antibodies to inhibit tumor growth in vivo is tested. This test can use an in vivo model system, such as a xenograft model. In an exemplary xenograft system, human tumor cells are introduced into a suitably immunocompromised non-human animal (e.g., SCID mouse). The antibody of the present invention is administered to the animal. The ability of the antibody to inhibit or reduce tumor growth is measured. In certain embodiments of the above-mentioned xenograft system, the human tumor cells are tumor cells from human patients. In certain embodiments, human tumor cells are introduced into a suitably immunocompromised non-human animal by subcutaneous injection or by transplantation into a suitable site (e.g., mammary fat pad).

[0302] 2. Binding Assays and Other Assays

[0303] In one aspect, the anti-PSMA antibodies are tested for antigen binding activity. For example, in certain embodiments, the anti-PSMA antibodies are tested for their ability to bind to PSMA expressed on the surface of cells. FACS assays can be used for such testing.

[0304] In one aspect, competition assays can be used to identify monoclonal antibodies that compete with a monoclonal antibody comprising the following HCVR / LCVR sequence pairs: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36; or a monoclonal antibody that competes with six CDRs of a HCVR / LCVR sequence pair selected from: SEQ ID NO: NO:1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34 or 35 / 36.

[0305] In certain embodiments, such a competing antibody binds to the same epitope (e.g., a linear or conformational epitope) as a monoclonal antibody comprising the following HCVR / LCVR sequence pairs: SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36; or to the same epitope as a monoclonal antibody comprising six CDRs of the following HCVR / LCVR sequence pairs: SEQ ID NO: NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34 or 35 / 36. Exemplary competition assays include, but are not limited to, conventional assays such as those provided in Harlow and Lane (1988) Antibodies: A Laboratory Manual ch. 14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Detailed exemplary methods for locating epitopes bound by antibodies are provided in Morris (1996) "Epitope Mapping Protocols," in Methods in Molecular Biology Vol. 66 (Humana Press, Totowa, NJ). If two antibodies block 50% or more of the binding of each other, then the two antibodies are considered to bind to the same epitope.

[0306] In an exemplary competition assay, immobilized PSMA is incubated in a solution comprising a first labeled antibody that binds to PSMA and a second unlabeled antibody (which is to be tested for the ability to compete with the first antibody for binding to PSMA). The second antibody may be present in the hybridoma supernatant. As a control, immobilized PSMA is incubated in a solution comprising the first labeled antibody but not the second unlabeled antibody. After incubation under conditions that allow the first antibody to bind to PSMA, excess unbound antibody is removed and the amount of label associated with the immobilized PSMA is measured. If the amount of label associated with the immobilized PSMA in the test sample is substantially reduced compared to the control sample, this indicates that the second antibody competes with the first antibody for binding to PSMA. In certain embodiments, the immobilized PSMA is present on the surface of a cell or in a membrane preparation obtained from a cell expressing PSMA on its surface.

[0307] In one aspect, the purified anti-PSMA antibodies can be further characterized by a battery of assays including, but not limited to, N-terminal sequencing, amino acid analysis, native size exclusion high pressure liquid chromatography (HPLC), mass spectrometry, ion exchange chromatography, and papain digestion.

[0308] E. Epitope Identification Methods

[0309] In one aspect, the present disclosure provides a method of identifying an epitope of an anti-PSMA antibody or antigen-binding fragment thereof.

[0310] An epitope may include at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids in a unique spatial conformation. An epitope may be formed by contiguous or non-contiguous amino acids juxtaposed by the tertiary folding of the protein. Epitopes formed by contiguous amino acids are generally retained when exposed to denaturing solvents, while epitopes formed by tertiary folding are generally lost when treated with denaturing solvents.

[0311] Epitope mapping can be performed to identify linear or non-linear discontinuous amino acid sequences, i.e., epitopes that are recognized (e.g., specifically) by anti-PSMA antibodies or antigen-binding fragments thereof. The general method of epitope mapping may entail expressing the full-length polypeptide sequence recognized by the antibody or ligand of interest, as well as various fragments, i.e., truncated forms of the polypeptide sequence, typically in a heterologous expression system. These various recombinant polypeptide sequences or fragments thereof (e.g., fused to an N-terminal protein (e.g., GFP)) can then be used to determine whether the antibody or ligand of interest is able to bind to one or more truncated forms of the polypeptide sequence.

[0312] By utilizing repeated truncations and generating recombinant polypeptide sequences with overlapping amino acid regions, it is possible to confirm the region of the polypeptide sequence recognized by the antibody of interest (see, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, ed. (1996)). The method relies on the ability of an agent (e.g., an antibody of interest) to bind to a sequence reconstructed from an epitope library (e.g., an epitope library derived from a synthetic peptide array on a membrane support, a combinatorial phage display peptide library). The epitope library then provides a range of possibilities for screening the antibody. In addition, site-specific mutagenesis or random Ala scanning of one or more residues of the targeted epitope can be performed to confirm the identity of the epitope.

[0313] Libraries of epitopes can be created by synthetically designing various portions of PSMA as constructs and expressing them in a suitable system. In other cases, portions of PSMA can be amplified from total RNA extracted from PSMA-expressing cells isolated from human normal and / or malignant tissues.

[0314] The host system can be any suitable expression system, such as 293 cells, insect cells, or a suitable in vitro translation system. Binding of an anti-PSMA antibody or antigen-binding fragment thereof to one of the epitopes in the above library can be detected by contacting a labeled PSMA antibody of the present disclosure with the epitope of the library and detecting the signal from the label.

[0315] For epitope mapping, computational algorithms have also been developed that have been shown to map conformationally discontinuous epitopes. Conformational epitopes can be confirmed by determining the spatial conformation of amino acids using methods including, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance. Some epitope mapping methods, such as x-ray analysis of crystals of antigen: antibody complexes, can provide atomic resolution of epitopes. In other cases, a computational combinatorial approach for epitope mapping can be used to model potential epitopes based on the sequence of anti-PSMA or its antigen-binding fragment. In such cases, the antigen-binding portion of the antibody is sequenced and a computational model is used to reconstruct and predict the potential binding site of the antibody.

[0316] In some cases, the present disclosure provides a method for determining PSMA epitopes, the method comprising: (a) preparing a library of epitopes from a PSMA receptor; (b) contacting the library of epitopes with an anti-PSMA antibody; and (c) identifying the amino acid sequence of at least one epitope in the library of epitopes that is bound by the antibody. In one case, the antibody is attached to a solid support. The library of epitopes may include sequences corresponding to continuous and discontinuous epitopes of PSMA. In some cases, the library of epitopes includes fragments from a PSMA receptor ranging in length from about 10 amino acids to about 30 amino acids, about 10 amino acids to about 20 amino acids, or about 5 amino acids to about 12 amino acids. In some cases, the anti-PSMA antibody or its antigen-binding fragment is labeled, and the label is a radioactive molecule, a luminescent molecule, a fluorescent molecule, an enzyme, or biotin.

[0317] Phage panning can be used to identify PMSA binding molecules that bind to PMSA or one or more epitopes on PMSA. In embodiments, phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads is performed on a highly diverse synthetic scFv phage display library using multiple rounds (e.g., 5 rounds) of selection, with each round of decreasing antigen concentration (e.g., starting from 100 pmol to 2 pmol) but increasing wash stringency. In embodiments, an alternating panning strategy can be used, with alternating rounds of selection at 1e8 PSMA+ cells or antigen (e.g., 100 pmol and 25 pmol, respectively). Antigen-bound phage can then be pulled down, eluted, amplified, and screened using ELISA for confirmation and selection of binders. Selected scFvs can be reformatted as IgG, expressed, purified, and characterized after NGS and / or Sanger clone sequencing.

[0318] In an embodiment, a PMSA binding molecule can be generated using an epitope comprising or consisting of human PSMA residues 574-580, 644-649, and 674-686, wherein the residues are Fig.18B In an embodiment, a PMSA binding molecule can be generated using an epitope comprising or consisting of human PSMA residues 150-161, 167-172, and 256-261, wherein the residues are based on Fig.18B SEQ ID NO:330 in.

[0319] F. Chimeric Antigen Receptor (CAR) Constructs

[0320] Aspects of the invention include nucleic acids encoding CARs, and constructs and vectors comprising such nucleic acids. In some cases, the nucleic acid is a heterologous component, such as an expression cassette. In embodiments, the nucleic acid is a heterologous component, such as a retroviral vector. In embodiments, the nucleic acid is a heterologous component, such as an αβ or γδ T cell, and preferably a γδ T cell. In embodiments, the nucleic acid is, for example, a γ + T cells and / or delta + In an embodiment, the nucleic acid is, for example, α - T cells and / or β - Heterogeneous components of cells.

[0321] The subject CAR of the present invention comprises an antigen binding domain that can specifically bind to PSMA. The antigen binding domain may be operably connected to another domain of CAR, such as a transmembrane domain, a costimulatory domain, and / or an intracellular signaling domain, as described herein. The antigen binding domain described herein may be combined with any transmembrane domain, a costimulatory domain, and / or an intracellular signaling domain described herein and / or any other domain that may be included in the CAR of the present invention as described herein. The subject CAR of the present invention may also include a hinge domain as described herein. The subject CAR of the present invention may also include at least one spacer domain as described herein.

[0322] 1. Antigen binding domain

[0323] The antigen binding domain may include any domain that binds to PSMA, and may include, but is not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. In an embodiment, the antigen binding domain portion includes a mammalian antibody or a fragment thereof. The choice of antigen binding domain may depend on the type and amount of antigen present on the surface of the target cell.

[0324] In an embodiment, the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), and a single chain variable fragment (scFv).

[0325] The present disclosure provides antibodies and CARs having "substantial identity" or "substantial similarity" with sequences provided herein in CDR or framework regions. When referring to nucleic acids or fragments thereof, the term "substantial identity" or "substantially identical" indicates that when optimally aligned with another nucleic acid (or the complementary strand of another nucleic acid), there is a nucleotide sequence identity in %, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% of nucleotide bases, as measured by any well-known sequence identity algorithm (such as FASTA, BLAST or GAP), as discussed below. In certain cases, a nucleic acid molecule having substantial identity to a reference nucleic acid molecule can encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.

[0326] When applied to polypeptides, the term "substantially similar" or "substantially similar" means that when optimally aligned (such as by using the program GAP or BESTFIT with default gap weights), two peptide sequences share at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity. In some aspects, non-identical residue positions differ by conservative amino acid substitutions. "Conservative amino acid substitutions" are substitutions in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, conservative amino acid substitutions will not substantially change the functional properties of the protein. In the case where two or more amino acid sequences differ from each other by conservative substitutions, the percentage or degree of similarity may be adjusted upward to correct for the conservative nature of the substitution. Means for making such adjustments are well known to those skilled in the art. See, for example, Pearson (1994) Methods Mol. Biol. 24: 307-331, which is incorporated herein by reference. Examples of groups of amino acids with side chains of similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic-hydroxy side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic acid-aspartic acid and asparagine-glutamine. Alternatively, conservative substitutions are any changes with positive values ​​in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256:1443-45 (incorporated herein by reference). "Moderately conservative" substitutions are any changes with non-negative values ​​in the PAM250 log-likelihood matrix.

