Preparation method of holo-RBP4 and application of holo-RBP4 in preparation of medicine for treating familial vitreous amyloidosis

Abstract

The invention discloses a preparation method of holo-RBP4 and application of the holo-RBP4 in preparation of a medicine for treating familial vitreous amyloidosis in the technical field of biological medicine. According to the application, the model mouse is subjected to intravitreal injection of the holo-RBP4, and the pathogenic target cells are subjected to precise treatment. Compared with a control group mouse, the model mouse treated by the method has the advantages that TTR expression of RPE cells is obviously reduced, and the development of HVA can be effectively inhibited.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a preparation method of holo-RBP4 and its application in the preparation of drugs for treating familial vitreous amyloidosis. Background Art

[0002] Hereditary Vitreous Amyloidosis (HVA) is a genetic disease caused by gene mutations that lead to protein conformational changes and abnormal aggregation in the vitreous cavity. It is a special type of Transthyretin Related Familial Amyloid Polyneuropathy (TTR-FAP). This disease is an autosomal dominant genetic disease, and its onset is related to mutations in the transthyretin (TTR) gene. TTR-FAP is an irreversible neurological disease that is highly disabling and life-threatening. From 1994 to 2019, 86 TTR-FAP families were reported in China. TTR-FAP is highly prevalent in China, and its main clinical features are peripheral axonal polyneuropathy, accompanied by autonomic dysfunction (84.6%), organ tissue involvement, including cardiomyopathy (35.2%), vitreous opacity (25.3%), renal failure (5.6%) and meningeal involvement (2.5%). The TTR Gly83Arg mutation is more common in the pathogenic genes of HVA, which is a unique and most common mutation type in China. All patients have eye involvement, mainly vitreous amyloidosis. It is speculated that in TTR-FAP, abnormal secretion of different TTR variants by choroid plexus epithelial cells and retinal pigment epithelium (RPE) cells, after transporting thyroxine (T4) and retinol (ROL) to target cells respectively, the structurally unstable TTR variants may partially depolymerize and deposit abnormally, leading to the disease.

[0003] Currently, vitrectomy is the main treatment method for this disease. Although vitrectomy can improve the patient's vision in the short term, a considerable proportion of patients will face the problem of recurrence of amyloidosis 2 to 4 years after the operation. Liver transplantation was the earliest systemic treatment regimen used for TTR-FAP, but its therapeutic effect on late-onset cases, patients with central nervous system involvement and eye involvement is not ideal. The antisense oligonucleotide drug Inotersen, the RNA interference agent Patisiran, the TTR stabilizer Tafamidis and the non-steroidal anti-inflammatory drug Diflunisal respectively have problems such as lack of selectivity of expression inhibition, toxic side effects and safety. Therefore, the above treatment regimens cannot effectively treat vitreous amyloidosis. Summary of the Invention

[0004] The present invention aims to provide the application of holo-RBP4 in the preparation of drugs for treating familial vitreous amyloidosis. By inhibiting the expression of TTR in RPE cells with holo-RBP4, the development of HVA can be effectively inhibited.

[0005] By intravitreal injection of holo-RBP4 into model mice, precise treatment of pathogenic target cells can be achieved. After treatment with this method, compared with the control group of mice, the expression of TTR in RPE cells of the model mice decreased significantly, and the development of HVA can be effectively inhibited. Therefore, this application claims the protection of the application of holo-RBP4 in the preparation of drugs for treating familial vitreous amyloidosis.

[0006] In this application, holo-RBP4 is retinol-binding protein 4 loaded with retinol.

