Application of circsatb1 in preparation of medicine for improving sheep reproductive ability

By overexpressing the circSATB1 gene in sheep, the proliferation and migration of endometrial epithelial cells were promoted and apoptosis was inhibited. This solved the problem of unresolved circRNA regulation of endometrial receptivity in existing technologies, and improved sheep fertility and embryo implantation rate.

CN120037354BActive Publication Date: 2026-05-19HAINAN RES INST OF ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HAINAN RES INST OF ZHEJIANG UNIV
Filing Date
2025-02-19
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current technology has not elucidated the regulatory role of seminal plasma EV-derived circRNAs in endometrial receptivity formation and embryo implantation, nor the underlying molecular mechanisms, leading to a high pregnancy failure rate.

Method used

In the preparation of drugs to improve sheep fertility, circSATB1 was applied by overexpressing the circSATB1 gene to promote the proliferation and migration of sheep endometrial epithelial cells and inhibit endometrial epithelial cell apoptosis. Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing circSATB1 were used to promote the expression of the circSATB1 gene.

Benefits of technology

It significantly improved the fertility of sheep, promoted the formation of endometrial receptivity, and increased the embryo implantation rate in female animals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005277845270000051
    Figure BDA0005277845270000051
  • Figure BDA0005277845270000061
    Figure BDA0005277845270000061
  • Figure BDA0005277845270000062
    Figure BDA0005277845270000062
Patent Text Reader

Abstract

The application discloses application of circSATB1 in preparation of a medicine for improving the reproductive capacity of sheep, and belongs to the technical field of biological medicine. The nucleotide sequence of the circSATB1 is shown as SEQ ID NO. 1. The application firstly analyzes the sheep seminal plasma extracellular vesicle circRNA expression profile, wherein the expression amount of circSATB1 in the seminal plasma extracellular vesicle is relatively high, overexpression of the circSATB1 can extremely significantly promote the proliferation and migration of endometrial epithelial cells, and significantly inhibit the apoptosis of the endometrial epithelial cells. Interference with the circSATB1 can extremely significantly inhibit the proliferation and migration of the endometrial epithelial cells, and extremely significantly promote the apoptosis of the endometrial epithelial cells. The above results prove the important significance of the circSATB1 in the formation of endometrial receptivity, and provide a new idea for improving the embryo implantation rate of a female animal.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of circSATB1 in the preparation of drugs to improve sheep fertility. Background Technology

[0002] In the normal physiological cycle of mammals, the endometrium has only a very short period of time that is receptive to embryo implantation; this period is called the "window of opportunity" and is essential for embryo localization, adhesion, and implantation. During this window, the endometrium has maximum receptivity, meaning that the formation of endometrial receptivity is crucial for successful embryo implantation. When the endometrial environment is unsuitable for embryo implantation, pregnancy failure occurs (Hu et al., 2023). Recently, increasing research has confirmed that paternal factors such as seminal plasma interact with the female reproductive tract during reproduction, thereby regulating biological processes such as embryonic development, endometrial receptivity formation, and embryo implantation (Ahmadi et al., 2022).

[0003] Extracellular vesicles (EVs) are membrane-bound vesicles widely distributed in biological fluids. They play an important regulatory role in intercellular communication by selectively transferring small molecules such as proteins, circRNAs, miRNAs, and mRNAs they carry to target cells (Kalluri and LeBleu, 2020). In 2022, Gholipour et al. first discovered that seminal plasma EVs from patients with unexplained infertility inhibited the formation of endometrial receptivity, leading to a decrease in the expression of endometrial receptivity marker mRNAs (Gholipour et al., 2022). These studies preliminarily confirm that seminal plasma EVs can regulate reproductive-related biological processes such as endometrial receptivity formation and embryo implantation; however, the underlying molecular mechanisms and regulatory networks remain unresolved, and there is little research on them in the field of animal reproduction.

[0004] circRNAs are important regulatory factors carried by endoblastic embryos (EVs), primarily functioning through five pathways: promoting the initiation and elongation of cellular RNAPII transcription genes, negatively regulating the expression of linear homologous mRNAs, disrupting the function of translation and ribosome-related protein complexes, translating into functional peptide chains, and acting as competing endogenous RNAs (ceRNAs) to regulate mRNA stability by binding to miRNAs (Chen, 2020). Because the ceRNA network involves multiple RNA molecules, including non-coding RNAs and mRNAs, it can provide a more comprehensive and in-depth explanation of some biological phenomena, and has become a research hotspot in recent years for elucidating the mechanisms of endometrial receptivity formation and embryo implantation (Zhang et al., 2024). However, to date, no studies have reported the regulatory role of seminal plasma EV-derived circRNAs in endometrial receptivity formation and embryo implantation, nor the underlying molecular mechanisms and regulatory networks. Summary of the Invention

[0005] The purpose of this invention is to provide the application of circSATB1 in the preparation of drugs to improve sheep fertility, so as to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] One of the technical solutions of this invention is the application of circSATB1 in the preparation of a drug to improve sheep fertility. The nucleotide sequence of circSATB1 is shown in SEQ ID NO.1.

[0008] The second technical solution of the present invention is the application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the preparation of drugs to improve sheep fertility.

[0009] The third technical solution of this invention is the application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the cultivation of high-fertility sheep strains.

[0010] The fourth technical solution of the present invention is a drug for improving sheep fertility, comprising a substance that promotes the expression of the circSATB1 gene.

[0011] The fifth technical solution of the present invention is a method for cultivating a high-fertility sheep breed, comprising a method for promoting the expression of the circSATB1 gene using a recombinant vector containing the circSATB1 gene, an expression cassette, a transgenic cell line or recombinant bacteria.

