A polypeptide targeting npat protein and its application in inhibiting proliferation of tumor cells

CN120040557BActive Publication Date: 2026-09-11LIANGZHU LAB
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510048072.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-10
Publication Date
2026-09-11
Estimated Expiration
2045-01-10

AI Technical Summary

Benefits of technology

[0024] The polypeptide provided in this invention was discovered during research on the regulatory mechanism of histone matrix formation, a non-membrane organelle within the cell nucleus. Overexpression of this polypeptide in cells effectively inhibits intracellular NPAT aggregation, thereby suppressing histone matrix formation and downregulating histone gene expression. CCK8 assays and clonogenic assays showed that this polypeptide significantly inhibits tumor cell proliferation. The polypeptide of this invention is the amino acid sequence from the N-terminus 1-50 of the NPAT protein, effectively interfering with the normal function of NPAT in regulating histone transcription and hindering the normal progression of the cell cycle. It has promising applications in the pharmaceutical field and can provide new design ideas for developing drugs that inhibit abnormal tumor cell proliferation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120040557B_ABST
    Figure CN120040557B_ABST
Patent Text Reader

Abstract

This invention discloses a polypeptide targeting the NPAT protein and its application in inhibiting tumor cell proliferation, belonging to the field of biomedical technology. The polypeptide provided by this invention was discovered during research on the regulatory mechanism of histone matrix formation, a non-membrane organelle in the cell nucleus. Overexpression of this polypeptide in cells effectively inhibits intracellular NPAT aggregation, thereby inhibiting histone matrix formation and downregulating histone gene expression. Using CCK8 assays and clonogenic assays, it was observed that this polypeptide has a significant inhibitory effect on tumor cell proliferation. The polypeptide of this invention is the amino acid sequence of NPAT protein N-terminus 1-50, which can effectively interfere with the normal function of NPAT in regulating histone transcription and hinder the normal progression of the cell cycle. It has promising applications in the pharmaceutical field and can provide new design ideas for developing drugs to inhibit abnormal tumor cell proliferation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a polypeptide that targets NPAT protein and its application in inhibiting tumor cell proliferation. Background Technology

[0002] Membraneless organelles within cells, such as stress granules, P-body structures, and nucleoli, provide the structural basis for cells to rapidly respond to environmental changes. The aggregation / phase separation of biomolecules, on the other hand, is the mechanism by which membraneless organelles are assembled, and it has become a hot topic in biological research in recent years.

[0003] In cell biology, "phase separation" refers to the process by which biomolecules such as proteins and RNA form dynamic, non-membrane-bound, droplet-like structures within cells through multivalent interactions such as electrostatic and hydrophobic interactions. Cells respond to external stimuli or internal signal changes by rapidly forming or disassembling these non-membrane organelles, thereby regulating intracellular biochemical reactions and signal transduction. Abnormal phase separation of the biomolecules that determine the formation of non-membrane organelles can lead to corresponding pathological changes. Neurodegenerative diseases such as Alzheimer's and Parkinson's are caused by abnormal phase separation of nerve cells. Therefore, research into the mechanisms of important protein phase separation holds promise for providing new ideas and methods for the diagnosis and treatment of these major diseases.

[0004] Normal cell cycle function depends on DNA replication and histone synthesis. Both require precise regulation to ensure normal cell proliferation. Histone transcription is regulated by a membraneless organelle in the cell nucleus called the Histone Locus Body (HLB), and its formation and maintenance are crucial for the normal transcription of histone genes. NPAT (Nuclear Protein mapped to the AT locus) is a key protein regulating histone transcription. Our research found that NPAT forms condensates in the nucleus through phase separation via self-interaction, driving the formation of the histone locus and initiating histone transcription. Abnormal NPAT phase separation affects histone locus formation, leading to cell cycle disruption due to abnormal histone transcription. Therefore, NPAT condensation / phase separation often represents a novel target for developing therapies for cancers such as breast cancer and lymphoma.