[0007] The preparation method of the holo-RBP4 includes the following steps:

[0008] Step 1: Use pET15b as the vector plasmid, insert the optimized cDNA sequence of human RBP4 protein "GAGCGCGACTGCAGGGTTTCCAGCTTCCGCGTGAAGGAGAATTTCGACAAAGCCCGGTTTAGCGGCACCTGGTACGC CATGGCTAAGAAAGACCCCGAAGGACTGTTTCTGCAGGACAATATCGTGGCCGAGTTTTCCGTGGACGAGACCGGCCAGATGTCCGCAACCGCCAAGGGCAGGGTGAGGCTGCTGAATAATTGGGACGTGTGTGCCGATATGGTGGGCACATTTACCGACACCGAGGATCCAGCCAAATTCAAGATGAAGTACTGGGGGGTGGCCAGCTTCCTGCAGAAGGGCAACGATGACCACTGGATCGTGGATACCGATTATGACACATACGCTGTGCAGTACAGCTGTAGGCTGCTGAACCTGGACGGCACTTGTGCCGACAGCTACTCTTTCGTGTTCAGTCGCGACCCTAACGGCCTGCCCCCCGAGGCCCAGAAGATCGTGAGGCAGAGGCAGGAGGAGCTGTGCCTGGCTAGGCAGTACCGCCTGATCGTGCACAACGGCTACTGCGACGGCAGATCCGAACGCAATCTGCTGTGA" after the promoter, and add 6×His at its N-terminus as a purification tag;

[0009] Step 2: Amplify the above plasmid, and then extract the plasmid;

[0010] Step 3: Transform the plasmid extracted in Step 2 into a host bacterium containing the T7 RNA polymerase gene, inoculate and culture, pick monoclonal colonies, and shake the bacteria; when the OD600 value reaches 0.5 - 0.7, perform IPTG induction, then carry out protein expression. After 4 hours of protein expression, collect the bacterial liquid and centrifuge, then resuspend the bacterial cells and centrifuge again;

[0011] Step 4: Resuspend the bacterial cells with a lysis buffer containing 8M urea, add protease inhibitors, and perform ultrasonic disruption in an ice-water bath, then centrifuge at 4°C at 10000 - 12000g for 20 - 30 minutes, and take the supernatant;

[0012] Step 5: The supernatant passes through a nickel column. After the protein binds to the column, the column is washed to remove impurities, and then eluted and purified. The purity of the purified TTR protein is greater than 95%. The protein concentration is detected at 280 nm by ultraviolet absorption. An equimolar ratio of retinol is added, and the mixture is shaken at 2-8 °C in the dark for 10-15 h to obtain holo-RBP4.

[0013] Further, in Step 2, the plasmid is transformed into competent cells VB UltraStable for amplification.

[0014] Further, in Step 3, the inoculation and culture process is to plate on an LB plate containing the corresponding antibiotic and culture at 37 °C for 8-12 hours.

[0015] Further, in Step 3, when shaking the bacteria, shake the bacteria in an LB medium containing antibiotics at 37 °C and 200 rpm.

[0016] Further, in Step 3, the centrifugation conditions are: centrifuge at 4000-5000 g for 10-20 minutes.

[0017] Further, in Step 3, resuspend the bacterial cells with PBS.

[0018] Further, in Step 4, the conditions for ultrasonic disruption are: ultrasonic energy 200-300 W, working for 2 s and then pausing for 2 s, with a total duration of 15-30 minutes.

[0019] Further, in Step 5, wash the impurities with 20 mM imidazole containing 8 M urea, and elute with 250 mM imidazole containing 8 M urea; use a dialysis bag with a molecular weight cut-off of 2000 Da for dialysis purification.

[0020] Further, in Step 5, after the shaking treatment, filter and sterilize using a filter membrane with a diameter of 0.22 μm. Description of the Drawings

[0021] Figure 1 It is that holo-RBP4 causes a decrease in the transcriptional level of TTR.

[0022] Figure 2 It is that holo-RBP4 causes a decrease in the protein expression of TTR. Detailed Description of the Specific Embodiments

[0023] The following is a further detailed description through specific embodiments:

[0024] 1. Preparation of holo-RBP4

[0025] The cDNA sequence of human RBP4 protein was intercepted from the NCBI database, and the cDNA sequence of human RBP4 protein was optimized according to the codon preference of Escherichia coli. Using pET15b as the vector plasmid, the optimized cDNA sequence of human RBP4 protein was inserted behind the promoter.