[0327] The sequence identity and / or similarity of polypeptide are measured using sequence analysis software usually. Protein analysis software uses the similarity measurement assigned to various replacements, disappearances and other modifications (including conservative amino acid substitutions) to match similar sequences. For example, GCG software contains programs such as GAP and BESTFIT, and the program can use default parameters to determine the sequence homology or sequence identity between closely related polypeptides (such as homologous polypeptides from different organism species), or between wild-type protein and its mutant protein. See, for example, GCG version 6.1. Peptide sequences can also be compared using FASTA (program in GCG version 6.1) utilizing default or recommended parameters. FASTA (for example, FASTA2 and FASTA3) provides comparison and sequence identity percentage (Pearson (2000) the same) of the best overlap region between query sequence and search sequence. Sequences can also be compared using the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, and a BLOSUM matrix of 62. When comparing the sequences disclosed herein to a database containing a large number of sequences from different organisms, another preferred algorithm is the computer program BLAST, particularly BLASTP or TBLASTN, using default parameters. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215:403-410 and (1997) Nucleic Acids Res. 25:3389-3402, each of which is incorporated herein by reference.

[0328] Provided herein is an anti-PSMACAR comprising a variant of any one of HCVR, LCVR and / or CDR amino acid sequences disclosed herein with one or more substitutions (e.g., conservative substitutions). For example, the disclosure comprises an anti-PSMACAR with HCVR, LCVR and / or CDR amino acid sequences, relative to any one of HCVR, LCVR and / or CDR (e.g., HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 or LCDR3) amino acid sequences disclosed herein, the anti-BCMACAR has, for example, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, 2 or less or 1 amino acid substitution. For example, an anti-PSMACAR may comprise 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid substitutions (e.g., conservative amino acid substitutions) relative to any of the HCVR, LCVR and / or CDR (e.g., HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3) amino acid sequences disclosed herein.

[0329] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1-36. In embodiments, the anti-PSMA binding domain binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1-36. In embodiments, the anti-PSMA binding domain binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35. In embodiments, the anti-PSMA binding domain binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a LCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, and 36. In embodiments, the anti-PSMA binding domain binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 13. In embodiments, the anti-PSMA binding domain binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a LCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, and 14.

[0330] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs:37-54; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs:55-72; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs:73-90. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 91-108; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 109-126; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 127-144.

[0331] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs:37-43; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs:55-61; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs:73-79. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs:91-97; a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs:109-115; and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs:127-133.

[0332] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO: 1 and a LCVR amino acid sequence as set forth in SEQ ID NO: 2. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:3 and a LCVR amino acid sequence as set forth in SEQ ID NO:4. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:5 and a LCVR amino acid sequence as set forth in SEQ ID NO:6. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:7 and a LCVR amino acid sequence as set forth in SEQ ID NO:8.In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:9 and a LCVR amino acid sequence as set forth in SEQ ID NO:10. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO: 11 and a LCVR amino acid sequence as set forth in SEQ ID NO: 12. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO: 13 and a LCVR amino acid sequence as set forth in SEQ ID NO: 14. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO: 15 and a LCVR amino acid sequence as set forth in SEQ ID NO: 16.In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO: 17 and a LCVR amino acid sequence as set forth in SEQ ID NO: 18. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO: 19 and a LCVR amino acid sequence as set forth in SEQ ID NO: 20. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:21 and a LCVR amino acid sequence as set forth in SEQ ID NO:22. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:23 and a LCVR amino acid sequence as set forth in SEQ ID NO:24.In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:25 and a LCVR amino acid sequence as set forth in SEQ ID NO:26. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:27 and a LCVR amino acid sequence as set forth in SEQ ID NO:28. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:29 and a LCVR amino acid sequence as set forth in SEQ ID NO:30. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:31 and a LCVR amino acid sequence as set forth in SEQ ID NO:32.In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:33 and a LCVR amino acid sequence as set forth in SEQ ID NO:34. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising a HCVR amino acid sequence as set forth in SEQ ID NO:35 and a LCVR amino acid sequence as set forth in SEQ ID NO:36.

[0333] Preferred embodiments include those in which the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: the HCVR amino acid sequence set forth in SEQ ID NO:1 and the LCVR amino acid sequence set forth in SEQ ID NO:2; the HCVR amino acid sequence set forth in SEQ ID NO:3 and the LCVR amino acid sequence set forth in SEQ ID NO:4; the HCVR amino acid sequence set forth in SEQ ID NO:5 and the LCVR amino acid sequence set forth in SEQ ID NO:6; the HCVR amino acid sequence set forth in SEQ ID NO:7 and the LCVR amino acid sequence set forth in SEQ ID NO:8; the HCVR amino acid sequence set forth in SEQ ID NO:9 and the LCVR amino acid sequence set forth in SEQ ID NO:10; the HCVR amino acid sequence set forth in SEQ ID NO:11 and the LCVR amino acid sequence set forth in SEQ ID NO:12; or the HCVR amino acid sequence set forth in SEQ ID NO:13 and the LCVR amino acid sequence set forth in SEQ ID NO:14.

[0334] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:37, a CDR2 sequence as set forth in SEQ ID NO:55, and a CDR3 sequence as set forth in SEQ ID NO:73; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:91, a CDR2 sequence as set forth in SEQ ID NO:109, and a CDR3 sequence as set forth in SEQ ID NO:127.

[0335] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:38, a CDR2 sequence as set forth in SEQ ID NO:56, and a CDR3 sequence as set forth in SEQ ID NO:74; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:92, a CDR2 sequence as set forth in SEQ ID NO:110, and a CDR3 sequence as set forth in SEQ ID NO:128.

[0336] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:39, a CDR2 sequence as set forth in SEQ ID NO:57, and a CDR3 sequence as set forth in SEQ ID NO:75; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:93, a CDR2 sequence as set forth in SEQ ID NO:111, and a CDR3 sequence as set forth in SEQ ID NO:129.

[0337] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:40, a CDR2 sequence as set forth in SEQ ID NO:58, and a CDR3 sequence as set forth in SEQ ID NO:76; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:94, a CDR2 sequence as set forth in SEQ ID NO:112, and a CDR3 sequence as set forth in SEQ ID NO:130.

[0338] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:41, a CDR2 sequence as set forth in SEQ ID NO:59, and a CDR3 sequence as set forth in SEQ ID NO:77; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:95, a CDR2 sequence as set forth in SEQ ID NO:113, and a CDR3 sequence as set forth in SEQ ID NO:131.

[0339] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:42, a CDR2 sequence as set forth in SEQ ID NO:60, and a CDR3 sequence as set forth in SEQ ID NO:78; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:96, a CDR2 sequence as set forth in SEQ ID NO:114, and a CDR3 sequence as set forth in SEQ ID NO:132.

[0340] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:43, a CDR2 sequence as set forth in SEQ ID NO:61, and a CDR3 sequence as set forth in SEQ ID NO:79; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:97, a CDR2 sequence as set forth in SEQ ID NO:115, and a CDR3 sequence as set forth in SEQ ID NO:133.

[0341] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:44, a CDR2 sequence as set forth in SEQ ID NO:62, and a CDR3 sequence as set forth in SEQ ID NO:80; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:98, a CDR2 sequence as set forth in SEQ ID NO:116, and a CDR3 sequence as set forth in SEQ ID NO:134.

[0342] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:45, a CDR2 sequence as set forth in SEQ ID NO:63, and a CDR3 sequence as set forth in SEQ ID NO:81; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:99, a CDR2 sequence as set forth in SEQ ID NO:117, and a CDR3 sequence as set forth in SEQ ID NO:135.

[0343] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:46, a CDR2 sequence as set forth in SEQ ID NO:64, and a CDR3 sequence as set forth in SEQ ID NO:82; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:100, a CDR2 sequence as set forth in SEQ ID NO:118, and a CDR3 sequence as set forth in SEQ ID NO:136.

[0344] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:47, a CDR2 sequence as set forth in SEQ ID NO:65, and a CDR3 sequence as set forth in SEQ ID NO:83; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:101, a CDR2 sequence as set forth in SEQ ID NO:119, and a CDR3 sequence as set forth in SEQ ID NO:137.

[0345] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:48, a CDR2 sequence as set forth in SEQ ID NO:66, and a CDR3 sequence as set forth in SEQ ID NO:84; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:102, a CDR2 sequence as set forth in SEQ ID NO:120, and a CDR3 sequence as set forth in SEQ ID NO:138.

[0346] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:49, a CDR2 sequence as set forth in SEQ ID NO:67, and a CDR3 sequence as set forth in SEQ ID NO:85; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:103, a CDR2 sequence as set forth in SEQ ID NO:121, and a CDR3 sequence as set forth in SEQ ID NO:139.

[0347] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:50, a CDR2 sequence as set forth in SEQ ID NO:68, and a CDR3 sequence as set forth in SEQ ID NO:86; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:104, a CDR2 sequence as set forth in SEQ ID NO:122, and a CDR3 sequence as set forth in SEQ ID NO:140.

[0348] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:51, a CDR2 sequence as set forth in SEQ ID NO:69, and a CDR3 sequence as set forth in SEQ ID NO:87; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:105, a CDR2 sequence as set forth in SEQ ID NO:123, and a CDR3 sequence as set forth in SEQ ID NO:141.

[0349] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:52, a CDR2 sequence as set forth in SEQ ID NO:70, and a CDR3 sequence as set forth in SEQ ID NO:88; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:106, a CDR2 sequence as set forth in SEQ ID NO:124, and a CDR3 sequence as set forth in SEQ ID NO:142.

[0350] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:53, a CDR2 sequence as set forth in SEQ ID NO:71, and a CDR3 sequence as set forth in SEQ ID NO:89; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:107, a CDR2 sequence as set forth in SEQ ID NO:125, and a CDR3 sequence as set forth in SEQ ID NO:143.

[0351] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:54, a CDR2 sequence as set forth in SEQ ID NO:72, and a CDR3 sequence as set forth in SEQ ID NO:90; and / or a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:108, a CDR2 sequence as set forth in SEQ ID NO:126, and a CDR3 sequence as set forth in SEQ ID NO:144.