[0005] In the prior art, for example, patent application CN1 18373895A discloses a peptide targeting NPAT protein phase separation and its application, relating to the field of biomedical technology. The peptide provided by this invention was discovered during research on the mechanism by which NPAT protein regulates histone matrix formation; it is a truncated version of nuclear import protein α4. Transfection of this peptide into cells effectively inhibits histone matrix formation and downregulates histone gene expression. MTT and clonogenic assays show that the peptide of this invention has a significant inhibitory effect on tumor cell proliferation. Furthermore, the peptide of this invention has a maximum sequence length of only 49 amino acid residues, a small molecular weight, and high permeability, showing promising application potential in the pharmaceutical field and providing design ideas for drug development to inhibit the growth of highly proliferating tumor cells. Summary of the Invention

[0006] The purpose of this invention is to provide a polypeptide that targets NPAT protein aggregation / phase separation. This polypeptide is the amino acid sequence from the N-terminus 1-50 of the NPAT protein, capable of interfering with NPAT self-interaction and inhibiting its phase separation. Through this mechanism, the polypeptide interferes with the formation of histone matrix, downregulates the transcriptional level of histone genes, and ultimately inhibits the proliferation of tumor cells.

[0007] The applicant's research revealed that NPAT proteins form aggregates through self-interaction. This means that disrupting NPAT self-interaction will inhibit aggregate formation. This invention is the first to discover that the amino acid sequence from the N-terminus 1-90 of NPAT contains LisH and SIF domains, which are key sequences mediating NPAT self-interaction. Based on this key sequence, we designed a 50-amino acid polypeptide. This polypeptide competes with endogenous NPAT in cells, thereby interfering with NPAT protein self-interaction, preventing it from condensing to initiate histone matrix formation, and ultimately inhibiting tumor cell proliferation.

[0008] To achieve the above objectives, the technical solution of the present invention is as follows:

[0009] This invention provides a polypeptide targeting the NPAT protein, which is a truncated version of the NPAT protein. The amino acid sequence of the polypeptide is as follows:

[0010] MLLPSDVARLVLGYLQQENLISTCQTFILESSDLKEYAEHCTDEGFIPAC.

[0011] The present invention also provides a gene encoding the polypeptide. Preferably, the nucleotide sequence of the gene is shown in SEQ ID No. 6.

[0012] The present invention also provides a delivery system comprising the said gene.

[0013] Delivery is made through one or more of the following delivery systems:

[0014] a) Delivery using plasmid vectors;

[0015] b) Delivery via viral vectors, including but not limited to adeno-associated virus vectors and retroviral vectors;

[0016] c) Delivery using non-viral vectors, such as liposome delivery, polymer delivery, etc.;

[0017] d) Delivery by nanoparticles, including inorganic nanoparticles, polymer nanoparticles, etc.;

[0018] e) Direct mRNA delivery, wherein the mRNA encodes the polypeptide, and the mRNA serves as a direct template for gene expression, which can be translated into protein within the cell, thereby enabling rapid production of the gene product.

[0019] The present invention also provides the application of the aforementioned polypeptide or gene in inhibiting tumor cell proliferation.

[0020] In some embodiments of the present invention, the tumor cells are abnormally rapidly proliferating tumor cells, including but not limited to breast cancer cells or lymphoma cells.

[0021] The present invention also provides the use of the aforementioned polypeptide or gene in the preparation of antitumor drugs.

[0022] In some embodiments of the present invention, the tumor is abnormally rapidly proliferating tumor cells, including but not limited to breast cancer or lymphoma.

[0023] The present invention also provides a pharmaceutical composition comprising the aforementioned polypeptide and a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient is selected from excipients, fillers, sweeteners, disintegrants, humectants, and lubricants.

[0024] The polypeptide provided in this invention was discovered during research on the regulatory mechanism of histone matrix formation, a non-membrane organelle within the cell nucleus. Overexpression of this polypeptide in cells effectively inhibits intracellular NPAT aggregation, thereby suppressing histone matrix formation and downregulating histone gene expression. CCK8 assays and clonogenic assays showed that this polypeptide significantly inhibits tumor cell proliferation. The polypeptide of this invention is the amino acid sequence from the N-terminus 1-50 of the NPAT protein, effectively interfering with the normal function of NPAT in regulating histone transcription and hindering the normal progression of the cell cycle. It has promising applications in the pharmaceutical field and can provide new design ideas for developing drugs that inhibit abnormal tumor cell proliferation. Attached Figure Description

[0025] Figure 1The LisH and SIF sequences at the N-terminus of the NPAT protein are key regions mediating NPAT interactions and condensation: A. The amino acid sequence at the N-terminus of NPAT contains LisH and SIF domains. B. Schematic diagrams of three mutants: N-terminal truncated mutant of NPAT, N-terminal LisH-deficient mutant of NPAT, and N-terminal SIF-deficient mutant of NPAT. C. Immunoprecipitation analysis to detect... Figure 1 B. Self-interactions of the three mutants. D. In vitro phase separation experiment to detect... Figure 1 Phase separation of the three mutants in B.