[0012] Based on the above technical solution, the present invention has the following technical effects:

[0013] This invention provides the first analysis of the circRNA expression profile of sheep seminal plasma extracellular vesicles. circSATB1 was found to be highly expressed in seminal plasma extracellular vesicles. Overexpression of circSATB1 significantly promoted the proliferation and migration of endometrial epithelial cells and significantly inhibited their apoptosis. Conversely, interference with circSATB1 significantly inhibited endometrial epithelial cell proliferation and migration and significantly promoted their apoptosis. These results demonstrate the important role of circSATB1 in endometrial receptivity formation and provide a new approach to improving embryo implantation rates in female animals. Attached Figure Description

[0014] Figure 1 In the figure, A represents the morphological characteristics of sheep seminal plasma extracellular vesicles under transmission electron microscopy; B represents the particle size of sheep seminal plasma extracellular vesicles; and C represents the expression of extracellular vesicle marker proteins (Alix, HSP70, TSG101, CD63) and endoplasmic reticulum cell marker protein (CANX) in sheep seminal plasma extracellular vesicles.

[0015] Figure 2 In the table, A represents the top ten circRNAs expressed in sheep seminal plasma extracellular vesicles; B represents the expression levels of different circRNAs in sheep seminal plasma extracellular vesicles as verified by RT-qPCR.

[0016] Figure 3 To identify the circular biological characteristics of sheep seminal plasma extracellular vesicle circRNAs using agarose gel electrophoresis and Sanger sequencing, the lanes from left to right represent the amplification results of testicular tissue cDNA and gDNA samples using divergent and convergent primers, respectively; Sanger sequencing identifies the reverse splicing sites of circRNAs.

[0017] Figure 4 This study identifies the circRNA-miRNA interaction network that may be regulated by the top ten most expressed circRNAs in sheep seminal plasma extracellular vesicles.

[0018] Figure 5 GO functional enrichment analysis of downstream mRNAs of circSATB1.

[0019] Figure 6 KEGG pathway enrichment analysis for downstream mRNA of circSATB1.

[0020] Figure 7 In the diagram, A represents the use of RT-qPCR to verify the tolerance of circSATB1 to RNase R; B represents the use of DiI dye to verify that endometrial epithelial cells can take up sheep seminal plasma extracellular vesicles; and C represents the use of RT-qPCR to verify that circSATB1 is transported from sheep seminal plasma extracellular vesicles into endometrial epithelial cells.

[0021] Figure 8 In the table, A shows the changes in the expression levels of circSATB1 and its host gene SATB1 in endometrial epithelial cells after overexpression of circSATB1, detected by RT-qPCR; B shows the effect of overexpression of circSATB1 on the proliferative activity of endometrial epithelial cells at different time points, detected by CCK-8 assay; C shows the effect of overexpression of circSATB1 on the number of proliferating endometrial epithelial cells, detected by Edu assay (scale bar: 50 μm); D shows the effect of overexpression of circSATB1 on the migration of endometrial epithelial cells, detected by scratch assay (scale bar: 200 μm); and E shows the effect of overexpression of circSATB1 on apoptosis of endometrial cells, detected by flow cytometry.

[0022] Figure 9 In the table, A shows the changes in the expression levels of circSATB1 and its host gene SATB1 in endometrial epithelial cells after circSATB1 interference, detected by RT-qPCR; B shows the effect of circSATB1 interference on the proliferation activity of endometrial epithelial cells at different time points, detected by CCK-8 assay; C shows the effect of circSATB1 interference on the number of proliferating endometrial epithelial cells, detected by Edu assay (scale bar: 50 μm); D shows the effect of circSATB1 interference on the migration of endometrial epithelial cells, detected by scratch assay (scale bar: 200 μm); and E shows the effect of circSATB1 interference on endometrial cell apoptosis, detected by flow cytometry. Detailed Implementation

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0026] This invention provides the application of circSATB1 in the preparation of a drug to improve sheep fertility. The nucleotide sequence of circSATB1 is shown in SEQ ID NO.1.

[0027] In some specific implementation schemes, overexpression of the circSATB1 gene promotes the proliferation and migration of sheep endometrial epithelial cells, inhibits endometrial epithelial cell apoptosis, and promotes the formation of endometrial receptivity.

[0028] In some specific implementations, the sheep is a sheep.

[0029] This invention also provides the application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the preparation of drugs to improve sheep fertility.

[0030] The present invention also provides the application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the cultivation of high-fertility sheep strains.

[0031] This invention also provides a drug for improving sheep fertility, including a substance that promotes the expression of the circSATB1 gene.

[0032] In some specific implementations, the substance that promotes circSATB1 gene expression includes a recombinant vector containing the circSATB1 gene, an expression cassette, a transgenic cell line, or a recombinant bacterium.

[0033] In some specific implementations, the substance that promotes circSATB1 gene expression includes the overexpression vector pCD5-circSATB1.

[0034] This invention also provides a method for cultivating a highly fertile sheep breed, including a method for promoting the expression of the circSATB1 gene using a recombinant vector containing the circSATB1 gene, an expression cassette, a transgenic cell line, or a recombinant bacterium.