[0352] Preferred embodiments include those in which the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or comprises an anti-PSMA binding domain comprising: a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:37, a CDR2 sequence as set forth in SEQ ID NO:55, and a CDR3 sequence as set forth in SEQ ID NO:73, and a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:91, a CDR2 sequence as set forth in SEQ ID NO:109, and a CDR3 sequence as set forth in SEQ ID NO:127; a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:38, a CDR2 sequence as set forth in SEQ ID NO:56, and a CDR3 sequence as set forth in SEQ ID NO:74, and a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:92, a CDR2 sequence as set forth in SEQ ID NO:110, and a CDR3 sequence as set forth in SEQ ID NO:128; a NO:39, a CDR1 sequence as shown in SEQ ID NO:57, and a CDR3 sequence as shown in SEQ ID NO:75; and a LCVR comprising a CDR1 sequence as shown in SEQ ID NO:93, a CDR2 sequence as shown in SEQ ID NO:111, and a CDR3 sequence as shown in SEQ ID NO:129; a HCVR comprising a CDR1 sequence as shown in SEQ ID NO:40, a CDR2 sequence as shown in SEQ ID NO:58, and a CDR3 sequence as shown in SEQ ID NO:76, and a LCVR comprising a CDR1 sequence as shown in SEQ ID NO:94, a CDR2 sequence as shown in SEQ ID NO:112, and a CDR3 sequence as shown in SEQ ID NO:130; a HCVR comprising a CDR1 sequence as shown in SEQ ID NO:41, a CDR2 sequence as shown in SEQ ID NO:59, and a CDR3 sequence as shown in SEQ ID NO:77, and a CDR1 sequence as shown in SEQ ID NO:95, a CDR2 sequence as shown in SEQ ID NO:111, and a CDR3 sequence as shown in SEQ ID NO:129. A LCVR having a CDR2 sequence as shown in NO:113 and a CDR3 sequence as shown in SEQ ID NO:131;A HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:42, a CDR2 sequence as set forth in SEQ ID NO:60, and a CDR3 sequence as set forth in SEQ ID NO:78, and a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:96, a CDR2 sequence as set forth in SEQ ID NO:114, and a CDR3 sequence as set forth in SEQ ID NO:132; or a HCVR comprising a CDR1 sequence as set forth in SEQ ID NO:43, a CDR2 sequence as set forth in SEQ ID NO:61, and a CDR3 sequence as set forth in SEQ ID NO:79, and a LCVR comprising a CDR1 sequence as set forth in SEQ ID NO:97, a CDR2 sequence as set forth in SEQ ID NO:115, and a CDR3 sequence as set forth in SEQ ID NO:133. ;

[0353] Other anti-PSMA binding domains and anti-PSMACARs are known and can be used in accordance with the teachings of the present disclosure. See, for example, WO2017180713, WO2019245991A1, WO2002098897, WO2001009192, WO2016179534, WO2019224718, WO2021 / 188599, WO2016111344, WO2017027325, WO2018098354, WO2017212250, WO 2021 / 050656 and NNarayan et al., (2022) Nature Medicine.doi: 10.1038, the contents of each of which are hereby expressly incorporated herein by reference in their entirety. In preferred embodiments, such anti-PSMA binding domains are incorporated into a CAR as described herein, or a known CAR is used as is or modified according to the present disclosure, wherein the CAR is expressed in γδ T cells for use in the methods described herein.

[0354] 2. Transmembrane domain

[0355] CAR of the present disclosure may include a transmembrane domain coupling the antigen binding domain of CAR to one or more intracellular domains of CAR. The transmembrane domain of CAR of the present disclosure is a region of the plasma membrane that can span cells (e.g., γδT cells). In embodiments, the transmembrane domain is interspersed between the antigen binding domain of CAR and one or more intracellular domains.

[0356] In embodiments, the transmembrane domain is naturally associated with one or more domains in the CAR. In embodiments, the transmembrane domain can be selected or modified by one or more amino acid substitutions to avoid such domains from binding to the transmembrane domains of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex.

[0357] For example and not limited to, transmembrane domains can be derived from natural or synthetic sources. In the case of natural sources, domains can be derived from any membrane-bound protein or transmembrane protein. The transmembrane region used particularly in the present invention can be derived from (i.e., at least including the following transmembrane region) 4-1BB / CD137, activated NK cell receptors, immunoglobulins, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154, CD100 (SEMA4D), CD103, CD16 0(BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276(B7-H3), CD28, CD29, CD3δ, CD3ε, CD3γ, CD3ζ, CD30, CD4, CD40, C D49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96(Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRT AM, cytokine receptor, DAP10, DNAM1 (CD226), Fcγ receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell co-stimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGBl, KIRDS2, LAT, LFA-1, ligand that specifically binds to CD83, LIGHT, LTBR, ​​Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC Class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecules (SLAM proteins), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Ly108), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6 or fragments, truncations or combinations thereof.Alternatively, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan and valine will be present at each end of the synthetic transmembrane domain.

[0358] In certain embodiments, the transmembrane domain includes the transmembrane domain of CD8. In certain embodiments, the transmembrane domain of CD8 includes the transmembrane domain of CD8α. In certain embodiments, the transmembrane domain of CD8 includes the amino acid sequence shown in SEQ ID NO:158. In certain embodiments, the transmembrane domain includes the transmembrane domain of CD28. In certain embodiments, the transmembrane domain of CD28 includes the amino acid sequence shown in SEQ ID NO:285. In certain embodiments, the transmembrane domain includes the transmembrane domain of ICOS. In certain embodiments, the transmembrane domain of ICOS includes the amino acid sequence shown in SEQ ID NO:286.

[0359] The transmembrane domains described herein can be combined with any antigen binding domain described herein, any intracellular domain described herein, or any other domain described herein that can be included in a subject CAR.

[0360] In an embodiment, the transmembrane domain further comprises a hinge region. The subject CAR of the present invention may also include a hinge region. The hinge region of CAR is a hydrophilic region between the antigen binding domain and the transmembrane domain. In an embodiment, the domain promotes the correct protein folding of CAR. The hinge region is an optional component of CAR. The hinge region may include a domain selected from the following: an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. Examples of hinge regions include, but are not limited to, CD8α hinges, CD8β hinges, CD28 hinges, 4-1BB hinges, CD7 hinges, artificial hinges prepared from polypeptides that may be as small as three glycine (Gly), and CHI and CH3 domains of IgG (such as human IgG4). Naturally occurring hinge domains may be used as wild-type hinge regions, or molecules may be changed.

[0361] In embodiments, the subject CAR of the present disclosure includes a hinge region coupling an antigen binding domain to a transmembrane domain, which is in turn coupled to one or more intracellular domains. The hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to a target antigen on a target cell (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3 (2): 125-135). In embodiments, the hinge region is a flexible domain, so as to allow the antigen binding domain to have a structure that optimally recognizes the specific structure and density of the target antigen on a cell (such as a tumor cell) (Hudecek et al., as described above). The flexibility of the hinge region allows the hinge region to adopt many different conformations. In embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a hinge region derived from CD8).

[0362] The length of the hinge region may be from about 4 amino acids to about 50 amino acids, e.g., from about 4aa to about 10aa, from about 10aa to about 15aa, from about 15aa to about 20aa, from about 20aa to about 25aa, from about 25aa to about 30aa, from about 30aa to about 40aa, or from about 40aa to about 50aa. In embodiments, the length of the hinge region may be greater than 5aa, greater than 10aa, greater than 15aa, greater than 20aa, greater than 25aa, greater than 30aa, greater than 35aa, greater than 40aa, greater than 45aa, greater than 50aa, greater than 55aa, or greater.

[0363] Suitable hinge regions can be easily selected, and can be any of a plurality of suitable lengths, such as 1 amino acid (e.g., Gly) to 20 amino acids, 2 amino acids to 15 amino acids, 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6 or 7 amino acids. Suitable hinge regions can have a length greater than 20 amino acids (e.g., 30, 40, 50, 60 or more amino acids).

[0364] For example, the hinge region includes glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 275), and (GGGS)n (SEQ ID NO: 276), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured and therefore can be used as neutral tethers between components. Glycine polymers can be used; glycine can access significantly more phi-psi space than even alanine and is much less constrained than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). Exemplary hinge regions may comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 278), GGSGG (SEQ ID NO: 279), GSGSG (SEQ ID NO: 280), GSGGG (SEQ ID NO: 281), GGGSG (SEQ ID NO: 282), GSSSG (SEQ ID NO: 283), and the like.

[0365] In an embodiment, the hinge region is an immunoglobulin heavy chain hinge region.Immunoglobulin hinge region amino acid sequences are known in the art; see, for example, Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1):162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4):1779-1789. As a non-limiting example, an immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 287); CPPC (SEQ ID NO: 288); CPEPKSCDTPPPCPR (SEQ ID NO: 289) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280: 41494-41503); ELKTPLGDTTHT (SEQ ID NO: 290); KSCDKTHTCP (SEQ ID NO: 291); KCCVDCP (SEQ ID NO: 292); KYGPPCP (SEQ ID NO: 293); EPKSCDKTHTCPPCP (SEQ ID NO: 294) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO: 295) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 296) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 297); NO:297) (human IgG4 hinge); etc.

[0366] The hinge region may comprise the amino acid sequence of a human IgG1, IgG2, IgG3 or IgG4 hinge region. In one embodiment, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region. For example, His229 of a human IgG1 hinge may be substituted with Tyr such that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 298); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897.

[0367] In certain embodiments, the hinge region may comprise an amino acid sequence derived from human CD8 or a variant thereof. In certain embodiments, the CAR comprises a CD8α hinge sequence comprising the amino acid sequence shown in SEQ ID NO: 156. In certain embodiments, the CAR comprises a hinge and a transmembrane domain sequence comprising the amino acid sequence shown in SEQ ID NO: 160.

[0368] 3.Co-stimulatory domain

[0369] In an embodiment, the CAR encoded by the nucleic acid may further include at least one costimulatory domain, wherein the costimulatory domain includes a functional costimulatory signaling domain, and the functional costimulatory signaling domain is derived from, for example, MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activated NK cell receptors, BTLA, Toll ligand receptors, etc. For example, within the scope of the present disclosure, CAR may include 2, 3, 4 or more costimulatory domains. Also within the scope of the present disclosure, when more than one costimulatory domain is included, the costimulatory domains may be the same, or they may be different.In embodiments, the co-stimulatory domain is derived from one or more of the following: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54(ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96(Tactile), CD10 0(SEMA4D), CD103, CD134(OX40), CD137(4-1BB), CD152(CTLA-4), CD160(BY55), CD162(SELPLG), CD244(2B4), CD270(HVEM), CD 226(DNAM1), CD229(Ly9), CD278(ICOS), ICAM-1, LFA-1(CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, ​​LAT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, I TGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2 and TRANCE / RANKL or portions thereof and combinations thereof.

[0370] In embodiments, the nucleic acid encoding CAR encodes at least one 4-1BB co-stimulatory domain, and optionally encodes a second co-stimulatory domain, which is selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 co-stimulatory domains or any of the above co-stimulatory domains. In embodiments, nucleic acid encodes at least two 4-1BB co-stimulatory domains, or at least two 4-1BB co-stimulatory domains and one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27 or any of the above co-stimulatory domains. In embodiments, the 4-1BB co-stimulatory domain comprises an amino acid sequence as shown in SEQ ID NO: 162. In embodiments, the 4-1BB co-stimulatory domain comprises at least one, at least two, or at least three or more modified amino acid sequences having an amino acid sequence of SEQ ID NO: 162. In embodiments, the 4-1BB co-stimulatory domain is substantially similar to the 4-1BB co-stimulatory domain comprising SEQ ID NO: 162.

[0371] In embodiments, the nucleic acid encoding CAR encodes at least one CD27 co-stimulatory domain, and optionally encodes at least one second co-stimulatory domain, the second co-stimulatory domain being selected from 4-1BB, ICOS, CD28, OX40, 2B4 and CD27 co-stimulatory domains, or any of the above co-stimulatory domains. In embodiments, the nucleic acid encodes at least one CD27 co-stimulatory domain and a 4-IBB co-stimulatory domain. In embodiments, the nucleic acid encodes two CD27 co-stimulatory domains, and at least one second co-stimulatory domain selected from 4-1BB, ICOS, CD28 and CD27. In embodiments, the CD27 co-stimulatory domain comprises SEQ ID NO: 39. In embodiments, the CD27 co-stimulatory domain comprises at least one, at least two, at least three or more modified amino acid sequences having an amino acid sequence of SEQ ID NO: 300. In embodiments, the CD27 co-stimulatory domain is substantially similar to the CD27 co-stimulatory domain comprising SEQ ID NO: 300.