[0026] Figure 2 The N-terminal 1-50 amino acid sequence of NPAT can inhibit the formation of histone matrix: A. Immunofluorescence staining experiments showed that overexpression of the N-terminal 1-50 amino acid sequence of NPAT significantly inhibited the aggregation of the N-terminus of NPAT. Scale bar: 10 μm. B. Immunofluorescence staining experiments showed that overexpression of the N-terminal 1-50 amino acid sequence of NPAT significantly inhibited the formation of histone matrix. Scale bar: 10 μm.

[0027] Figure 3 The N-terminal 1-50 amino acid sequence of NPAT can inhibit the transcription of histone genes: Real-time PCR results showed that the N-terminal 1-50 amino acid sequence of NPAT significantly inhibited the expression of histone genes.

[0028] Figure 4 NPAT-derived peptides can inhibit cell proliferation: A. CCK8 assay showed that N-terminal NPAT-derived peptides significantly inhibited the proliferation of MCF-7 cells. B. Clonogenesis assay showed that N-terminal NPAT-derived peptides significantly inhibited the proliferation of MCF-7 cells. Detailed Implementation

[0029] Example 1: NPAT in vitro phase separation experiment

[0030] The NPAT in vitro phase separation experiment was consistent with Example 1 of the patent with publication number CN118373895A.

[0031] Example 2: Construction of expression plasmids containing the N-terminal sequence and amino acid sequences 1-50 of NPAT

[0032] The relevant vector was constructed using the pXJ40-FLAG plasmid. Primers were designed targeting the N-terminal sequence and amino acid sequences 1-50 of NPAT (primer sequences are shown in Table 1). The relevant DNA fragment was amplified using PCR. Simultaneously, the DNA fragment and the pXJ40-FLAG plasmid were digested with enzymes, ligated using ligase, transformed, and the correct clone was detected. Finally, the relevant vector was obtained. The specific cloning method was consistent with Example 2 of patent publication number CN118373895A.

[0033] The amino acid sequence of NPAT N-terminus 1-430 is shown in SEQ ID No. 1, and the corresponding nucleotide sequence is shown in SEQ ID No. 4;

[0034] The amino acid sequence of NPAT N-terminus 1-90 is shown in SEQ ID No. 2, and the corresponding nucleotide sequence is shown in SEQ ID No. 5.

[0035] The amino acid sequence of NPAT N-terminus 1-50 is shown in SEQ ID No. 3, and the corresponding nucleotide sequence is shown in SEQ ID No. 6.

[0036] The amino acid sequence of NPAT protein 1-90 contains LisH and SIF domains. Figure 1 A). We constructed N-terminal truncated mutants, N-terminal LisH deletion mutants, and N-terminal SIF deletion mutants of NPAT. Figure 1 B). Cloning of the deletion mutant involves removing the deletion fragment using homologous recombination, as follows: Design forward primers and their complementary reverse primers, ensuring the primer sequences simultaneously contain the sequences upstream and downstream of the deletion fragment (the forward primer corresponds to the 15 nucleotides upstream and downstream of the deletion fragment, while the reverse primer is the complementary sequence of the forward primer). Primer sequences are shown in Table 1. PCR amplification is performed using the N-terminus plasmid of NPAT (containing amino acid sequence 1-430) as a template. The resulting PCR product is ligated using homologous recombination enzyme to obtain the plasmid with the deletion fragment removed.

[0037] The amino acid sequence of the LisH domain at the N-terminus of NPAT is shown in SEQ ID No. 7, and the corresponding nucleotide sequence is shown in SEQ ID No. 9.

[0038] The amino acid sequence of the SIF domain at the N-terminus of NPAT is shown in SEQ ID No. 8, and the corresponding nucleotide sequence is shown in SEQ ID No. 10.