[0035] Example 1

[0036] 1. Density gradient centrifugation for separation of extracellular vesicles from sheep seminal plasma

[0037] (1) Select three healthy rams of moderate size and with normal fertility. Collect semen using the artificial vagina method, place it in a 37℃ thermos, and bring it back to the laboratory within 30 minutes. Quickly examine sperm motility and density under a microscope. Motility should be ≥0.75 and density ≥10×10⁻⁶. 8 It can only be used when the volume is above / mL;

[0038] (2) Centrifuge the collected semen at 12,000×g for 20 min at room temperature, and then centrifuge at 12,000×g for 20 min at 4℃, and collect the precipitate and supernatant;

[0039] (3) The supernatant obtained in step (2) was passed through 0.45 μm and 0.22 μm cell filters in sequence, and centrifuged at 100,000 × g for 1 h at 4 °C. The supernatant was collected and the precipitated seminal plasma EVs were resuspended in DPBS.

[0040] (4) Centrifuge the EVs solution obtained in step (3) at 4°C at 100,000×g for 1 h, and resuspend the precipitated seminal plasma EVs in 1 mL of DPBS.

[0041] (5) Prepare 40%, 20%, 10% and 5% iodixanol solutions using a buffer solution containing 0.25M sucrose and 10mM Tris (pH 7.5), and add them sequentially into an ultrafiltration tube to prepare a buffer solution with a discontinuous density gradient (3 mL for each gradient).

[0042] (6) Add the EVs solution obtained in step (5) to the top layer of the discontinuous density gradient buffer and centrifuge at 103,000×g for 16 h at 4 °C. After centrifugation, remove the top 1 mL of elution buffer and divide the density gradient buffer into 12 equal volumes according to the corresponding concentration (3 portions for each concentration), and dilute them with DPBS respectively.

[0043] (7) Centrifuge the seminal plasma EVs solution obtained in step (6) at 4°C at 100,000×g for 2h, resuspend the precipitated seminal plasma EVs in DPBS, store at -80°C for subsequent experiments.

[0044] 2. Morphological characteristics of extracellular vesicles in sheep seminal plasma observed by transmission electron microscopy

[0045] 5 μL of the prepared EV plasma sample was added to a copper grid and allowed to stand at room temperature for 1 min to allow the EV plasma to settle. Excess liquid was then absorbed with filter paper, and the sample was washed twice with double-distilled water. The EV plasma was then negatively stained with 2% uranyl acetate for 1 min and allowed to air dry. Finally, the morphology of the EV plasma was observed using a transmission electron microscope (Talos 120 kV).

[0046] 3-nanometer particle tracking analysis of extracellular vesicle size in sheep seminal plasma

[0047] The EVs were diluted 50-fold with DPBS and the particle size was analyzed using a nanoparticle size and Zeta potential analyzer (Zetasizer NanoZS90). For each analysis, at least three independent replicate experiments were performed.

[0048] 4. Extraction of extracellular vesicles and sperm proteins from sheep seminal plasma

[0049] (1) Mix the protein lysis buffer (RIPA lysis buffer: PMSF = 99:1) with the seminal plasma EVs solution (or sperm) and incubate on ice at 120 rpm for 30 min.

[0050] (2) Centrifuge the lysed sample at 12,000×g for 4 min at 4℃ and collect the supernatant (protein) for subsequent experiments.

[0051] 5. Determination of protein concentration

[0052] (1) Prepare the BCA protein standard curve according to Table 1;

[0053] Table 1. Configuration of BCA protein standard curve

[0054]

[0055] (2) Mix BCA reagent and Cu reagent at a ratio of 1:50 (v:v) to prepare BCA working solution;

[0056] (3) Take 20 μL of LBCA standard and the sample to be tested into a 96-well plate, and add 200 μL of LBCA working solution to each well. Mix thoroughly and incubate at 37°C for 30 min.

[0057] (4) Detect the absorbance at 562 nm wavelength on the microplate reader, and plot the standard curve based on the absorbance of the BCA standard. Calculate the concentration of each sample to be tested for subsequent experiments.

[0058] 6. Western blot detection of extracellular vesicle marker proteins in sheep seminal plasma

[0059] (1) Install the mold for preparing the gel and fill the mold with pure water to check for leakage, ensuring that there is no leakage during the gel preparation process;

[0060] (2) Prepare the SDS-PAGE separating gel according to the table below;

[0061] Table 2 Preparation of SDS-PAGE separating gel

[0062]

[0063] (3) Drain the pure water in the mold, add the mixed separating gel liquid to a distance of 1.5cm from the top of the glass plate, and add anhydrous ethanol to cover the separating gel. Let it stand at room temperature for 20-30 minutes until the separating gel solidifies.

[0064] (4) Prepare SDS-PAGE stacking gel according to the table below;

[0065] Table 3 Preparation of SDS-PAGE stacking gel

[0066]

[0067] (5) Blot dry the anhydrous ethanol on the surface of the separating gel, add the mixed concentrated gel liquid to the top of the short glass plate, insert the comb for preparing the gel, and let it stand at room temperature for 20-30 minutes for subsequent experiments.

[0068] (6) Prepare the protein denaturation system according to the table below, mix well and incubate at 99°C for 10 min to denature the protein;

[0069] Table 4. Protein denaturation reaction conditions

[0070]

[0071]

[0072] (7) Weigh 18.8g glycine, 3g Tris and 1g sodium dodecyl sulfate and dissolve them in 1L deionized water. Stir and mix well to prepare an electrophoresis solution.

[0073] (8) Load the SDS-PAGE gel into the electrophoresis tank, pour in the electrophoresis buffer, and add the pre-stained protein marker and the denatured protein in sequence. The amount of marker loaded is 5 μL.

[0074] (9) After aligning the electrodes, perform electrophoresis at 200V for 5 minutes, then adjust the voltage to 120V and continue electrophoresis until the bromophenol blue reaches the bottom of the gel.