[0372] In embodiments, the nucleic acid encoding CAR encodes at least one CD28 co-stimulatory domain, and optionally encodes a second co-stimulatory domain, which is selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 co-stimulatory domains or any of the above co-stimulatory domains. In embodiments, the nucleic acid encodes at least two CD28 co-stimulatory domains, or at least two CD28 co-stimulatory domains and one, two, three, or four or more co-stimulatory domains selected from any of 4-1BB, ICOS, CD28, OX40 and CD27 or the above co-stimulatory domains. In embodiments, the CD28 co-stimulatory domain comprises SEQ ID NO: 254. In embodiments, the CD28 co-stimulatory domain comprises SEQ ID NO: 301. SEQ ID NO: 254 and SEQ ID NO: 301 include three subdomains YMNM, PRRP and PYAP, which can regulate signal transduction pathways. In embodiments, the disclosed CAR comprises a mutation or deletion of one or more of the subdomains (see, e.g., WO2019010383). In embodiments, the CD28 costimulatory domain comprises at least one, at least two, at least three or more modified amino acid sequences having an amino acid sequence of SEQ ID NO: 254 or an amino acid sequence of SEQ ID NO: 301. In embodiments, the CD28 costimulatory domain is substantially similar to the CD28 costimulatory domain comprising SEQ ID NO: 254. In embodiments, the CD28 costimulatory domain is substantially similar to the CD28 costimulatory domain comprising SEQ ID NO: 301.

[0373] In embodiments, the nucleic acid encoding CAR encodes at least one ICOS costimulatory domain, and optionally encodes a second costimulatory domain, which is selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 costimulatory domains or any of the above costimulatory domains. In embodiments, nucleic acid encodes at least two ICOS costimulatory domains, or at least two ICOS costimulatory domains and one, two, three, or four or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27 or any of the above costimulatory domains. In embodiments, the ICOS costimulatory domain includes SEQ ID NO: 255. In embodiments, the ICOS costimulatory domain includes at least one, at least two, at least three or more modified amino acid sequences (see, e.g., US20170209492) of the amino acid sequence of SEQ ID NO: 255. In embodiments, the ICOS costimulatory domain is substantially similar to the ICOS costimulatory domain comprising SEQ ID NO: 255.

[0374] In embodiments, the nucleic acid encoding CAR encodes at least one OX40 co-stimulatory domain, and optionally encodes a second co-stimulatory domain, the second co-stimulatory domain being selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 co-stimulatory domains or any of the above co-stimulatory domains. In embodiments, the nucleic acid encodes at least two OX40 co-stimulatory domains, or at least two OX40 co-stimulatory domains and a combination of one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27 or any of the above co-stimulatory domains. In embodiments, the OX40 co-stimulatory domain comprises SEQ ID NO: 256. In embodiments, the OX40 co-stimulatory domain comprises at least one, at least two, at least three or more modified amino acid sequences having an amino acid sequence of SEQ ID NO: 256. In embodiments, the OX40 co-stimulatory domain is substantially similar to the OX40 co-stimulatory domain comprising SEQ ID NO: 256.

[0375] 4. Intracellular signaling domain

[0376] In the embodiment, the nucleic acid encoding CAR encodes at least one intracellular signaling domain. In the embodiment, at least one intracellular signaling domain is outside one or more costimulatory domains. In the embodiment, one or more intracellular signaling domains are included to increase the proliferation, persistence and / or cytotoxic activity of host cells containing CAR as disclosed herein, preferably γδ cells. For example, in some embodiments, the intracellular signaling domain includes CD3ζ, repeats (e.g., 2-5) DAP10 YINM motifs, derived from LFA-1, DAP12, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD79a, CD79b, CD5, CD22, FcεRI, CD66d, etc. Signaling domains. Within the scope of this disclosure, the intracellular domain of the disclosed CAR may include multiple (e.g., 2, 3, 4 or more) intracellular signaling domains. In the case of including more than one intracellular signaling domain, the intracellular signaling domain may be the same, or it may be different.

[0377] In an embodiment, the intracellular signaling domain of a disclosed CAR is or comprises a CD3 zeta signaling domain. In an embodiment, the CD3 zeta signaling domain is or comprises an amino acid sequence as shown in SEQ ID NO: 164, 166 or 167.

[0378] 5. Additional peptides

[0379] In embodiments, the nucleic acid encoding the separation of the CAR of the present invention may also encode one or more polycistronic joint regions, which are configured to promote the translation of CAR polypeptides and one or more additional polypeptides. In embodiments, nucleic acids encoding one or more additional polypeptides and related joint regions may be located at the 3' end of the separated nucleic acid, or at the 5' end of the separated nucleic acid, or at the 5' end and 3' end of the separated nucleic acid in some examples. In some embodiments, the joint region may encode self-cutting and / or cutting polypeptide sequences. In some examples, the self-cutting sequence is a 2A self-cutting sequence (e.g., T2A, P2A, E2A, F2A), which may induce ribosome jumping during the translation of CAR. In embodiments, the cutting sequence is a furin protease (furin) sequence. In some examples, the cutting sequence (e.g., a furin protease cutting sequence as shown in SEQ ID NO: 242) is a self-cutting sequence such as the amino terminus of furin protease-P2A (FP2A). In embodiments, the polycistronic joint region encodes an internal ribosome entry site. In an embodiment, the addition of an optional linker "GSG" or "SGSG" etc. can improve cleavage efficiency. In this way, one or more additional polypeptides can be released from the CAR and directed to the secretory pathway.

[0380] In an embodiment, the cleavage sequence is the FP2A amino acid sequence as shown in SEQ ID NO: 236. In an embodiment, the cleavage sequence is the P2A amino acid sequence as shown in SEQ ID NO: 238 or SEQ ID NO: 240-241. In an embodiment, the cleavage sequence is the furin amino acid sequence as shown in SEQ ID NO: 242. In an embodiment, the cleavage sequence is the F2A amino acid sequence as shown in SEQ ID NO: 243. In an embodiment, the cleavage sequence is the E2A amino acid sequence as shown in SEQ ID NO: 244. In an embodiment, the cleavage sequence is the T2A amino acid sequence as shown in SEQ ID NO: 245. In some aspects, multiple cleavage and / or self-cleavage sequences can be encoded at the carboxyl terminus of the signaling and / or costimulatory domain and the amino terminus of the encoded one or more additional polypeptides. In some aspects, one or more self-cleavage sequences and one or more sequences cleaved by endogenous proteases are encoded in the constructs described herein. In some embodiments, the endogenous protease recognition site is encoded at the amino terminus of the self-cleavage sequence.

[0381] In an embodiment, the polycistronic linker region encodes an internal ribosome entry site. An exemplary internal ribosome entry site is encoded by the nucleotide sequence shown in SEQ ID NO: 246. Another exemplary internal ribosome entry site is encoded by the nucleotide sequence shown in SEQ ID NO: 247. Other suitable internal ribosome entry sites include, but are not limited to, those disclosed in Nucleic Acids Res. 2010 Jan; 38 (database period): D131-6. doi: 10.1093 / nar / gkp981. Epub 2009 Nov 16, those described in iresite.org, those described in WO 2018 / 215787, the sequences described in GenBank accession number KP019382.1, and the IRES elements disclosed in GenBank accession number LT727339.1. Additional polycistronic linker regions are disclosed in US 2018 / 0360992 and US8,865,467, including cutting, self-cutting and IRES elements.

[0382] In embodiments, one or more additional polypeptides include one or more soluble γ chain cytokines expressed as isolated polypeptides from CAR. One or more soluble shared γ chain cytokines may include but are not limited to IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, IL-23. In embodiments, shared γ chain cytokines are selected from IL-2, IL-7 and IL-15. In embodiments, shared γ chain cytokines are IL-15. IL-15 sequences (including codon-optimized nucleic acid sequences encoding soluble IL-15 (sIL-15)) are disclosed herein and in WO 2007 / 037780.

[0383] In embodiments, one or more additional polypeptides include one or more tags or markers, for example, to facilitate the ability to monitor CAR expression levels, to serve as internal controls, etc. In embodiments, the isolated nucleic acid encoding CAR encodes a fluorescent protein, examples of which include, but are not limited to, green fluorescent protein (GFP), red fluorescent protein (RFP), enhanced GFP (EGFP), enhanced cyan fluorescent protein (ECFP), enhanced yellow fluorescent protein (EYFP), etc. Other examples may include, but are not limited to, chloramphenicol acetyltransferase, β-galactosidase, β-glucuronidase, β-lactamase, luciferase, etc.

[0384] In embodiments, one or more additional polypeptides include proteins expressed on the cell surface to facilitate detection and / or separation of cells expressing the protein, such as via fluorescence activated cell sorting (FACS); or for enrichment by positive selection using antibodies specific for the encoded protein, such as using antibodies to purify or enrich cell products on a column or device; or for in vivo binding of antibodies to proteins to enhance or eliminate activity, for example, to facilitate the removal of cells expressing proteins in patients for safety reasons. Exemplary proteins for these purposes include, for example, CD19, CD20 (rituximab (Rituxumab) recognition domain), RQR8, LNGFR, truncated forms of human epidermal growth factor receptor (EGFRt), etc. By way of example, EGFRt can be targeted by clinical stage antibodies, wherein the use of the antibodies to treat patients results in the elimination of cells containing isolated nucleic acids encoding CARs as disclosed herein and / or the CARs. See, e.g., Wang et al. A transgenic encoded cell surface polypeptide for selection, in vivo tracking and ablation of engineered cells; Blood 2011 118(5):1255-63; Philip et al. A highly compact epitope-based marker / suicide gene for simpler and safer T cell therapy; Blood 2014 124(8):1277-87; Smith J. et al. UCART19, an allogeneic “off-the-shelf” adoptive T cell immunotherapy for CD19+ B cell leukemia; DOI:10.1200 / jco.2015.33.15_suppl.3069 Journal of Clinical Oncology 33, no.15_suppl (May 20, 2015) 3069-3069; Gouble et al. A highly compact epitope-based marker / suicide gene for simpler and safer T cell therapy; Blood 2014 124(8):1277-87; Smith J. et al. UCART19, an allogeneic “off-the-shelf” adoptive T cell immunotherapy for CD19+ B cell leukemia; DOI:10.1200 / jco.2015.33.15_suppl.3069 Journal of Clinical Oncology 33, no.15_suppl (May 20, 2015) 3069-3069; Gouble et al. A. et al., In vivo proof of concept for the activity and safety of UCART19, an allogeneic “off-the-shelf” adoptive T-cell immunotherapy for CD19+ B-cell leukemia; Blood (2014) 124(21):4689, doi.org / 10.1182 / blood.V124.21.4689.4689, each of which is incorporated by reference in its entirety.