[0026] "GAGCGCGACTGCAGGGTTTCCAGCTTCCGCGTGAAGGAGAATTTCGACAAAGCCCGGTTTAGCGGCACCTGGTACGC CATGGCTAAGAAAGACCCCGAAGGACTGTTTCTGCAGGACAATATCGTGGCCGAGTTTTCCGTGGACGAGACCGGCCAGATGTCCGCAACCGCCAAGGGCAGGGTGAGGCTGCTGAATAATTGGGACGTGTGTGCCGATATGGTGGGCACATTTACCGACACCGAGGATCCAGCCAAATTCAAGATGAAGTACTGGGGGGTGGCCAGCTTCCTGCAGAAGGGCAACGATGACCACTGGATCGTGGATACCGATTATGACACATACGCTGTGCAGTACAGCTGTAGGCTGCTGAACCTGGACGGCACTTGTGCCGACAGCTACTCTTTCGTGTTCAGTCGCGACCCTAACGGCCTGCCCCCCGAGGCCCAGAAGATCGTGAGGCAGAGGCAGGAGGAGCTGTGCCTGGCTAGGCAGTACCGCCTGATCGTGCACAACGGCTACTGCGACGGCAGATCCGAACGCAATCTGCTGTGA" And 6×His was added at its N-terminus as a purification tag.

[0027] The above plasmid was transformed into competent cell VB UltraStable for amplification, and then the plasmid was extracted. Subsequently, the plasmid was transformed into competent cell BL21(DE3) by heat shock method, plated on LB plates containing the corresponding antibiotics, and single colonies were picked after culturing at 37 °C for 12 hours. The colonies were cultured in LB medium containing antibiotics with the conditions of 37 °C and 200 rpm. When the OD600 value reached about 0.6, IPTG induction was carried out, followed by protein expression. After 4 hours of expression, the bacterial liquid was collected and centrifuged at 4000 g for 10 minutes. The cells were resuspended with PBS and centrifuged again. The cells were resuspended with lysis buffer (containing 8 M urea), protease inhibitor was added, and then ultrasonic disruption was performed in an ice-water bath. The ultrasonic energy was 200 W, working for 2 s and interval for 2 s, with a total duration of 15 minutes. Then, centrifugation was carried out at 4 °C at 10000 g for 20 minutes. The supernatant was passed through a nickel column. After binding to the column, the impurity proteins were washed with 20 mM imidazole (containing 8 M urea), and finally eluted with 250 mM imidazole (containing 8 M urea). The eluate was dialyzed using a dialysis bag with a molecular weight cut-off of 2000 Da. Each time, the dialysis solution was 100 times the sample volume. Dialysis was performed 3 times to remove imidazole, and at the same time, the urea concentration in the dialysis solution was gradually decreased (gradient: 6 M, 4 M, 2 M, 0 M). The purity of the purified protein was determined by SDS-PAGE gel electrophoresis, and it was required to be greater than 95%. The protein concentration was detected at 280 nm by ultraviolet. Retinol with an equimolar ratio was added, and holo-RBP4 was obtained by vigorous shaking overnight in the dark at 4 °C. Finally, filtration sterilization was carried out using a filter membrane with a diameter of 0.22 μm.

[0028] 2. Animal experiments

[0029] The TTR Gly83Arg model mice were randomly divided into two groups: experimental group and control group, with a male-female ratio of 1:1. All mice were fed with regular nutrition in an SPF-level environment. At 5 months of age, the two groups were respectively injected with holo-RBP4 and normal saline into the vitreous cavity. At 6 months of age, the eyeballs of all mice were removed. Under a dissecting microscope, the corneal edge was cut with an iris scissors, and the cornea, iris, lens, vitreous body and retina were removed. The pigment epithelium was scraped with micro forceps. The PBS containing the pigment epithelium was collected, centrifuged at 12000 g for 5 minutes, and the supernatant was discarded. Then 50 μl of PBS was added. Total RNA was extracted from one sample by TRIzol method, and then reverse transcribed into cDNA using a kit. Finally, SYBR Green dye, TTR and internal reference gene primers and cDNA were mixed in proportion, and amplified and data were read on a fluorescence quantitative PCR instrument. The results showed that the transcriptional level of the TTR gene in RPE cells of the mice in the group injected with holo-RBP4 into the vitreous cavity was significantly lower than that of the control group ( Figure 1)。Total protein was extracted using the RIPA method. After the protein was mixed with the loading buffer, it was boiled for 5 - 10 minutes, and then electrophoresed at 80V and 120V for 30 and 60 minutes respectively in 12.5% SDS-PAGE. Then, the protein was transferred to the PVDF membrane by transferring at 280mA for 90 minutes. Then, the primary antibody was incubated overnight at 4°C, and the secondary antibody was incubated at room temperature for 2 hours. Finally, the film was developed and the bands were analyzed. The expression of TTR protein in RPE cells was analyzed. The results showed that the expression of TTR protein in RPE cells of mice in the vitreous cavity injection of holo-RBP4 group was significantly decreased( Figure 2 ), indicating that this method has the potential to treat familial vitreous amyloidosis.