[0075] (10) Weigh 2.9g glycine and 5.8g Tris and dissolve them in 800mL deionized water. Stir and mix well. Add 200mL of anhydrous methanol pre-cooled at -20℃ 20min before the membrane transfer to prepare the membrane transfer solution.

[0076] (11) According to the size of the target band and the marker mark, cut it out of the gel, cut out a polyvinylidene difluoride (PVDF) membrane of the same size according to the size of the gel, and soak the membrane in anhydrous methanol for 10 min to activate it.

[0077] (12) Stack the gauze, 2 sheets of filter paper, glue, PVDF membrane, 2 sheets of filter paper and gauze in sequence from the negative electrode (black) to the positive electrode (white) of the small transfer sandwich clamp, avoiding the generation of air bubbles during the stacking process.

[0078] (13) Transfer the small transfer sandwich clamp into the transfer tank, pour in the transfer solution, and place ice cubes outside the transfer tank. Select the transfer time according to the strip size at 200mA.

[0079] (14) Dissolve TBS powder in 2L of deionized water and add 2mL of TWEEN 20. Stir well to prepare TBST.

[0080] (15) Wash the PVDF membrane after transfer in TBST 3 times for 5 min each time, then transfer the membrane into TBST solution containing 5% (v / v) skim milk powder and seal for 2 h;

[0081] (16) Wash the blocked membrane three times in TBST for 5 min each time, and then transfer the membrane into 5% (v / v) skim milk powder TBST solution containing the corresponding antibody and incubate overnight at 4°C.

[0082] (17) Wash the PVDF membrane after primary antibody incubation in TBST 3 times for 5 min each time, then transfer the membrane into 5% (v / v) skim milk powder TBST solution containing the corresponding secondary antibody and incubate at room temperature for 2 h.

[0083] (18) After the PVDF membrane was incubated with the secondary antibody, it was washed three times in TBST for 5 min each time, then incubated with ECL chemiluminescence solution, and the expression of the target protein was detected by a chemiluminescence imager.

[0084] result

[0085] Sheep seminal plasma EVs samples exhibited cup-shaped vesicles with a double-membrane structure. Figure 1 (A) with particle sizes concentrated in the range of 50–200 nm. Figure 1 In the middle B), the marker proteins Alix, HSP70, TSG101, and CD63 of EVs were positive, while the marker protein CANX of the endoplasmic reticulum was negative. Figure 1 (C). The above results indicate that the extracted sample is EVs, and has high purity with no cytoplasmic contamination.

[0086] Example 2

[0087] Analysis of the expression profile of extracellular vesicle circRNA in sheep seminal plasma

[0088] 1. Extraction of total RNA from extracellular vesicles of sheep seminal plasma

[0089] (1) Add 1 mL of TRIzol to the seminal plasma EVs solution and incubate at -80°C overnight;

[0090] (2) After thawing, mix EVs with TRIzol by vortexing and incubate at room temperature for 5 min to allow the nucleic acid-protein complex to be fully lysed;

[0091] (3) Add 200 μL of chloroform (pre-cooled at 4°C), vortex and shake to mix, and let stand on ice for 3 min;

[0092] (4) Centrifuge the solution obtained in step (3) at 12,000×g for 15 min at 4 °C. After centrifugation, the sample is divided into a colorless aqueous upper layer containing RNA, a white middle layer, and a red organic lower layer. Transfer the upper aqueous phase to a new centrifuge tube, add 500 μL of isopropanol (pre-cooled at 4 °C) and 1 μL of glycogen, mix by inverting, and incubate at -20 °C for 1 h;

[0093] (5) Centrifuge the solution obtained in step (4) at 4°C at 12,000×g for 10 min, discard the supernatant, add 1 mL of 75% (v / v) ethanol-DEPC water (pre-cooled at 4°C), and invert the solution to make the precipitate float.

[0094] (6) Centrifuge the solution obtained in step (5) at 4°C at 12,000×g for 5 min, discard the supernatant, and air dry on ice for 5 min;

[0095] (7) Add 20 μL of DEPC water to the precipitate to dissolve the RNA, measure the concentration with a spectrophotometer, and store at -80℃ for subsequent experiments.

[0096] 2. Library construction and sequencing data filtering

[0097] (1) The purity and integrity of RNA were detected using Nanodrop and Agilent 2200 Bioanalyzer, respectively. After passing the quality control, ribosomal RNA and linear RNA were removed using Ribo Zero rRNA Removal Kit and RNase R, respectively. The enriched RNA was reverse transcribed, end-repaired, ligated with sequencing adapters, and amplified by PCR to obtain a cDNA library. After library testing, the library was sequenced on the Illumina HiSeq platform, and the raw image data files were converted into sequence data (raw reads) through base recognition analysis.

[0098] (2) The raw reads obtained are first removed by removing adapter sequences and low-quality reads to obtain high-quality data (clean reads), and then the ribosomal RNA sequences are removed by comparing with the RNAcentral ribosome database to obtain effective reads.

[0099] 3. Alignment of sequencing data and calculation of circRNA expression levels

[0100] (1) Effective reads were aligned to the reference genome (GCF_016772045.2_ARS-UI_Ramb_v3.0) using bwa mem software, and the resulting sam file was then processed twice using CIRI2. First, junction reads were detected using interleaved alignment signals. Initial filtering was performed using paired-end alignment and GT-AG sequence features to obtain candidate circRNAs. Second, additional junction reads were detected again, and false positive candidate circRNAs were further filtered out.