[0385] In an embodiment, one or more additional polypeptides include proteins that have the function of increasing resistance to exhaustion and activation-induced apoptosis and / or upregulating one or more proinflammatory cytokines, co-stimulatory molecules, and / or antigen presentation mechanisms. Representative examples include, but are not limited to, lymphotoxin beta receptor (LTBR). LTBR is typically expressed in a subset of myeloid cells but not in lymphocytes. When expressed in T cells, LTBR can induce transcriptional remodeling, conferring one or more of the above-mentioned favorable functions to T cells (Legut et al., Blood. (2021); 138(1): 1726).

[0386] In embodiments, the one or more additional polypeptides include a polypeptide that confers the ability of the host cell to resist tumor antigen-specific cellular immunity, such as cellular immunity mediated by transforming growth factor β (TGF-β). For example, the isolated nucleic acid may encode a dominant negative receptor for TGF-β (dnTGFβR2), such as described in Foster et al., J Immunother. (2008); 31: 500-505, WO2019 / 173324A1, WO2020 / 183131A1, and WO2020042647A1. In the presence of TGF-β-secreting tumors, incorporation of such a dominant negative receptor for TGF-β may provide functional advantages, including enhanced anti-tumor activity, relative to control cells lacking such a dominant negative receptor for TGF-β.

[0387] In some embodiments, the isolated nucleic acid encodes a signal peptide that is operably linked to facilitate directing one or more additional polypeptides to the secretory pathway. Such one or more additional polypeptides may be polypeptides located inside certain organelles, polypeptides secreted from host cells, or polypeptides inserted into cell membranes. In embodiments, the signal peptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 152. In embodiments, the signal peptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 248. In embodiments, the signal peptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 259. In embodiments, the signal peptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 263. In embodiments, the signal peptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 267. In embodiments, the signal peptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 271.

[0388] In an embodiment, one or more additional polypeptides comprise or consist of an EGFRt amino acid sequence as shown in SEQ ID NO: 261. In an embodiment, one or more additional polypeptides comprise or consist of a GMCSFR amino acid sequence as shown in SEQ ID NO: 260. In an embodiment, a signal peptide comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 259 is operably linked to SEQ ID NO: 260. In an embodiment, one or more additional polypeptides comprise or consist of a dominant negative TGFβ receptor II (dnTGFβR2) amino acid sequence as shown in SEQ ID NO: 265. In an embodiment, a signal peptide comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 263 is operably linked to SEQ ID NO: 265. In an embodiment, one or more additional polypeptides comprise a full-length LTBR amino acid sequence as shown in SEQ ID NO: 269. In an embodiment, a signal peptide comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 267 is operably linked to SEQ ID NO: 269. In an embodiment, one or more additional polypeptides comprise an LNGFR amino acid sequence as shown in SEQ ID NO: 273. In an embodiment, a signal peptide comprising or consisting of an amino acid sequence as set forth in SEQ ID NO: 271 is operably linked to SEQ ID NO: 273. In an embodiment, one or more additional polypeptides comprises the sIL-15 amino acid sequence as set forth in SEQ ID NO: 249. In an embodiment, a signal peptide comprising or consisting of an amino acid sequence as set forth in SEQ ID NO: 248 is operably linked to SEQ ID NO: 249.

[0389] In an embodiment, one or more additional polypeptides include a chimeric switch receptor comprising an extracellular domain of a TGFβ receptor for binding to TGFβ (e.g., TGFβRI and / or TGFβRII) and an intracellular domain of a cytokine receptor. The chimeric switch receptor can convert a TGFβ signal into a cytokine signal that promotes cytotoxicity. Examples of such chimeric switch receptors include those described in WO2012138858, WO2016122738, WO2018094244, WO2014172584, WO2019109980, and WO2022037562, which are incorporated by reference in their entirety.

[0390] In an embodiment, one or more additional polypeptides include dominant negative Fas (dnFas). Incorporation of such dominant negative Fas in T cells can provide functional advantages relative to control cells lacking such dominant negative Fas, can prevent Fas ligand-induced apoptosis and allow T cells to persist and have anti-tumor efficacy. Examples of dnFas include those described in Yamamoto TN et al., T cells genetically engineered to overcome death signaling enhance adoptive cancer immunotherapy, J Clin Invest. February 25, 2019; 129 (4): 1551-1565, which is incorporated herein by reference in its entirety.

[0391] In an embodiment, the one or more additional polypeptides include membrane-bound IL-12 (mbIL-12). Incorporation of such mbIL-12 into T cells can provide functional advantages relative to control cells lacking such mbIL-12, can enhance the effector function of T cells and / or limit systemic toxicity associated with IL-12. Examples of mbIL-12 include those described in Hu J. et al., Cell membrane-anchored and tumor-targeted IL-12 (attIL12)-T cell therapy for eliminating large and heterogeneous solid tumors, J Immunother Cancer. 2022 Jan;10(1):e003633; Hombach A. et al., IL12 integrated into the CAR exodomain converts CD8+T cells to poly-functional NK-like cells with superior killing of antigen-loss tumors, Mol Ther. 2022 Feb 2;30(2):593-605; and Lee EH et al., Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting, bioRxiv. 2023 Jan 7;2023.01.06.522784, each of which is incorporated herein by reference in its entirety.

[0392] In an embodiment, one or more additional polypeptides include an antibody or fragment thereof that binds to CD70, or a CAR comprising such an antibody or fragment. Incorporation of such a CD70 binding molecule into T cells can provide a functional advantage over control cells lacking the CD70 binding molecule, which can reduce HvG alloreactivity by targeting CD70+ activated T cells. Examples of such CD70 binding molecules include those described in PCT / US2023 / 29047, which is incorporated herein by reference in its entirety.

[0393] 6. Exemplary CAR

[0394] The present invention provides nucleic acid molecules encoding one or more CAR constructs described herein. In one aspect, the nucleic acid molecules are provided as messenger RNA transcripts. In one aspect, the nucleic acid molecules are provided as DNA constructs.

[0395] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 204, a CAR polypeptide PL805 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0396] In an embodiment, the nucleic acid encoding PL805 CAR comprises the sequence of SEQ ID NO: 205. Table 2 below provides an annotation of the nucleotide sequence of SEQ ID NO: 205.

[0397]

[0398] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 208, a CAR polypeptide PL880 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0399] In an embodiment, the nucleic acid encoding PL880 CAR comprises the sequence of SEQ ID NO: 209. Table 3 below provides an annotation of the nucleotide sequence of SEQ ID NO: 209.

[0400]

[0401] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 212, a CAR polypeptide PL1027 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0402] In an embodiment, the nucleic acid encoding PL1027 CAR comprises the sequence of SEQ ID NO: 213. Table 4 below provides an annotation of the nucleotide sequence of SEQ ID NO: 213.

[0403]

[0404] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 216, a CAR polypeptide PL1028 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0405] In an embodiment, the nucleic acid encoding PL1028 CAR comprises the sequence of SEQ ID NO: 217. Table 5 below provides an annotation of the nucleotide sequence of SEQ ID NO: 217.

[0406]

[0407] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 220, a CAR polypeptide PL1042 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0408] In an embodiment, the nucleic acid encoding PL1042 CAR comprises the sequence of SEQ ID NO: 221. Table 6 below provides an annotation of the nucleotide sequence of SEQ ID NO: 221.

[0409]

[0410] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 224, a CAR polypeptide PL1045 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0411] In an embodiment, the nucleic acid encoding PL1045 CAR comprises the sequence of SEQ ID NO: 225. Table 7 below provides an annotation of the nucleotide sequence of SEQ ID NO: 225.

[0412]

[0413] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 228, a CAR polypeptide PL1049 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0414] In an embodiment, the nucleic acid encoding PL1049 CAR comprises the sequence of SEQ ID NO: 229. Table 8 below provides an annotation of the nucleotide sequence of SEQ ID NO: 229.

[0415]

[0416] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 232, a CAR polypeptide PL1062 comprising the following domains in order: a signal peptide, a PSMA binding domain, a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0417] In an embodiment, the nucleic acid encoding PL1062 CAR comprises the sequence of SEQ ID NO: 233. Table 9 below provides an annotation of the nucleotide sequence of SEQ ID NO: 233.

[0418]

[0419] The above-mentioned CAR and the nucleic acid encoding it contain a specific signal peptide. In an embodiment, it may be necessary to replace another signal peptide with one signal peptide in the CAR of the present disclosure. Thus, in embodiments, an isolated nucleic acid comprising SEQ ID NO:207 encodes SEQ ID NO:206 comprising PL805 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:211 encodes SEQ ID NO:210 comprising PL880 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:215 encodes SEQ ID NO:214 comprising PL1027 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:219 encodes SEQ ID NO:218 comprising PL1028 minus the signal peptide; a nucleic acid comprising SEQ ID NO:223 encodes SEQ ID NO:222 comprising PL1042 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:227 encodes SEQ ID NO:226 comprising PL1045 minus the signal peptide; a nucleic acid comprising SEQ ID NO:231 encodes SEQ ID NO:230 comprising PL1049 minus the signal peptide; or an isolated nucleic acid comprising SEQ ID NO:232 encodes SEQ ID NO:233 comprising SEQ ID NO:234 ​​comprising SEQ ID NO:235 comprising SEQ ID NO:236 comprising PL1049 minus the signal peptide; The isolated nucleic acid of NO:235 encodes SEQ ID NO:234 ​​comprising PL1062 minus the signal peptide.

[0420] Any of the above isolated nucleic acids encoding a particular CAR polypeptide may further encode one or more additional polypeptides, as discussed herein. For example, but not limited to, any of the above nucleic acids encoding a particular CAR may comprise at least one polycistronic linker and a polynucleic acid encoding a dnTGFβR2 polypeptide.

[0421] 7. Carrier

[0422] The present invention encompasses DNA constructs comprising CAR sequences. Nucleic acid sequences encoding the desired molecules can be obtained using recombinant methods known in the art, such as by screening a library from cells expressing the gene, by obtaining the gene from a vector known to contain the gene, or by directly isolating the gene from cells and tissues containing it using standard techniques. Alternatively, the gene of interest can be synthesized rather than cloned.

[0423] The present invention provides vectors into which the DNA of the present invention is inserted. Vectors derived from retroviruses (such as lentiviruses) are suitable tools for achieving long-term gene transfer because they allow long-term stable integration of transgenes and their propagation in daughter cells. Lentivirus vectors have increased advantages over vectors derived from tumor retroviruses (such as murine leukemia viruses) because they can transduce non-proliferating cells, such as hepatocytes. They also have the advantage of increased low immunogenicity.

[0424] In another embodiment, the vector comprising the nucleic acid encoding CAR required for the present invention is an adenovirus vector (A5 / 35). In another embodiment, a transposon (such as Sleeping Beauty, Crisper, CAS9 and zinc finger nuclease) can be used to achieve the expression of the nucleic acid encoding CAR.

[0425] In short, the expression of natural or synthetic nucleic acids encoding CAR is generally achieved by operably connecting the nucleic acid encoding the CAR polypeptide or part thereof to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration of eukaryotic cells. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters that can be used to regulate the expression of the desired nucleic acid sequence.

[0426] The expression construct of the present invention can also be used for nucleic acid immunization and gene therapy using standard gene delivery schemes. Methods for gene delivery are known in the art (e.g., U.S. Patents 5,399,346, 5,580,859, 5,589,466, which are incorporated herein by reference in their entirety). In another embodiment, the present invention provides gene therapy vectors.