[0030] The above are only examples of the present invention. Common knowledge such as specific structures and characteristics known in the art are not described in detail herein. It should be pointed out that for those skilled in the art, without departing from the structure of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicality of the patent. The protection scope required by this application should be based on the content of its claims, and the specific implementation manners described in the specification can be used to interpret the content of the claims.

Claims

1. Application of holo-RBP4 in the preparation of drugs for the treatment of familial vitreous amyloidosis.

2. The method for preparing holo-RBP4 according to claim 1, characterized in that: The following steps are involved: Step 1: Use pET15b as the vector plasmid, insert the optimized human RBP4 protein cDNA sequence "" after the promoter, and add 6×His at its N-terminus as a purification tag; Step 2, amplifying the above plasmid and then extracting the plasmid; Step 3: Transform the plasmid extracted in step 2 into a host bacterium containing the T7 RNA polymerase gene, pick a single clone after inoculation and culture, and shake the bacteria; when the OD600 value reaches 0.5-0.7, IPTG induction is performed, and then protein expression is performed. After 4 hours of protein expression, the bacterial solution is collected and centrifuged, and then the bacteria are resuspended and centrifuged again; Step 4: Resuspend the cells in a lysis buffer containing 8 M urea, add protease inhibitors, and then perform ultrasonic disruption in an ice-water bath. Then, centrifuge at 10,000 to 12,000 g for 20 to 30 minutes at 4°C, and collect the supernatant. Step 5: The supernatant is passed through a nickel column, the impurities are washed off after hanging on the column, and then eluted and purified. The purity of the purified TTR protein is greater than 95%. The protein concentration is detected by ultraviolet 280nm, and an equimolar ratio of retinol is added. The mixture is shaken at 2-8°C in a dark environment for 10-15 hours to obtain holo-RBP4.

3. The method for preparing holo-RBP4 according to claim 2, characterized in that: In step 2, the plasmid is transformed into competent cells VB UltraStable for amplification.

4. The method for preparing holo-RBP4 according to claim 3, characterized in that: In step 3, the inoculation and culturing process is to plate the culture on an LB plate containing the corresponding antibiotics and culture at 37° C. for 8 to 12 hours.

5. The method for preparing holo-RBP4 according to claim 4, characterized in that: In step 3, the shaking is performed in LB medium containing antibiotics at 37° C. and 200 rpm.

6. The method for preparing holo-RBP4 according to claim 5, characterized in that: In step 3, the centrifugation conditions are: 4000-5000 g for 10-20 minutes.

7. The method for preparing holo-RBP4 according to claim 6, characterized in that: In step 3, resuspend the cells in PBS.

8. The method for preparing holo-RBP4 according to claim 7, characterized in that: In step 4, the conditions for ultrasonic fragmentation are: ultrasonic energy 200-300 W, working 2 seconds, interval 2 seconds, total duration 15-30 minutes.

9. The method for preparing holo-RBP4 according to claim 8, characterized in that: In step 5, 20 mM imidazole containing 8 M urea is used to wash the impurities, and 250 mM imidazole containing 8 M urea is used for elution; and a dialysis bag with a molecular weight cutoff of 2000 Da is used for dialysis purification.

10. The method for preparing holo-RBP4 according to claim 9, characterized in that: In step 5, after the shaking treatment, the solution is filtered and sterilized using a filter membrane with a diameter of 0.22 μm.

Images