[0101] (2) Effective reads were aligned to the reference genome (GCF_016772045.2_ARS-UI_Ramb_v3.0) using Tophat-Fusion software. Then, CIRCexplorer2 was used to filter out reads that Tophat could not map to, and these reads were then mapped to the genome using Tophat-Fusion. The non-linear candidate reads from these Tophat-Fusion alignments were then re-aligned to the genome, and combined with gene annotation files, more accurate junction sites were obtained.

[0102] (3) Take the intersection of the results from CIRI2 and CIRCexplorer2 software to obtain the final candidate circRNA;

[0103] (4) The expression value of circular RNA was measured by the junction reads at the circRNA linker position in the CIRCexplorer2 output results. The RPM value was used to correct the data. The formula for calculating RPM is as follows:

[0104]

[0105] Note: Junction reads and Total circRNAs reads are values ​​output by the CIRCexplorer2 software. All parts are outputs from the CIRCexplorer2 software.

[0106] 4. Validation of sequencing data

[0107] (1) Three rams that were not involved in sequencing, were in good health, of moderate size, and had normal fertility were randomly selected. Semen was collected using the artificial vagina method, seminal plasma EVs were separated, and RNA was extracted.

[0108] (2) Use a reverse transcription kit to remove gDNA from RNA. The system is shown in Table 5.

[0109] Table 5. GDNA Removal System

[0110]

[0111]

[0112] (3) Gently mix the above system by pipetting, incubate at 42°C for 2 min, and use a reverse transcription kit (TAKARA, RR047a) to reverse transcribe the RNA into cDNA. The system is shown in Table 6.

[0113] Table 6 Reverse Transcription System

[0114]

[0115] (4) Gently pipette the above system to mix well, incubate at 37°C for 15 min, heat at 85°C for 5 s, determine the concentration of the synthesized cDNA using a spectrophotometer, store at -20°C for subsequent experiments;

[0116] (5) Six circRNAs identified by sequencing were randomly selected, and divergent primers were designed based on the reverse splicing site (see Table 8). ACTB was used as an internal control (ACTB primers are shown in Table 9). RT-qPCR was performed using SYBR Green Master Mix reagent (RT-qPCR system is shown in Table 7, reaction procedure is shown in Table 10). A 2-phase flow rate was used. -ΔΔCt The relative expression levels of circRNAs were analyzed using a method.

[0117] Table 7 RT-qPCR System

[0118]

[0119] Table 8. Primers for circRNA divergence

[0120]

[0121]

[0122] Table 9 ACTB Primers

[0123]

[0124] Table 10 RT-qPCR Procedure

[0125]

[0126] Validation of 5-circRNA circular structure

[0127] (1) Extract sheep testis gDNA using a tissue gDNA extraction kit. Take 50 mg of testis tissue, grind it into powder in liquid nitrogen, add 200 μL of buffer GA and 4 μL of LNase A (100 mg / mL), vortex for 15 s, and let stand at room temperature for 5 min.

[0128] (2) Add 20 μL of Proteinase K solution, vortex, and incubate at 56 °C until the tissue is completely dissolved;

[0129] (3) Add 200 μL buffer GB, mix thoroughly by inverting, incubate at 70°C for 10 min, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0130] (4) Add 200 μL of anhydrous ethanol, vortex mix for 15 s, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0131] (5) Add the solution and flocculent precipitate obtained in step (4) into the adsorption column CB3 (place the adsorption column in the collection tube), centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0132] (6) Add 500 μL of buffer GD (pre-added with anhydrous ethanol) to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0133] (7) Add 600 μL of washing solution PW (pre-added with anhydrous ethanol) to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0134] (8) Repeat step (7);

[0135] (9) Centrifuge the adsorption column CB312,000rpm for 2min, discard the waste liquid, and let it stand at room temperature for 5min;

[0136] (10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle of the adsorption column membrane, let stand at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and store the gDNA solution obtained by elution at 4℃ for subsequent experiments.

[0137] (11) Take 50 mg of testicular tissue, grind it into powder in liquid nitrogen, add 1 mL of Trizol to extract RNA and reverse transcribe it into cDNA;

[0138] (12) Convergence primers were designed based on the sequences of 6 randomly selected circRNAs (Table 12), and PCR amplification of testicular cDNA / gDNA was performed using GloriaNovaHS2X Master Mix with Dye reagent (PCR amplification system is shown in Table 11, and amplification program is shown in Table 13).

[0139] Table 11 PCR System

[0140]

[0141] Table 12 circRNA convergence primers

[0142]

[0143]

[0144] Table 13 PCR Procedure

[0145]

[0146] (13) The amplified products were electrophoresed on 1% agarose gel at 120V for 30 min to verify the circular structure of circRNA. Products that passed the agarose gel electrophoresis test were sent to Sanger sequencing by Sangon Biotech (Shanghai) Co., Ltd. to detect the reverse splicing sites of circRNAs.

[0147] 6. circRNA-miRNA-mRNA interaction analysis

[0148] (1) For the top ten circRNAs expressed in sheep seminal plasma EVs, the recognition regions of circRNA-miRNA were predicted using three software programs: miRanda, RNAhybrid, and TargetScan. The results of the three software programs were intersected, and a circRNA-miRNA interaction network was constructed using Cytoscape.

[0149] (2) For circRNAs that may regulate the most miRNAs, the recognition regions of their downstream miRNA-mRNAs were predicted using three software programs: miRanda, RNAhybrid, and TargetScan. The results of the three software programs were taken as the intersection.

[0150] (3) Based on the miRNA-mRNA interaction network obtained in (2), use clusterprofiler to perform GO functional enrichment analysis and KEGG pathway enrichment analysis.