[0427] Nucleic acids can be cloned into various types of vectors. For example, nucleic acids can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0428] Further, the expression vector can be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses and slow viruses. In general, suitable vectors contain a functional origin of replication, a promoter sequence, a convenient restriction endonuclease site and one or more selectable markers (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193). Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene transfer systems. The selected gene can be inserted into a vector using techniques known in the art and packaged in retroviral particles. The recombinant virus can then be separated and delivered to the cells of the subject in vivo or in vitro. Many retroviral systems are known in the art. In an embodiment, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

[0429] Other promoter elements, such as enhancers, regulate the frequency of transcription initiation. Typically, these are located in the region 30-110bp upstream of the start site, although many promoters have recently been shown to contain functional elements downstream of the start site. The spacing between promoter elements is usually flexible so that when the elements are inverted or moved relative to each other, promoter function is retained. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50bp before activity begins to decline. Depending on the promoter, it seems that individual elements can work collaboratively or independently to activate transcription.

[0430] An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as but not limited to actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Further, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also considered to be part of the present invention. The use of an inducible promoter provides a molecular switch that can turn on the expression of an operably linked polynucleotide sequence when such expression is desired, or turn off such expression when such expression is not desired. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0431] In order to evaluate the expression of CAR polypeptides or parts thereof, the expression vector to be introduced into the cell may also contain a selectable marker gene or a reporter gene or both, so as to confirm and select the expressing cells from the cell populations attempted to be transfected or infected by viral vectors. In other aspects, the selectable markers may be carried on separate DNA fragments and used for co-transfection procedures. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in host cells. Useful selectable markers include, for example, antibiotic resistance genes, such as neo, etc.

[0432] Reporter gene is used to identify potential transfected cells and for evaluating the functionality of regulatory sequences. In general, reporter gene is a gene that is not present in or expressed by a recipient organism or tissue, and it encodes a polypeptide, the expression of which is expressed by some easily detectable properties (e.g., enzyme activity). The expression of reporter gene is measured at the appropriate time after DNA has been introduced into the recipient cell. Suitable reporter gene may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase or green fluorescent protein gene (e.g., Ui-Tei et al., 2000FEBS Letters479:79-82). Suitable expression systems are well known and can be prepared or commercially obtained using known techniques. In general, the construct with the minimum 5' flanking region showing the highest expression level of reporter gene is confirmed as a promoter. This type of promoter region can be connected to a reporter gene and used to assess the ability of a medicament to regulate promoter-driven transcription.

[0433] Methods for introducing genes into cells and expressing them are known in the art. In the context of expression vectors, the vectors can be easily introduced into host cells, such as mammalian, bacterial, yeast or insect cells, by any method in the art. For example, the expression vectors can be transferred to host cells by physical, chemical or biological means.

[0434] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for generating cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). One method for introducing polynucleotides into host cells is calcium phosphate transfection.

[0435] Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used methods for inserting genes into mammals (e.g., human cells). Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, etc. See, for example, U.S. Patents Nos. 5,350,674 and 5,585,362.

[0436] Chemical methods for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system used as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0437] In the case of utilizing a non-viral delivery system, an exemplary delivery vehicle is a liposome. Consider using lipid formulations to introduce nucleic acid into a host cell (in vitro, in vitro or in vivo). On the other hand, nucleic acid can be associated with lipids. Nucleic acids associated with lipids can be encapsulated in the aqueous interior of liposomes, dispersed in the lipid bilayer of liposomes, connected to liposomes via a connecting molecule associated with both liposomes and oligonucleotides, trapped in liposomes, compounded with liposomes, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, included in lipids as a suspension, included in micelles or compounded with micelles or otherwise associated with lipids. Lipid, lipid / DNA or lipid / expression vector related compositions are not limited to any specific structure in solution. For example, they can be present in a double-layer structure, as micelles, or have a "collapsed" structure. They can also be simply dispersed in solution, and may form aggregates with uneven size or shape. Lipid is a fatty substance, which can be naturally occurring or synthetic lipids. For example, lipids include fat droplets naturally present in the cytoplasm as well as a class of compounds containing long-chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0438] Suitable lipids are available from commercial sources. For example, dimyristoylphosphatidylcholine ("DMPC") is available from Sigma, St. Louis, Mo.; dicetyl phosphate ("DCP") is available from K&K Laboratories (Plainview, NY); cholesterol ("Choi") is available from Calbiochem-Behring; dimyristoylphosphatidylglycerol ("DMPG") and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the only solvent because it evaporates more easily than methanol. "Liposome" is a general term covering various monolayer and multilayer lipid vehicles formed by producing closed lipid bilayers or aggregates. Liposomes can be characterized by having a vesicle structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in an excess of aqueous solution, they form spontaneously. The lipid assembly undergoes self-rearrangement before forming a closed structure, and water and dissolved solutes are trapped between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions having structures different from normal vesicle structures in solution are also contemplated. For example, lipids may present micellar structures, or may exist only as heterogeneous aggregates of lipid molecules. Cationic liposomes (lipofectamine)-nucleic acid complexes are also contemplated.

[0439] Regardless of the method used to introduce exogenous nucleic acid into host cells or expose cells to the inhibitors of the present invention, a variety of assays can be performed to confirm the presence of the recombinant DNA sequence in the host cell. Such assays include, for example, "molecular biology" assays well known to those skilled in the art, such as Southern and Northern blots, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of specific peptides, for example, by immunological methods (ELISA and Western blots) or by assays described herein to confirm that the agents fall within the scope of the present invention.

[0440] 8. Host Cells

[0441] The CAR polypeptides disclosed herein can be expressed in a variety of host cells via their corresponding nucleic acid constructs. In embodiments, the host cell is a mammalian cell. Host cells as described herein can be stored, for example, cryopreserved, for adoptive cell transfer. In embodiments, before the host cell is engineered to express the CAR polypeptide, the cell is stored first. In embodiments, the cell is engineered to express the CAR polypeptide and then the cell is stored.

[0442] Preferred host cells for use with the CAD polypeptides and chimeric receptors of the present disclosure include immune cells. Such cells may be obtained from the subject to be treated (i.e., autologous), or alternatively immune cell lines or donor immune cells (allogeneic, isogenic) may be used. Immune cells may be obtained from many sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. Any number of techniques known to those skilled in the art (such as Ficoll TM Immune cells are obtained from blood collected from a subject by separation. For example, cells in the circulating blood of an individual can be obtained by apheresis. In embodiments, immune cells are separated from peripheral blood lymphocytes by lysing red blood cells and depleting monocytes, for example, by PERCOLL TM Gradient centrifugation or by countercurrent centrifugal elutriation. Specific immune cell subsets can be further separated by positive or negative selection techniques. For example, immune cells can be separated using a combination of antibodies for surface markers specific to positively selected cells, for example, by incubating with antibody-conjugated beads for a time sufficient to positively select the desired immune cells. Alternatively, negative selection can also be performed using a combination of antibodies for surface markers specific to negatively selected cells, thereby achieving enrichment of immune cell populations. Other specific methods of separation and / or enrichment are disclosed herein.

[0443] In embodiments, immune cells include any leukocytes involved in protecting the body from infectious diseases and foreign substances. For example, immune cells may include lymphocytes, monocytes, macrophages, dendritic cells, mast cells, neutrophils, basophils, eosinophils or any combination thereof. For example, immune cells related to the present disclosure may include but are not limited to αβT cells, γδT cells, NK cells, NKT cells, γδNKT cells, B cells, innate lymphoid cells (ILC), cytokine-induced killer (CIK) cells, cytotoxic T lymphocytes (CTL), lymphokine-activated killer (LAK) cells, regulatory T cells, etc. In embodiments, preferred immune cells include αβT cells, γδT cells, NK cells, NKT cells, γδNKT cells, and / or macrophages in some examples. In embodiments, preferred immune cells include γδT cells. In embodiments, immune cells related to the present disclosure include allogeneic cells, autologous cells or isogenic cells.

[0444] Thus, aspects of the invention include host cells (in some preferred embodiments, γδ T cells) that functionally express the isolated nucleic acid described herein and thereby express a CAR on the surface of the cell.

[0445] Aspects of the invention may additionally or alternatively include host cells, preferably γδ T cells, having in vitro or in vivo cytotoxic activity against tumor cells that exhibit cell surface expression of PSMA.

[0446] In some cases, cytotoxic activity is an innate activity. In some cases, cytotoxicity is at least partially, significantly (> about 25%) or completely due to the presence of a CAR construct, the CAR construct having a binding domain that specifically binds to PSMA expressed on the surface of tumor cells. In some cases, the tumor cell killing activity exhibited by host cells, preferably γδT cells, is greater than the innate level of in vitro and / or in vivo tumor cell killing activity in control cells of the same cell type. In some cases, the control cells do not include a CAR construct. In some cases, the control cells include a CAR construct lacking a binding domain described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a co-stimulatory intracellular domain described herein.

[0447] In some cases, the cytotoxicity is at least partially, significantly (> about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to PSMA or an epitope within PSMA. In some cases, the host cell, preferably a γδ T cell, functionally expresses a PSMA-specific CAR encoded by an isolated nucleic acid described herein.

[0448] In embodiments where the host cell is a γδ T cell, the γδ T cell may exhibit HLA-restricted (e.g., HLA class I-restricted) cytotoxicity. In other embodiments, most (>50%), substantially all (>90%), or all of the cytotoxic activity is not HLA-restricted (e.g., HLA class I-restricted). HLA-restricted cytotoxic activity can be determined by comparing in vitro cytotoxicity against HLA (e.g., HLA class I) (null) tumor cell lines to that against HLA+ (e.g., HLA class I) (null) tumor cell lines. + The in vitro cytotoxicity of HLA-restricted tumor cell lines is evaluated. In embodiments, the HLA-restricted cytotoxic activity is provided at least partially, significantly (>25%) or completely by using a T cell receptor-like binding domain. A T cell receptor-like binding domain is a binding domain that specifically recognizes an antigen when presented in complex with an MHC molecule on the cell surface. T cell receptor-like binding domains are further described, for example, in WO 2016 / 199141.

[0449] The host cells described herein, preferably γδT cells, may exhibit robust and / or sustained tumor cell killing activity. In some cases, the tumor cell killing activity may be sustained for at least about 6 days to 120 days, or at least about 6 days to 180 days, from the first contact with the tumor cell. In some cases, the host cells described herein, preferably γδT cells or their progeny, may have a tumor cell killing activity that is sustainable for at least about 6 days to 120 days, or at least about 6 days to 180 days, from the first contact with the tumor cell, or from the administration of the host cell. This sustained tumor cell killing activity may be performed in vitro, in vivo, or simultaneously in vitro and in vivo.

[0450] Aspects of the present invention may additionally or alternatively include host cells, preferably γδT cells, that proliferate in response to contact with cells that express or overexpress PSMA on the cell surface. Cells that express or overexpress PSMA on the cell surface may be tumor cells or non-tumor cells. In some cases, proliferation is an innate activity. In some cases, the increase in value is at least partially, significantly (> about 20% or > about 25%) or entirely due to the presence of a CAR construct, which has a binding domain that specifically binds to PSMA expressed on the surface of tumor cells. In some cases, host cells, preferably γδT cells, exhibit higher levels of in vitro and / or in vivo proliferation compared to control cells of the same type. In some cases, the control cells do not include a CAR construct. In some cases, the control cells include a CAR construct lacking a binding domain described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a co-stimulatory intracellular domain described herein.