[0039] Table 1

[0040] NPAT-N1-430F CGCGGATCCATGATGTTGTTACCCTCGGAC NPAT-N1-430R CGGCTCGAGTTATGTTTTAAAGGCCTTTT NPAT-N1-50F CGCGGATCCATGATGTTGTTACCCTCGGAC NPAT-N1-50R CGGCTCGAGTTAGCAGGCTGGAATAAACCC NPAT-N-ΔLisH F GATAAGTCCGGATCCGAATATGCAGAACAT NPAT-N-ΔLisH R ATGTTCTGCATATTCGGATCCGGACTTATC NPAT-N-ΔSIF F TTATTTGGAAAAAACGACCATACACTTTCT NPAT-N-ΔSIF R AGAAAGTGTATGGTCGTTTTTTCCAAATAA

[0041] Example 3: Immunoprecipitation assay for the self-interaction of NPAT N-terminal truncated protein and its deletion mutants

[0042] Cells were seeded in 6-well cell culture plates and transfected with a vector plasmid containing the target gene cDNA from Example 2. After overnight culture, cells were lysed with lysis buffer (1% sodium deoxycholate, 200 mM NaCl, 60 mM Tris-HCl pH 7.3, 0.75 mM EDTA, 25 mM phosphatase inhibitor, 1% Triton-X-100, 0.2% sodium fluoride, 5 mM sodium orthovanadate, and protease inhibitor), and centrifuged at 15,000 rpm. 15 μL of m²-FLAG beads were added to the supernatant, and after incubation for 2–4 hours, the beads were washed with cell lysis buffer. Loading buffer was added to the samples, and protein-protein interactions were detected by Western blot.

[0043] The results are as follows Figure 1 As shown in C, the absence of LisH or SIF sequences causes the N-terminal truncated NPAT protein to lose its ability to interact with itself, thus preventing phase separation (consistent with in vitro phase separation experiments). Figure 1 D).

[0044] Example 4: Immunofluorescence staining to detect the effect of NPAT-derived peptides on the aggregation of the N-terminus of NPAT and histone matrix formation.

[0045] Cover slips were pre-placed in 24-well cell culture plates, cells were seeded and cultured overnight. Plasmids containing the target gene from Example 2 were transfected into the cells using the Lipofectamine kit and cultured overnight. The next day, cells were washed with PBS, fixed with fixative (3% Paraformaldehyde) for 30 minutes, washed with PBS, and then lysed with PBS containing 0.1% Saponin. Specific primary antibodies (rabbit anti-FLAG monoclonal antibody, Wuhan Aibote Biotechnology Co., Ltd., catalog number: AE092; mouse anti-NPAT antibody, BD Biosciences Co., Ltd., catalog number: 611344; rabbit anti-Myc polyclonal antibody, Hangzhou Huaan Biotechnology Co., Ltd., catalog number: R1208-1; mouse anti-FLAG monoclonal antibody, Shanghai Yisheng Biotechnology Co., Ltd., catalog number: 30505ES60) were added, and incubated for 3-6 hours, followed by washing three times with PBS. Next, add the fluorescently labeled secondary antibody (goat anti-rabbit-Alexa Fluor 555, Thermo Fisher Scientific, catalog number: A-32732; goat anti-mouse-Alexa Fluor 488, Thermo Fisher Scientific, catalog number: A-32723). After 1 hour, clean the slide, carefully remove it and place it upside down on a slide, seal it with 20 μL of Fluoresafe reagent, and observe and photograph it using a confocal microscope.

[0046] NPAT proteins undergo phase separation and condensate formation through self-interaction; therefore, inhibiting NPAT self-interaction will inhibit phase separation. Since LisH is a key region mediating NPAT interaction, we hypothesized that a LisH domain-derived polypeptide (i.e., the polypeptide of the 1-50 amino acid sequence at the N-terminus of NPAT) should be able to bind to NPAT, interfering with its self-interaction through competitive binding and blocking histone basal body (HLB) formation. Immunofluorescence staining analysis showed that the amino acid sequence of NPAT 1-50 not only inhibits N-terminal aggregation of NPAT (… Figure 2 A), and it inhibits the aggregation of endogenous NPAT, preventing the formation of histone matrix ( Figure 2 B).

[0047] Example 5: Detection of the effect of NPAT-derived peptides on histone transcription by quantitative real-time PCR

[0048] Cells were cultured overnight in 6-well cell culture dishes. The constructed vector containing the target gene was transfected into the cells using lipofectamine. Cells were then incubated at 37°C (5% CO2) for 24-48 hours. RNA was extracted using the AFT Spin Tissue / Cell Fast RNA Extraction Kit (Abclonal). 1 μg of RNA was used for reverse transcription using the ABScript III RT Master Mix for qPCR with gDNA Remover kit (Abclonal). The resulting sample was diluted to 100 μl with DEPC H2O. 5 μl of the reverse transcription product was used as a template for real-time quantitative PCR using 2×UniversalSYBR Green Fast qPCR Mix (Abclonal). PCR fluorescence signals were detected using a LightCycler 480II real-time fluorescence quantitative PCR instrument. The results were processed and analyzed using Excel and Graphpad Prism.