[0151] result

[0152] A total of 504 circRNAs were detected in sheep seminal plasma (EVs), among which circEEFSEC, circSATB1, circELF1, circSMARCA5, circKDM4C, circACOXL, circSSBP2, circRERE, circZNF532, and circLRIG1 were the top ten circRNAs in terms of expression. Figure 2 (A). To verify the reliability of the sequencing data, six circRNAs were randomly selected, and specific divergent primers were designed based on the backsplicing sites. RT-qPCR was used to verify the relative expression levels of these six circRNAs in seminal plasma EVs. Figure 2(See section B). To further confirm the circular structure of circRNAs, this invention designed convergent primers for six circRNAs as controls. Using testicular tissue cDNA and gDNA as templates, PCR amplification was performed using both divergent and convergent primers. The results showed that the divergent primers amplified the target fragments in the cDNA template, but no bands were observed in the gDNA template. Furthermore, Sanger sequencing revealed that all six circRNAs underwent reverse splicing, rather than genomic rearrangement. Figure 3 The above results prove that the sequencing data is accurate and reliable.

[0153] Among the top ten circRNAs expressed in sheep seminal plasma EVs, circSATB1 has the most potential downstream miRNAs (21). Figure 4 GO functional enrichment analysis showed that the circSATB1-regulated ceRNA network is involved in biological processes such as cell development, cell differentiation, cell localization, intracellular protein transport, and intracellular transport. Figure 5 KEGG pathway enrichment analysis showed that the circSATB1-regulated ceRNA network is involved in embryo implantation-related signaling pathways such as vascular endothelial growth factor (VEGF) signaling, oxytocin signaling, gonadotropin-releasing hormone signaling, hedgehog signaling, folic acid biosynthesis, ovarian steroid synthesis, and focal adhesion. Figure 6 The above results further reveal that circSATB1 may play an important regulatory role in the formation of endometrial receptivity in sheep.

[0154] The nucleotide sequence of the circSATB1 gene is shown in SEQ ID NO.1:

[0155]

[0156] The primer sequences for amplifying the circSATB1 gene are as follows:

[0157] SEQ ID NO.2: CGTGCTAAAGTTTCCCAAGCTC;

[0158] SEQ ID NO. 3: ATGTTCTTTCCCCTGAGTTGC.

[0159] Example 3

[0160] Overexpression of circSATB1 promotes the proliferation and migration of sheep endometrial epithelial cells and inhibits apoptosis of sheep endometrial epithelial cells.

[0161] 1. Detection of circSATB1 tolerance to RNase R enzyme

[0162] (1) RNA was extracted from sheep testicular tissue using the "verification of circRNA circular structure" method in Example 2;

[0163] (2) Mix sheep testicular RNA with RNAse R, incubate at 37°C for 20 min, and detect the changes in expression levels of circSATB1, SATB1, and ACTB by RT-qPCR after reverse transcription of the RNA digestion product.

[0164] Table 14 RNase R Reaction System

[0165]

[0166] Table 15 SATB1 primers

[0167]

[0168] 2. Detection of the ability of sheep endometrial epithelial cells to take up seminal plasma extracellular vesicles

[0169] (1) Sheep seminal plasma EVs were separated using the density gradient centrifugation method in Example 1. 50 μg of the prepared EVs sample was incubated with 20 μM DiI dye at room temperature in the dark for 15 min.

[0170] (2) Add an equal volume of 5% BSA to stop staining, dilute with DPBS, centrifuge at 120,000×g for 90 min at 4℃, resuspend the precipitated DiI-labeled sperm plasma EVs in DPBS, store at -80℃ for subsequent experiments.

[0171] (3) Endometrial epithelial cells were cultured in DMEM / F12 medium containing 12% fetal bovine serum, penicillin (100 U / mL), streptomycin (100 μg / mL), and 0.01% insulin;

[0172] (4) DiI-labeled seminal plasma EVs were incubated with endometrial epithelial cells for 0h, 2h, 4h, 6h and 12h respectively. After incubation, the culture medium was removed, the cells were washed three times with pre-cooled DPBS, and 4% paraformaldehyde was added to fix the cells at room temperature in the dark for 15min.

[0173] (5) Remove 4% paraformaldehyde, add pre-cooled DPBS, wash 3 times at 100 rpm for 4 min each time, then add 0.4% Tritonx-100 and incubate at room temperature in the dark for 15 min;

[0174] (6) Remove 0.4% Tritonx-100, add pre-cooled DPBS, wash 3 times at 100 rpm for 4 min each time, then add 200 nM FITC-phalloidin and incubate at room temperature in the dark for 30 min.

[0175] (7) Remove 200 nM of FITC-phalloidin, add pre-cooled DPBS, wash 3 times at 100 rpm for 4 min each time, then add Hoechst 33342 solution and incubate at room temperature in the dark for 10 min.

[0176] (8) Remove the Hoechst 33342 solution, add pre-cooled DPBS, wash twice at 100 rpm for 4 min each time, and then observe and acquire images using a fluorescence inverted microscope.

[0177] 3. Effect of sheep seminal plasma extracellular vesicles on circSATB1 expression in endometrial epithelial cells

[0178] (1) Sheep seminal plasma EVs were separated using the density gradient centrifugation method in Example 1. 80 μg of seminal plasma EVs were added to a 6-well plate of normally cultured endometrial epithelial cells.

[0179] (2) After co-incubation for 48 hours, the culture medium was removed, and the cells were washed three times with pre-cooled DPBS. 1 mL of Trizol was added to each well, and RNA was extracted from sheep endometrial epithelial cells using the "verification of sequencing data" method in Example 2 to detect changes in circSATB1 expression.

