Double-affinity chimeric antigen receptor and application thereof
By constructing a biparent chimeric antigen receptor, using hc-Met scFv and hPD-1 scFv to simultaneously target c-Met and PD-1, the problem of poor apoptosis and long-term effects of CAR-T cells in solid tumor treatment was solved, and the effect of improving the proliferation efficiency of CAR-T cells and tumor killing efficiency was achieved.
Patent Information
- Application Number
- CN202510211366.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-25
- Publication Date
- 2025-05-27
AI Technical Summary
Existing CAR-T cells face the problems of apoptosis and poor long-term effects in the clinical application of solid tumors, especially during co-culture with tumor cells or animal experiments, T cell failure is caused by inhibition of PD-1/PD-L1 immune checkpoints.
A versatile chimeric antigen receptor was constructed, and c-Met and PD-1 were simultaneously targeted by hc-Met scFv and hPD-1 scFv, and a versatile c-Met/PD-1CAR-T cells were prepared by retroviral vectors for targeting the treatment of solid tumors.
It effectively improves the proliferation efficiency and tumor killing efficiency of CAR-T cells, extends the lifespan of T cells and maintains the anti-cancer effect.
Smart Images
Figure CN120040602A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and more particularly to a bispecific affinity chimeric antigen receptor and its application. Background Art
[0002] Chimeric antigen receptor T cell technology, with the English name Chimeric Antigen Receptor T Cell Therapy and the English abbreviation CAR-T, is an emerging adoptive immunotherapy. In this method, T cells of tumor patients are isolated, modified with specific antigens in vitro, and then infused back into the patients. The advantages of CAR-T therapy are as follows: (1) CAR-T can specifically recognize tumor cells through the antibodies on its surface, without the action of antigen-presenting cells, can recognize short antigen peptides and non-protein antigens, and because the ScFv expressed on the surface has the characteristic of high affinity, CAR-T is still sensitive to low-concentration antigens. (2) Since the CAR structure connects specific antibodies with signal molecules required for activating T cells, second-generation and later CAR-T cells all express co-stimulatory signal domains CD28 and 4-1BB, which respectively provide the second signal for T cell activation, enabling it to exert faster and stronger signal activities, and play the role of prolonging the lifespan of T cells and maintaining the anti-cancer effect. Therefore, after the antigen-antibody binding, the activation process of T cells can be initiated, thus overcoming the restriction of MHC. (3) Compared with antibody drugs, CAR-T cells have relatively good homing and tissue penetration, and CAR-T cells have the ability to proliferate, can maintain the therapeutic dose in vivo, and even generate memory T cells against specific tumor antigens. Compared with other types of adoptive immunotherapy, CAR-T cells can recognize more types of antigens and have a wider range of target selection.
[0003] At present, CAR-T cells have achieved remarkable curative effects in the treatment of hematological malignancies, but face challenges in the clinical application of solid tumors. Currently, the relatively mature second-generation c-Met-specific CAR-T, during co-culture with tumor cells or in animal experiments, activates the PD-1 molecule on T cells through the recognition of tumor antigens on the surface of CAR-T, causes varying degrees of exhaustion of T cells through the PD-1 / PD-L1 immune checkpoint inhibition, and apoptosis occurs on its own, weakening the tumor killing efficiency and affecting the treatment effect. Therefore, it is necessary to develop a new chimeric antigen receptor to prepare chimeric antigen receptor cells that can be used for solid tumors. Summary of the Invention
[0004] To solve the above problems, the present invention provides a bispecific affinity chimeric antigen receptor and its application to improve the problems of apoptosis of CAR-T cells and poor long-term effect in the prior art.
[0005] The present invention is achieved through the following technical solutions:
[0006] The present invention constructs a bispecific affinity chimeric antigen receptor, which is composed of a first domain hc-Met scFv, a second domain hPD-1 scFv, a third domain, and a fourth domain in series; the first domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human c-Met in series; the second domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human PD-1 in series, the third domain is composed of the hinge region and transmembrane region of human CD8 in series, and the fourth domain is composed of the co-stimulatory domain CD137 and the intracellular signaling domain CD3ζ in series.