[0049] The results are as follows Figure 3 As shown, consistent with the results of Example 4, overexpression of the N-terminal 1-50 amino acid sequence of NPAT in MCF-7 cells can significantly downregulate the expression of histone genes.

[0050] Example 6: NPAT-derived peptides significantly inhibited the proliferation of MCF-7 cells.

[0051] Since the N-terminal 1-50 amino acid sequence of NPAT can significantly inhibit the expression of histone genes, we predicted that this peptide could inhibit cell proliferation. The CCK8 assay and clonogenic assay were used to verify the inhibitory effect of the peptide on tumor cell proliferation.

[0052] 1. CCK8 Experiment

[0053] After 24 hours of culture, the cells were in the logarithmic growth phase. Cells were digested with trypsin, and cell suspensions were collected and prepared into 5-7 concentration gradients. 100 μl of the suspension was added to each well of a 96-well plate, with 4-6 replicates per group. Cells adhered 2-4 hours after seeding. 10 μl of CCK-8 reagent was added to each well, and absorbance was measured at OD450 nm after 1 hour to create a standard curve. Simultaneously, 1000 cells each were seeded into 96-well plates for both the control and experimental groups, with 100 μl of culture medium per well and 4-6 replicates per group. After 24, 48, 72, and 96 hours of culture, 10 μl of CCK-8 reagent was added to each well, and absorbance was measured at OD450 nm after 1 hour. The results were processed and analyzed using Excel and Graphpad Prism.

[0054] 2. Cloning experiment

[0055] Cells in the logarithmic growth phase were digested with 0.25% trypsin and resuspended in DMEM high-glucose medium containing 10% fetal bovine serum to prepare gradient cell suspensions. These suspensions were uniformly suspended at densities of 500 and 1000 cells per cell in culture dishes containing 5 ml of culture medium, with three replicates per group. The dishes were incubated at 37°C, 5% CO2, and saturated humidity for 1-2 weeks. The medium was changed and cell morphology observed every 3 days. When cell clones were visible to the naked eye, the supernatant was discarded, and the cells were washed twice with PBS. 5 ml of 4% paraformaldehyde was added to each well for fixation for 15 minutes. After removing the fixative, crystal violet staining solution was added, followed by 15 minutes of staining with PBS 3-4 times. After air-drying, the plates were photographed with a digital camera, and the number of clones was counted. Finally, the results were analyzed using Graphpad Prism.

[0056] Experimental results show that, regardless of the CCK8 experiment ( Figure 4 A) or clone formation experiment ( Figure 4 B) Both studies have confirmed that NPAT-derived peptides of 1-50 amino acids in size can significantly inhibit the proliferation of MCF-7 cells.

[0057] In summary, the research results of this invention indicate that this NPAT-derived polypeptide can affect NPAT aggregation by interfering with NPAT self-interaction, preventing it from initiating the formation of histone matrix and thus inhibiting cell proliferation, which has good application prospects in the medical field.

Claims

1. A polypeptide targeting NPAT protein, characterized in that, It is a truncated version of the NPAT protein, and the amino acid sequence of the polypeptide is MLLPSDVARLVLGYLQQENLISTCQTFILESSDLKEYAEHCTDEGFIPAC.

2. A gene encoding the polypeptide as described in claim 1.

3. The gene as described in claim 2, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID No.

6.

4. A delivery system comprising the gene of claim 2 or 3.

5. The delivery system as claimed in claim 4, characterized in that, Delivery can be made through one or more of the following delivery systems: a) Delivery using plasmid vectors; b) Delivery using a viral vector; c) Delivery using non-viral vectors; d) Delivery using nanoparticles; e) Direct mRNA delivery.

6. The use of the polypeptide of claim 1 or the gene of claim 2 or 3 in the preparation of an antitumor drug, wherein the tumor is breast cancer.

7. A pharmaceutical composition, characterized in that, It includes the polypeptide of claim 1 and pharmaceutically acceptable excipients.

Citation Information

Patent Citations

  • 211At labeled polypeptide for targeted therapy of brain glioma and preparation method of 211At labeled polypeptide

    CN118108796A

  • Targeted NPAT protein phase separation polypeptide and application thereof

    CN118373895A