[0180] 4. Construction of an endometrial epithelial cell model overexpressing circSATB1

[0181] (1) When the cells in the 6-well plate have grown to 70-80%, use Lipofectamine.TM 3000 transfections, the transfection system is shown in Table 16;

[0182] Table 16 Overexpression Transfection System

[0183]

[0184] (2) After mixing the transfection system, let it stand at room temperature for 15 minutes, then add 250 μL of the mixture to each well of a 6-well plate containing normal cultured endometrial epithelial cells. Change the medium after 10 hours of transfection.

[0185] (3) 48 h after transfection, the culture medium was removed, the cells were washed three times with pre-cooled DPBS, 1 mL of Trizol was added to each well, and RNA was extracted from sheep endometrial epithelial cells using the “validation of sequencing data” method in Example 2 to detect changes in the expression levels of circSATB1 and SATB1.

[0186] 5. Cell proliferation detection

[0187] (1) Collect cells in the logarithmic growth phase, adjust the concentration of cell suspension, add 100 μL to each well of a 96-well plate to adjust the cell density to 10,000 cells / well, and transfect after 24 h of culture;

[0188] (2) After 12h, 24h, 48h and 72h of transfection, the culture medium was removed and 100μL of culture medium containing 10% CCK-8 solution was added to each well. After culturing for another 1h, the OD value of sheep endometrial epithelial cells at a wavelength of 450nm was detected.

[0189] (3) 48 h after transfection, remove the culture medium, add culture medium containing 10 μM Edu, and continue culturing for 2 h;

[0190] (4) After Edu labeling of cells, remove the culture medium, wash the cells three times with pre-cooled DPBS, and fix them at room temperature in the dark for 15 min with 4% paraformaldehyde.

[0191] (5) Remove 4% paraformaldehyde, add pre-cooled DPBS, wash 3 times at 100 rpm for 4 min each time, then add 0.4% Tritonx-100 and incubate at room temperature in the dark for 15 min;

[0192] (6) Remove 0.4% Tritonx-100, add pre-cooled DPBS, wash 3 times at 100 rpm for 4 min each time, then add Click reaction solution and incubate at room temperature in the dark for 30 min. The Click reaction solution system is shown in Table 17.

[0193] Table 17 Click Reaction Solution System

[0194]

[0195] (7) Remove the Click reaction solution, add pre-cooled DPBS, wash 3 times at 100 rpm for 4 min each time, then add Hoechst 33342 solution and incubate at room temperature in the dark for 10 min.

[0196] (8) Remove the Hoechst 33342 solution, add pre-cooled DPBS, wash twice at 100 rpm for 4 min each time, and then observe and acquire images using a fluorescence inverted microscope.

[0197] 6. Cell migration detection

[0198] (1) Draw straight lines at the bottom of the 6-well plate with a marker to divide the wells into multiple regions, with each line 1 cm apart. Then, evenly seed the cells onto the plate and wait until the cells reach 70-80% confluence before using Lipofectamine. TM 3000 transfections;

[0199] (2) 48 h after transfection, use a 200 μL sterile pipette tip to make a steady scratch on the surface of the monolayer cells. Rinse the cells three times with DPBS containing penicillin (100 U / mL) and streptomycin (100 μg / mL) to remove floating cell clumps.

[0200] (3) Add DMEM / F12 medium containing 0.5% FBS, take pictures under an inverted microscope to record the original scratches, and mark 0h;

[0201] (4) After culturing for another 12 hours, take a picture in the same field of view and mark it after 12 hours;

[0202] (5) Use ImageJ software to calculate the cell migration rate of each group.

[0203] 7. Apoptosis detection

[0204] (1) When the cells in the 12-well plate have grown to 70-80%, use Lipofectamine. TM 3000 transfections;

[0205] (2) 48 h after transfection, the culture medium was collected, and the cells were washed with DPBS containing penicillin (100 U / mL) and streptomycin (100 μg / mL) and the DPBS was collected.

[0206] (3) Digest the cells with trypsin for 2 min, add the collected culture medium to stop the digestion, collect the cells in a 2 mL centrifuge tube, and centrifuge at 500×g for 5 min.

[0207] (4) Discard the supernatant, wash twice with pre-cooled DPBS, and resuspend the precipitated cells in 100 μL of Binding Buffer.

[0208] (5) Add 5 μL Annexin V-EGFP to each tube of cells, mix well by pipetting, and incubate at room temperature in the dark for 5 min.

[0209] (6) Add 10 μL of Propidium Iodide and 400 μL of DPBS to each tube of cells, mix well by pipetting, and collect 30,000 cells by flow cytometry to detect apoptosis.

[0210] result

[0211] Compared to SATB1, which is digested by RNase R, circSATB1 is resistant to RNase R digestion. Figure 7 (A) indicates that circSATB1 is resistant to RNase R digestion, further confirming that circSATB1 possesses circRNA characteristics. Co-incubation of DiI-labeled sheep seminal plasma EVs with endometrial epithelial cells showed that, compared to the 0h control, red fluorescence appeared in the endometrial epithelial cells after 2h, 4h, 6h, and 12h of incubation, and the amount of red fluorescence increased with prolonged incubation time. Figure 7 (B). RT-qPCR results showed that co-incubation with sheep seminal plasma (EVs) significantly increased the expression level of circSATB1 in endometrial epithelial cells. Figure 7 (C). The above results indicate that circSATB1 is transported into endometrial epithelial cells by sheep seminal plasma (EVs). Furthermore, RT-qPCR results showed that transfection with the overexpression vector pCD5-circSATB1 significantly increased the expression level of circSATB1 in endometrial epithelial cells, while the expression level of the corresponding host gene STBA1 showed no significant change. Figure 8 (A) This demonstrates that a model of endometrial epithelial cells overexpressing circSATB1 has been successfully constructed.