[0007] Preferably, the nucleotide sequence of the first domain hc-Met scFv is as shown in SEQ ID NO.2.
[0008] Preferably, the nucleotide sequence of the second domain hPD-1 scFv is as shown in SEQ ID NO.3.
[0009] Preferably, the nucleotide sequence of the third domain is as shown in SEQ ID NO.4.
[0010] Preferably, a CD8 signal peptide is contained at the front end of the first domain hc-Met scFv, and its nucleic acid sequence is as shown in SEQ ID NO.5.
[0011] Preferably, a CD8 signal peptide is contained at the front end of the second domain hPD-1 scFv, and its nucleic acid sequence is as shown in SEQ ID NO.6.
[0012] Preferably, the nucleotide sequence of the co-stimulatory domain CD137 is as shown in SEQ ID NO.7.
[0013] Preferably, the nucleotide sequence of the CD3ζ intracellular signaling domain is as shown in SEQ ID NO.8.
[0014] The present invention further provides the application of the bispecific affinity chimeric antigen receptor in the preparation of chimeric antigen receptor T cells.
[0015] The chimeric antigen receptor T cells are used for the preparation of an immunotherapeutic agent for solid tumors.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] The present invention provides a bispecific affinity chimeric antigen receptor, which is composed of a first domain hc-Met scFv, a second domain hPD-1 scFv, a third domain and a fourth domain in series; the first domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human c-Met in series; the second domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human PD-1 in series; the third domain is composed of the hinge region and transmembrane region of human CD8 in series; the fourth domain is composed of the co-stimulatory domain CD137 and the intracellular signaling domain CD3ζ in series. The bispecific affinity chimeric antigen receptor of the present invention constructs a bispecific affinity chimeric antigen receptor composed of hc-Met scFv, hPD-1 scFv, the hinge region and transmembrane region of human CD8, and CD137-CD3ζ in series based on the second-generation CAR-T, which can target c-Met and PD-1 simultaneously, and prepares bispecific affinity c-Met / PD-1 CAR-T cells through a retroviral vector for targeted treatment of solid tumors. Experiments prove that the bispecific affinity chimeric antigen receptor of the present invention can effectively improve the proliferation efficiency of CAR-T and show strong tumor killing efficiency. The bispecific affinity chimeric antigen receptor constructed by the present invention has broad application prospects in the immunotherapy of tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0019] Figure 1 It is a diagram showing the expression difference of met in lung adenocarcinoma and normal tissues of the present invention;
[0020] Figure 2 It is a diagram showing the construction of the PD-1 / c-Met CAR plasmid of the present invention;
[0021] Figure 2 Among them, A is the molecular map of PD-1 / c-Met CAR, c-Met CAR, and CD19 CAR; B is the verification diagram of the recombinant plasmid digestion by enzymes;
[0022] Figure 3 It is a diagram showing the identification of CAR-T expression, secretion and subsets of the present invention;
[0023] Figure 3In it, A is the flow cytometry detection graph of the positive rates of PD-1 / c-Met CAR-T, c-Met CAR-T, and CD19 CAR-T; B is the western blot detection graph of the PD-1 antibody secreted by PD-1 / c-Met CAR-T; C is the flow cytometry detection graph of the cell subsets of PD-1 / c-Met CAR-T, c-Met CAR-T, and CD19 CAR-T; D is the corresponding statistical graph of the flow cytometry detection of the cell subsets of PD-1 / c-Met CAR-T, c-Met CAR-T, and CD19 CAR-T;
[0024] Figure 4 This is the statistical broken line graph of the proliferation of effector cells stimulated by the target cells of the present invention; among them, *: there is a statistically significant difference compared with the activated T cell group (P < 0.01); #: there is a statistically significant difference compared with the CD19 CAR-T group (P < 0.01); &: there is a statistically significant difference compared with the c-Met CAR-T group (P < 0.01);
[0025] Figure 5 This is the killing efficiency graph of each effector cell against the target cell at different effector-to-target ratios of the present invention; among them, *: there is a statistically significant difference compared with the activated T cell group (P < 0.01); #: there is a statistically significant difference compared with the CD19 CAR-T group (P < 0.01); &: there is a statistically significant difference compared with the c-Met CAR-T group (P < 0.01);
[0026] Figure 6 This is the detection graph of the secretion levels of three cytokines, IL-2, IFN-γ, and TNF-α, of the present invention;
[0027] Figure 6 In it, A is the TNF-α cytokine secretion level graph in T cells, CD19 CAR-T, c-Met CAR-T, and PD-1 / c-Met CAR-T; B is the IFN-γ cytokine secretion level graph in T cells, CD19 CAR-T, c-Met CAR-T, and PD-1 / c-Met CAR-T; C is the IL-2 cytokine secretion level graph in T cells, CD19 CAR-T, c-Met CAR-T, and PD-1 / c-Met CAR-T. Detailed implementation mode
[0028] For the convenience of understanding the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are given. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this invention belongs. The terms used in the description of the present invention herein are for the purpose of describing specific embodiments only and are not intended to limit the present invention.