[0451] Host cells as described herein, preferably γδT cells, exhibit robust and / or sustained proliferation in host organisms comprising cells (eg, tumor cells), wherein the blood and / or solid tumor cells exhibit cell surface expression or overexpression of PSMA. In some cases, from the first contact with tumor cells, or from the date of administration of host cells, preferably γδT cells to the host organism, proliferation can last for at least about 6 days to 120 days, or for at least about 6 days to 180 days. In some cases, from the first contact with PSMA-expressing cells, or from the first administration of host cells, preferably γδT cells to the host organism, the host cells described herein in the host organism comprising cells expressing PSMA cell surface expression or overexpression, preferably γδT cells or their progeny can last for at least about 6 days to about 120 days, or for at least about 6 days to about 180 days. In some cases, the proliferation in the host organism is at least partially, significantly (> about 20% or > about 25%) or entirely due to the presence of a CAR construct having a binding domain that specifically binds to an epitope within PSMA or PSMA. In some cases, a host cell, preferably a γδ T cell, exhibiting proliferation in a host organism functionally expresses a PSMA-specific CAR encoded by an isolated nucleic acid described herein, wherein the host organism comprises cells that exhibit PSMA cell surface expression.

[0452] In embodiments, the host cells described herein, preferably γδ T cells, express or continue to express proinflammatory cytokines, such as tumor necrosis factor α or interferon γ, after contact with PSMA-expressing cells. In embodiments, the host cells described herein, or their progeny, express or continue to express proinflammatory cytokines, such as tumor necrosis factor α or interferon γ, after contact with PSMA-expressing cells (e.g., in a host organism comprising PSMA-expressing cells).

[0453] In the embodiment, when introduced into an allogeneic host, the γδT cells or the pharmaceutical composition containing the γδT cells do not substantially show or show a graft-versus-host reaction. In the embodiment, when introduced into an allogeneic host, the γδT cells or the pharmaceutical composition containing the γδT cells show a clinically acceptable level of graft-versus-host reaction. In the embodiment, the clinically acceptable level is the amount of graft-versus-host reaction that does not require stopping γδT cell therapy to achieve therapeutically effective treatment. In the embodiment, according to the applicable IBMTR grading scale, the clinically acceptable level of graft-versus-host reaction (GvHD) is an acute reaction that is not as severe as grade C. The severity of the acute graft-versus-host reaction is determined by assessing the extent of involvement of the skin, liver, and gastrointestinal tract. The stages of involvement of each organ are combined to produce an overall score, which has prognostic significance. Grade I (A) GvHD is characterized as mild disease, grade II (B) GvHD is characterized as moderate, grade III (C) is characterized as severe, and grade IV (D) is life-threatening. The IBMTR grading system defines the severity of acute GvHD as follows (Rowlings et al. =, Br J Haematol 1997;97:855):

[0454] Grade A – Stage 1 skin involvement only (maculopapular rash on <25 percent of the body) with no liver or gastrointestinal involvement

[0455] Grade B – Stage 2 skin involvement; Stage 1 to 2 intestinal or liver involvement

[0456] Grade C – Stage 3 with involvement of any organ system (generalized erythroderma; bilirubin 6.1 to 15.0 mg / dL; diarrhea 1500 to 2000 mL / day)

[0457] Grade D – Stage 4 with involvement of any organ system (generalized erythroderma with bullous formation; bilirubin >15 mg / dL; diarrhea >2000 mL / day or pain or ileus).

[0458] See also Schoemans et al., Bone Marrow Transplantation Vol. 53, pp. 1401–1415 (2018), e.g., at Tables 1 and 2, which discloses criteria for assessing and grading acute GvHD.

[0459] In embodiments, compared to the graft-versus-host response exhibited by a control αβT cell or a control pharmaceutical composition comprising the control αβT cell administered to an allogeneic host, when introduced into an allogeneic host, the γδT cell or a pharmaceutical composition containing the γδT cell exhibits a reduced or significantly reduced graft-versus-host response. In some cases, the control αβT cell is an allogeneic non-engineered control αβT cell. In some cases, the control αβT cell does not include a CAR or does not include the same CAR as the reference γδT cell.

[0460] In embodiments, host cells described herein, preferably γδT cells, may be modified to include one or more gene editing.Gene editing discussed herein is a genetic engineering in which nucleotides / nucleic acids are inserted, deleted, and / or replaced in a DNA sequence (such as the genome of γδT cells). Targeted gene editing can be inserted, deleted, and / or replaced at a pre-selected site in the target cell genome. When editing the endogenous gene sequence, for example, by deleting, inserting, or replacing nucleotides / nucleic acids, the endogenous gene containing the affected sequence may be knocked out or knocked down due to sequence changes. Therefore, targeted editing can be used to destroy endogenous gene expression. The "destroyed gene" discussed herein refers to a gene that contains insertion, deletion, or substitution relative to an endogenous gene, so that the expression of a functional protein from an endogenous gene is reduced or inhibited. As used herein, "destroying a gene" refers to inserting, deleting, or replacing at least one nucleotide / nucleic acid in an endogenous gene, so that the expression of a functional protein from an endogenous gene is reduced or inhibited. Methods for destroying genes are known to those skilled in the art, and are described in, for example, U.S. Patent No. 11254912, which is incorporated herein by reference as a whole.

[0461] In embodiments, the targeted gene editing of T cells can be performed using a nuclease-dependent method. This nuclease-dependent method can achieve targeted editing by introducing double-strand breaks (DSBs) by specific endonucleases. This nuclease-dependent targeted editing utilizes DNA repair mechanisms, such as non-homologous end joining (NHEJ), which occurs in response to DSBs. Repairing DNA by NHEJ usually results in random insertion or deletion (indel) of a small amount of endogenous nucleotides. In contrast to the repair mediated by NHEJ, repair can also occur by homology-directed repair (HDR). When containing exogenous genetic material, a donor template with a pair of homologous arms on both sides exists, exogenous genetic material can be introduced into the genome by HDR, which results in targeted integration of exogenous genetic material. Available endonucleases that can introduce specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; Clustered Regularly Interspaced Short Palindromic Repeats Related to 9). It is discussed herein that a CRISPR system or CRISPR nuclease system may include a non-coding RNA molecule that binds DNA (e.g., a guide RNA) and a Cas protein (e.g., Cas9) that has nuclease functionality (Sander et al., Nature Biotechnology (2014); 32:347-355; Hsu et al., Cell (2014); 157(6):1262-1278).

[0462] In an embodiment, the host cell, preferably a γδ T cell, comprises one or more disrupted genes. For example, the one or more genes whose expression is disrupted may include adenosine A2a receptor (ADORA), CD276, V-group domain containing inhibitor of T cell activation 1 (VTCN1), B and T lymphocyte-associated (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDO1), killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail,1 (KIR3DL1), lymphocyte activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cell receptor 2 (HAVCR2), V-domain immunoglobulin inhibitor of T cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine-induced SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), adeno-associated virus integration site (AAVSSITE (e.g., AAVS1, AAVS2, etc.)), or chemokine (C—C motif) receptor 5 (gene / pseudogene) (CCR5) , CD160 molecule (CD160), T cell immunoreceptor with Ig and ITIM domains (TIGIT), CD96 molecule (CD96), cytotoxic and regulatory T cell molecule (CRTAM), leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), sialic acid-binding Ig-like lectin 7 (SIGLEC7), sialic acid-binding Ig-like lectin 9 (SIGLEC9), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), tumor necrosis factor receptor superfamily member 10a (TNFRSF10A), caspase 8 (CASP8 ), caspase 10 (CASP10), caspase 3 (CASP3), caspase 6 (CASP6), caspase 7 (CASP7), Fas-associated death domain (FADD), Fas cell surface death receptor (FAS), transforming growth factor beta receptor II (TGFBRII), transforming growth factor beta receptor I (TGFBR1), SMAD family member 2 (SMAD2), SMAD family member 3 (SMAD3), SMAD family member 4 (SMAD4), SKI proto-oncogene (SKI), SKI-like proto-oncogene (SKIL) , TGFB inducing factor homeobox 1 (TGIF1), interleukin 10 receptor subunit alpha (IL10RA), interleukin 10 receptor subunit beta (IL10RB), heme oxygenase 2 (HMOX2), interleukin 6 receptor (IL6R), interleukin 6 signal transducer (IL6ST), c-src tyrosine kinase (CSK), phosphoprotein membrane anchor with glycosphingolipid microdomain 1 (PAG1), signaling threshold regulating transmembrane adaptor 1 (SIT1), forkhead box P3 (FOXP3), PR domain 1 (PRDM1), basic leucine zipper transcription factor,ATF-like (BATF), soluble guanylate cyclase 1α2 (GUCY1A2), soluble guanylate cyclase 1α3 (GUCY1A3), soluble guanylate cyclase 1β2 (GUCY1B2), soluble guanylate cyclase 1β3 (GUCY1B3), cytokine-induced SH2-containing protein (CISH), prolyl hydroxylase domain (PHD1, PHD2, PHD3) protein family, or Cbl proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91), Roquin, CD58, ICAM-1, or any combination thereof.

[0463] In embodiments, the gene whose expression is destroyed is CISH, i.e., a negative regulator of TCR signaling. Destruction of CISH gene can provide functional advantages relative to control cells with complete CISH gene, improve sensitivity to certain cytokines (e.g., IL-2 / IL-15), increase T cell proliferation and / or limit T cell exhaustion. In some examples, the CISH gene can be destroyed by the method described in Daher M et al., Targeting a cytokine checkpoint enhances the fitness of armoredcord blood CAR-NK cells, Blood. February 4, 2021; 137 (5): 624-636, and the document is incorporated herein by reference as a whole. In some examples, the CISH gene is destroyed by gene editing using an RNA-guided nuclease system, and the RNA-guided nuclease system includes one or more guide RNAs comprising a sequence of any one of SEQ ID NO: 250-253 and 315-316.

[0464] In embodiments, the gene whose expression is disrupted is CBL-B, a negative regulator of T cell activation. The destruction of the CBL-B gene...

Claims

1. An affinity binding entity comprising an antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA), wherein the antigen binding domain comprises: A heavy chain variable region / light chain variable region (HCVR / LCVR) sequence pair selected from the group consisting of SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36; or six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36. NO: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34 and 35 / 36.

2. The affinity binding entity of claim 1, wherein the antigen binding domain comprises: A HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14; or six CDRs of a HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.

3. The affinity binding entity of claim 1 or claim 2, wherein the affinity binding entity is an antibody or antibody fragment; optionally wherein the affinity binding entity is selected from the group consisting of: scFv, Fab, Fab', Fv, F(ab') 2 , dsFv, dAb, and any combination or multiple thereof.

4. Affinity binding entity according to claim 3, wherein said antibody or antibody fragment is bispecific or monoclonal.

5. The affinity binding entity of claim 3 or claim 4, wherein the antibody or antibody fragment is chimeric, humanized or human.

6. A chimeric antigen receptor (CAR), wherein the CAR comprises the affinity binding entity of any one of claims 2-5.

7. The CAR of claim 6, wherein the CAR further comprises a hinge domain; optionally wherein the hinge domain comprises a glycine polymer, a glycine-serine polymer, a glycine-alanine polymer, an alanine-serine polymer, an immunoglobulin heavy chain hinge, or a receptor-derived hinge.