[0212] Morphological changes during endometrial receptivity formation depend on the proliferation of endometrial epithelial cells. CCK-8 results showed that endometrial epithelial cell viability was significantly increased at 48h and 72h after circSATB1 overexpression. Figure 8 (B); In addition, Edu results showed that overexpression of circSATB1 significantly increased the number of endometrial epithelial cells. Figure 8 (C). All the above results indicate that circSATB1 can promote the proliferation of endometrial epithelial cells.

[0213] Before endometrial receptivity develops, endometrial epithelial cells migrate to the embryo implantation site, providing a foundation for successful implantation. Cell scratch assays showed that overexpression of circSATB1 significantly increased the migration ability of endometrial epithelial cells. Figure 8 The results (D) indicate that circSATB1 can promote the migration of endometrial epithelial cells.

[0214] The formation of endometrial receptivity also involves apoptosis of endometrial epithelial cells. Apoptosis is beneficial for endometrial remodeling, but excessive apoptosis can negatively impact embryo implantation and development. Flow cytometry results showed that overexpression of circSATB1 significantly reduced the apoptosis rate of endometrial epithelial cells. Figure 8 The results (E) indicate that circSATB1 can inhibit apoptosis of endometrial epithelial cells. These results reveal that circSATB1 promotes endometrial receptivity.

[0215] Example 4

[0216] Interference with circSATB1 inhibits the proliferation and migration of sheep endometrial epithelial cells and promotes apoptosis of sheep endometrial epithelial cells.

[0217] 1. Construction of a circSATB1 endometrial epithelial cell model

[0218] (1) When the cells in the 6-well plate have grown to 70-80%, use Lipofectamine. TM 3000 transfections were performed; the transfection system is shown in Table 18.

[0219] Table 18 Interference Transfection System

[0220]

[0221] (2) After mixing the transfection system, let it stand at room temperature for 15 minutes, then add 250 μL of the mixture to each well of a 6-well plate containing normal cultured endometrial epithelial cells. Change the medium after 10 hours of transfection.

[0222] (3) 48 h after transfection, the culture medium was removed, the cells were washed three times with pre-cooled DPBS, 1 mL of Trizol was added to each well, and RNA was extracted from sheep endometrial epithelial cells using the “validation of sequencing data” method in Example 2 to detect changes in the expression levels of circSATB1 and SATB1.

[0223] 2. Cell proliferation detection

[0224] The effect of interfering with circSATB1 on the proliferation of endometrial epithelial cells was detected using the "cell proliferation detection" method in Example 3.

[0225] 3. Cell migration detection

[0226] The effect of interfering with circSATB1 on the migration of endometrial epithelial cells was detected using the "cell migration detection" method in Example 3.

[0227] 4. Apoptosis detection

[0228] The effect of interfering with circSATB1 on apoptosis of endometrial epithelial cells was detected using the "apoptosis detection" method in Example 3.

[0229] result

[0230] RT-qPCR results showed that transfection with circSATB1 siRNA significantly decreased the expression level of circSATB1 in endometrial epithelial cells, while the expression level of the corresponding host gene STBA1 did not change significantly. Figure 9 (A) This study demonstrates that a model of interfering with circSATB1 endometrial epithelial cells has been successfully constructed.

[0231] CCK-8 results showed that the viability of endometrial epithelial cells was significantly decreased at 48h and 72h after circSATB1 interference. Figure 9 (B); In addition, Edu results showed that after interfering with circSATB1, the number of endometrial epithelial cells decreased significantly (B); Figure 9 (C). All the above results indicate that interfering with circSATB1 inhibits the proliferation of endometrial epithelial cells.

[0232] Cell scratch assay results showed that interference with circSATB1 significantly reduced the migration ability of endometrial epithelial cells. Figure 9 The results (D) indicate that interference with circSATB1 inhibits the migration of endometrial epithelial cells.

[0233] Flow cytometry results showed that after interfering with circSATB1, the apoptosis rate of endometrial epithelial cells increased significantly. Figure 9 The results (E) indicate that interference with circSATB1 promotes apoptosis of endometrial epithelial cells. These results further confirm that circSATB1 promotes endometrial receptivity.

[0234] The above examples demonstrate that circSATB1 is highly expressed in sheep EVs and is carried by seminal plasma EVs into endometrial epithelial cells. It promotes endometrial cell proliferation and migration, inhibits endometrial epithelial cell apoptosis, and promotes endometrial receptivity. This invention provides the important promoting role of circSATB1 in the formation of sheep endometrial receptivity and its application prospects in improving sheep embryo implantation rates. Furthermore, circSATB1 is also a promising biomarker for assessing ram fertility, offering a new approach to improving sheep reproductive rates.

[0235] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of a substance overexpressing the circSATB1 gene in the preparation of a drug to improve sheep fertility, characterized in that, The nucleotide sequence of circSATB1 is shown in SEQ ID NO.

1. Overexpression of the circSATB1 gene promotes the proliferation and migration of sheep endometrial epithelial cells, inhibits endometrial epithelial cell apoptosis, and promotes the formation of endometrial receptivity.

2. Application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the preparation of drugs to improve sheep fertility.

3. Application of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the circSATB1 gene in the cultivation of high-fertility sheep breeds.

4. A method for breeding high-fertility sheep breeds, characterized in that, Methods for promoting circSATB1 gene expression using recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria containing the circSATB1 gene; the nucleotide sequence of circSATB1 is shown in SEQ ID NO.1.