[0030] The inventive concept of the present invention is as follows:
[0031] At present, CAR-T cells have achieved remarkable efficacy in the treatment of hematological malignancies, but face challenges in the clinical application of solid tumors. In the current relatively mature second-generation c-Met-specific CAR-T, during co-culture with tumor cells or in animal experiments, the activation of PD-1 molecules on T cells is caused by the recognition of tumor antigens on the surface of CAR-T, and different degrees of exhaustion of T cells are caused by the inhibitory effect of the PD-1 / PD-L1 immune checkpoint, and apoptosis occurs, weakening the tumor killing efficiency and affecting the treatment effect.
[0032] Based on this, the present invention provides a bispecific chimeric antigen receptor, which is composed of a first domain hc-Met scFv, a second domain hPD-1 scFv, a third domain, and a fourth domain in series; the first domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human c-Met in series; the second domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human PD-1 in series; the third domain is composed of the hinge region and transmembrane region of human CD8 in series; the fourth domain is composed of the co-stimulatory domain CD137 and the intracellular signaling domain of CD3ζ in series. First, c-Met and PD-L1 are expressed on the vast majority of esophageal cancer cells; second, T cells naturally undergo upregulation of the activation-induced co-inhibition pathway, which restricts the anti-tumor immune response. Programmed death-1 (PD-1), cytotoxic T lymphocyte-associated protein 4 (CTLA-4), and other co-inhibitory receptors are upregulated after T cells encounter antigens, and the expression of co-inhibitory ligands increases after tumor cells are exposed to Th1 cytokines secreted by T cells. The success of antibody therapy targeting immune checkpoints such as PD-1 and CTLA-4 highlights the therapeutic potential of counteracting immune suppression; finally, due to the widespread expression of c-Met and PD-L1 on esophageal cancer cells and their role in promoting their survival, the probability of simultaneous loss of these two antigens is very low. Therefore, the present invention constructs a bispecific chimeric antigen receptor composed of hc-Met scFv, hPD-1 scFv, the hinge region and transmembrane region of human CD8, and CD137-CD3ζ in series based on second-generation CAR-T, which can target c-Met and PD-1 simultaneously, and prepares bispecific c-Met / PD-1 CAR-T cells through a retroviral vector for targeted treatment of solid tumors. Experiments have proved that the bispecific chimeric antigen receptor of the present invention can effectively improve the proliferation efficiency of CAR-T and exhibit strong tumor killing efficiency.
[0033] To better illustrate the present invention, the content of the present invention will be further described below in conjunction with examples. The following are specific examples.
[0034] Example 1. A bispecific chimeric antigen receptor
[0035] The bispecific chimeric antigen receptor is composed of a first domain hc-Met scFv, a second domain hPD-1 scFv, a third domain, and a fourth domain in series; the first domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human c-Met in series; the second domain is composed of the variable light chain and variable heavy chain of a monoclonal antibody against human PD-1 in series; the third domain is composed of the hinge region and transmembrane region of human CD8 in series; the fourth domain is composed of the co-stimulatory domain CD137 and the intracellular signaling domain of CD3ζ in series.