8. The CAR of claim 7, wherein the receptor-derived hinge is a CD8α hinge domain, optionally wherein the CD8α hinge domain comprises the amino acid sequence shown in SEQ ID NO:

156.

9. The CAR of any one of claims 6-8, further comprising a transmembrane (TM) domain; optionally wherein the TM domain comprises the following TM region: 4-1BB / CD137, activating NK cell receptor, immunoglobulin, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154, CD100 (SEM) A4D), CD103, CD160(BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276(B7-H3), CD28, CD29, CD3δ, CD3ε, CD3γ, CD3ζ, CD30, CD4 , CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96(Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRT AM, cytokine receptor, DAP10, DNAM1 (CD226), Fcγ receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell co-stimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGBl, KIRDS2, LAT, LFA-1, ligand that specifically binds to CD83, LIGHT, LTBR, ​​Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC Class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecules (SLAM proteins), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Ly108), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6 or fragments, truncations or combinations thereof.

10. The CAR of claim 9, wherein the TM domain comprises the TM domain of CD8, preferably wherein the CD8 TM domain is the TM domain of CD8α; optionally wherein the TM domain comprises the amino acid sequence shown in SEQ ID NO:

158.

11. The CAR of any one of claims 6-10, further comprising at least one co-stimulatory domain; optionally wherein the co-stimulatory domain comprises the following co-stimulatory domains: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54(ICAM), CD69, CD70, CD80, CD83, CD84 , CD86, CD96(Tactile), CD100(SEMA4D), CD103, CD134(OX40), CD137(4-1BB), CD152(CTLA-4), CD160(BY55), CD162(SELPLG), CD244( 2B4), CD270(HVEM), CD226(DNAM1), CD229(Ly9), CD278(ICOS), ICAM-1, LFA-1(CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG 2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, ​​LAT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGA X, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2 or TRANCE / RANKL, or a portion or combination thereof.

12. The CAR of claim 11, wherein the co-stimulatory domain is a 4-1BB co-stimulatory domain; optionally wherein the 4-1BB co-stimulatory domain comprises the amino acid sequence shown in SEQ ID NO:

162.

13. The CAR of any one of claims 6 to 12, further comprising one or more intracellular signaling domains, preferably wherein the intracellular signaling domain is a CD3 zeta intracellular signaling domain; optionally wherein the CD3 zeta intracellular signaling domain comprises the amino acid sequence shown in SEQ ID NO: 164, 166 or 167.

14. The CAR of any one of claims 6 to 13, further comprising a signal peptide; optionally wherein the signal peptide comprises the amino acid sequence shown in SEQ ID NO:

152.

15. An isolated polynucleotide comprising a nucleic acid sequence encoding the affinity binding entity of any one of claims 1-5.

16. An expression vector comprising the polynucleotide of claim 15, operably linked to a cis-acting regulatory element.

17. A cell comprising the affinity binding entity of any one of claims 1 to 5, the isolated polynucleotide of claim 15 and / or the expression vector of claim 16.

18. An isolated polynucleotide comprising a nucleic acid sequence encoding the CAR of any one of claims 6-14.

19. The isolated polynucleotide of claim 18, further comprising a nucleic acid sequence encoding at least one polycistronic linker region; optionally the polycistronic region encodes a cleavage sequence and / or an internal ribosome entry site (IRES).

20. The isolated polynucleotide of claim 19, wherein the cleavage sequence is selected from the group consisting of T2A, F2A, P2A, E2A, furin, and furin-P2A (FP2A).

21. The isolated polynucleotide of any one of claims 18-20, further comprising a nucleic acid sequence encoding one or more additional polypeptides.

22. An isolated polynucleotide as described in claim 21, wherein the one or more additional polypeptides are selected from the group consisting of: lymphotoxin beta receptor (LTBR), low affinity nerve growth factor receptor (LNGFR), dominant negative (dn) receptor of TGF-β or Fas, a truncated form of human epidermal growth factor receptor (EGFRt), membrane-bound IL-12 (mbIL-12), a fluorescent protein, a gamma chain cytokine, CD19, CD20, CAR bound to CD70, and any combination thereof.

23. The isolated polynucleotide of claim 22, wherein the one or more additional polypeptides is dnTGFβR2, optionally wherein the dnTGFβR2 comprises the amino acid sequence shown in SEQ ID NO:

265.

24. The isolated polynucleotide of claim 22, wherein the additional polypeptide is a LTBR, ​​wherein the LTBR comprises the amino acid sequence shown in SEQ ID NO:

267.

25. The isolated polynucleotide of claim 22, wherein the additional polypeptide is EGFRt, wherein the EGFRt comprises the amino acid sequence shown in SEQ ID NO:

261.

26. The isolated polynucleotide of claim 22, wherein the additional polypeptide is LNGFR, wherein the LNGFR comprises the amino acid sequence shown in SEQ ID NO:

273.

27. An isolated polynucleotide as described in any one of claims 22-26, wherein the one or more additional polypeptides are operably linked to a nucleic acid sequence encoding a signal peptide; optionally wherein the signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:259, SEQ ID NO:263, SEQ ID NO:267, SEQ ID NO:271 and SEQ ID NO:

248.

28. The isolated polynucleotide of any one of claims 18-27, comprising the nucleic acid sequence of SEQ ID NO: 205, 209, 213, 217, 221, 225, 229 or 233.

29. An expression vector comprising the isolated polynucleotide of any one of claims 18-28, operably linked to a cis-regulatory element.

30. A γδ T cell, comprising: (a) a nucleic acid sequence encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an affinity binding domain that specifically binds to prostate-specific membrane antigen (PSMA); and / or (b) a polypeptide comprising a CAR, wherein the CAR comprises an amino acid sequence encoded by the nucleic acid of (a); wherein the γδ T cells functionally express the binding domain of the CAR encoded by the polypeptide or nucleic acid on the surface of the γδ T cells.

31. The γδ T cell of claim 30, wherein the CAR comprises the affinity binding entity of any one of claims 2-5; or Wherein the nucleic acid sequence comprises the isolated polynucleotide of any one of claims 18 to 28, or the expression vector of claim 29.

32. A modified immune cell comprising a CAR as described in any one of claims 6-14, a polynucleotide as described in any one of claims 18-28, or an expression vector as described in claim 29.

33. The modified immune cell of claim 32, wherein the modified immune cell is a γδT cell, a γδNKT cell, an αβT cell, a NK cell, a NKT cell, or a macrophage.

34. The modified immune cell of claim 33, wherein the modified immune cell is a γδT cell, optionally wherein the γδT cell is a δ1, δ2, δ3 or δ4 γδT cell, preferably a δ2 - γδ T cells, more preferably δ1 γδ T cells.

35. The modified immune cell according to any one of claims 32-34, or the γδ T cell according to claim 30 or claim 31, wherein the modified immune cell or the γδ T cell exhibits in vitro and / or in vivo cytotoxic activity against tumor cells exhibiting PSMA cell surface expression.

36. The modified immune cell or γδ T cell according to claim 35, wherein the modified immune cell or the γδ T cell proliferates in response to contact with the tumor cells exhibiting PSMA cell surface expression; optionally wherein the modified immune cell or the γδ T cell proliferates in a host organism comprising tumor cells exhibiting PSMA cell surface expression.

37. The modified immune cell according to any one of claims 32-36, or the γδ T cell according to any one of claims 30-31 or 35-36, wherein the modified immune cell or the γδ T cell expresses pro-inflammatory cytokines after contact with tumor cells exhibiting PSMA cell surface expression.

38. The modified immune cell according to any one of claims 32-37, or the γδ T cell according to any one of claims 30-31 or 35-37, which further comprises at least one disrupted gene; optionally wherein the at least one disrupted gene is cytokine-inducible SH2-containing protein (CISH), Cbl proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91), CD58, ICAM-1, or any combination thereof.

39. A method for preparing the modified immune cell according to any one of claims 32-38, or the γδ T cell according to any one of claims 30-31 or 35-38, wherein the method comprises transfecting an immune cell or a γδ T cell with the expression vector according to claim 29, optionally wherein the cell has at least one disrupted gene.

40. The method according to claim 39, wherein the method comprises retroviral transduction.

41. The method according to claim 39 or 40, wherein the method comprises ex vivo expansion of the immune cell or the γδ T cell, wherein the ex vivo expansion is performed before and / or after the expression vector transfection.

42. An antibody-drug conjugate (ADC) comprising the affinity binding entity according to any one of claims 1-5.

43. A pharmaceutical composition comprising the affinity binding entity according to any one of claims 1-5 or the ADC according to claim 42 and a pharmaceutically acceptable carrier.

44. A pharmaceutical composition comprising a plurality of modified immune cells as described in any one of claims 32-38, or a plurality of γδT cells as described in any one of claims 30-31 or 35-38; optionally wherein the plurality comprises at least 60%, 80% or about 60% or 80% to about 90% or 95% of δ1, δ2, δ3 or δ4 γδT cells, preferably δ1 or δ2 γδT cells, more preferably δ2-γδT cells, most preferably δ1 γδT cells, and a pharmaceutically acceptable carrier.

45. The pharmaceutical composition of claim 44, wherein the plurality of 7 modified immune cells or γδT cells, preferably about 10 8 Modified immune cells or γδT cells to about 10 11 A modified immune cell or γδ T cell.

46. ​​A method of inhibiting the growth of a cell that exhibits PSMA cell surface expression, comprising contacting the cell with an affinity binding entity as described in any one of claims 1-5, a modified immune cell as described in any one of claims 32-38, a γδ T cell as described in any one of claims 30-31 or 35-38, an ADC as described in claim 42, or a pharmaceutical composition as described in any one of claims 43-45.

47. A method of killing a tumor cell that exhibits cell surface expression of PSMA, comprising contacting the tumor cell with a therapeutically effective amount of an affinity binding entity as described in any one of claims 1-5, a modified immune cell as described in any one of claims 32-38, a γδ T cell as described in any one of claims 30-31 or 35-38, an ADC as described in claim 42, or a pharmaceutical composition as described in any one of claims 43-45.

48. The method of claim 47, wherein the method comprises introducing a therapeutically effective amount of the affinity binding entity, the modified immune cell, the γδ T cell, the ADC or the pharmaceutical composition into a host organism comprising the tumor cell.

49. The method of claim 48, further comprising One or more methods of increasing common γ chain cytokines are administered simultaneously or sequentially; optionally wherein the one or more methods of increasing common γ chain cytokines include administering a certain amount of common γ chain cytokines simultaneously or sequentially, performing lymphocyte depletion before introducing the modified immune cells or the γδT cells, and / or secreting one or more common γ chain cytokines from the introduced modified immune cells or γδT cells.

50. The method of any one of claims 46-49, wherein the host organism is a human and the method is a method of treating cancer in a subject in need thereof.

51. Use of the affinity binding entity of any one of claims 1-5, the modified immune cell of any one of claims 32-38, the γδ T cell of any one of claims 30-31, 35-38, the ADC of claim 42 or the pharmaceutical composition of any one of claims 43-45 in the preparation of a medicament for treating cancer.

Images