[0036] Among them, the nucleotide sequence of the first domain hc-Met scFv is shown in SEQ ID NO.2. The nucleotide sequence of the second domain hPD-1 scFv is shown in SEQ ID NO.3. The nucleotide sequence of the third domain is shown in SEQ ID NO.4. The front end of the first domain hc-Met scFv contains a CD8 signal peptide, and its nucleic acid sequence is shown in SEQ ID NO.5. The front end of the second domain hPD-1 scFv contains a CD8 signal peptide, and its nucleic acid sequence is shown in SEQ ID NO.6. The nucleotide sequence of the co-stimulatory domain CD137 is shown in SEQ ID NO.7. The nucleotide sequence of the CD3ζ intracellular signaling domain is shown in SEQ ID NO.8.
[0037] Experimental Example 1
[0038] In this experimental example, the expression level of c-Met protein in LUAD tissues was analyzed through the GEPIA database.
[0039] The expression of c-Met protein in LUAD tissues was significantly higher than that in adjacent normal tissues. Analysis of the Human Protein Atlas database showed that the expression of c-Met protein in lung cancer was significantly higher than that in normal lung tissues, as Figure 1 shown, p < 0.05.
[0040] Experimental Example 2
[0041] This experimental example was for the determination of the gene sequences of CD8 signal peptide-hc-Met scFv-CD8 hinge region and transmembrane region-CD137-CD3ζ-CD8 signal peptide-hPD-1 scFv.
[0042] The EF1a promoter, human CD8 signal peptide gene sequence, light chain and heavy chain variable region hc-Met scFv gene sequence of anti-human c-Met monoclonal antibody, light chain and heavy chain variable region hPD-1 scFv gene sequence of anti-human PD-1 monoclonal antibody, CD8 hinge region and transmembrane region gene sequence, co-stimulatory domain CD137, CD3ζ intracellular signaling domain gene sequence, his tag gene sequence, EGFP tag, and FP2A linker element gene sequence, and P2A linker element gene sequence were obtained from the NCBI database.
[0043] The above gene sequences were arranged and ligated in the order of EF1a promoter-CD8 signal peptide-hc-Met scFv-CD8 hinge region and transmembrane region-CD137-CD3ζ-FP2A-CD8 signal peptide-hPD-1 scFv-6his-P2A-EGFP to finally form the complete double-affinity chimeric antigen receptor gene sequence information.
[0044] Experimental Example 3
[0045] In this experimental example, a second-generation anti-c-Met CAR containing CD8 signal peptide-hc-Met scFv-CD8 hinge region and transmembrane region-CD137-CD3ζ-CD8 signal peptide-hPD-1scFv was constructed.
[0046] The FP2A element was used as the linker between the c-Met CAR and the secretion sequence, and the FP2A element sequence is shown in SEQ ID NO.9; then the his tag was used, and the his tag gene sequence is shown in SEQ ID NO.10, and a c-Met CAR for secreting anti-pd1 scFv was prepared. All target sequences were combined with the EGFP fluorescence reporter gene to evaluate the transduction efficiency. The EGFP fluorescence reporter gene sequence is shown in SEQ ID NO.12, as Figure 2 shown in A, digestion verification showed that the anti-human c-Met scfv-PD-1scFv-CAR expression plasmid was successfully constructed, as Figure 2 shown in B.
[0047] Lentiviruses were coated and concentrated using the three-plasmid method and high-speed centrifugation method. 15 ml of peripheral blood was drawn from healthy volunteers, anticoagulated with sodium heparin, and stored in a sealed manner. After dilution with normal saline, PBMCs were separated using lymphocyte separation medium culture solution and placed in a 48-well plate coated with anti-CD3 and CD28 monoclonal antibodies 24 h in advance, and 200 U / ml IL-2 was added for continued culture.
[0048] The pro-infection reagent RetroNectin was diluted in PBS at a ratio of 1:40, and 150 μL per well was used to coat the 48-well plate and incubated overnight at 4°C. It can be discarded and used for infection. In the infection system, the virus amount was placed according to the MOI value = 5 obtained from the preliminary experiment and 1×10 6 / mL T cells. According to the principle of changing the culture medium every other day, the cell growth status, density and fluorescence signal were observed on the 3rd, 5th, 7th and 9th days. The cell fluid was collected, centrifuged and passaged. Finally, the cells were inoculated in the corresponding cell culture flasks at a cell density of 0.7×10 6 / mL and cultured in an incubator at 37°C and 5% CO 2 for more than 10 days.
[0049] After lentivirus infection of activated T cells, second-generation c-Met CAR-T, fourth-generation c-Met / PD-1 CAR-T and negative control CD19 CAR-T were successfully prepared. Flow cytometry was used to detect the positive rate of each CAR-T cell. The results showed that the positive rate of fourth-generation c-Met / PD-1 CAR-T was 30%, the positive rate of second-generation c-Met CAR-T was 54.8%, and the positive rate of CD19 CAR-T was 50.6%, asFigure 3 as shown in A.
[0050] Experimental Example 4
[0051] In this experimental example, Western blot was used to detect the PD-1 antibody secreted by PD-1 / c-Met CAR-T into the supernatant. The PD-1 antibody molecule carried a his tag.
[0052] Western blot detection: Count and adjust the T cell concentration to 1×10 6 cells / ml, place the CAR-T cells in an incubator and culture for 24 h; for the cell supernatant, boil the protein; take 30 μg of cell protein loading amount, separate by 10% SDS-PAGE gel electrophoresis, transfer the protein to a PVDF membrane, block with skim milk powder at room temperature for 2 h, wash the membrane with TBST, and then add HIS and GAPDH primary antibodies respectively and incubate overnight at 4 °C. Wash the membrane 3 times with TBST, then incubate with the secondary antibody diluted 1:5000 at room temperature for 2 h, wash with TBST and develop. Using GAPDH as an internal reference, analyze the gray value of the protein band with Image J software and calculate the relative protein expression level.
[0053] It can be obtained by detecting the his protein in the supernatant that PD-1 / c-Met CAR-T can secrete PD-1 antibody smoothly, but there is no PD-1 antibody in the supernatants of activated T cells, CD19 CAR-T and c-Met CAR-T cells, as Figure 3 shown in B.
[0054] Experimental Example 5
[0055] In this experimental example, flow cytometry was used to evaluate the changes in T cell subsets before and after lentiviral infection.
[0056] Collect CAR-T cells, wash three times with PBS at 1000 rpm for 5 min; adjust the cell number to 1×10 6 cells per tube; add 1 μl of CD3-APC, CD4-PE, and CD8-PerCP5.5 to each type of CAR-T cell respectively, with an incubation volume of 200 μl, and set up single-positive tubes of EGFP, APC, PE, and PerCP5.5; after incubating statically in the dark at 4 °C for 30 min, wash three times with PBS at 1000 rpm for 5 min; resuspend with 200 μl of PBS, transfer to a flow tube, and detect the FITC, PE, PerCP5.5, and APC channels on the machine.
[0057] The results are as Figure 3 shown in C. Before lentiviral infection, the proportion of the CD4+ subset of T cells was 13.4%, and the proportion of the CD8+ subset was 74.9%. After lentiviral infection, for CD19 c-Met CAR-T CD4 +The proportion of the subgroup is 27.4%, CD8 + The proportion of the subgroup is 66.1%; c-Met CAR-T CD4 + The proportion of the subgroup is 39.1%, CD8 + The proportion of the subgroup is 53.1%; PD-1 / c-Met CAR-T CD4 + The proportion of the subgroup is 48.0%, CD8 + The proportion of the subgroup is 45.8%. After lentiviral infection, the CD8 + T cell subsets all decreased, and the CD4 + T cell subsets all increased.
[0058] The purpose of analyzing the CD4CD8 subtypes is to judge the way CAR-T attacks tumor cells. CD8 T cells are cytotoxic T cells, which mainly destroy tumor cells through perforin-granzyme, and can be verified by the LDH release test subsequently; CD4 T cells kill tumor cells by releasing cytokines, and the concentrated cytokines can be verified by the ELISA test subsequently.
[0059] Experimental Example 6: The PD-1 secreted antibody can effectively improve the proliferation efficiency of CAR-T
[0060] The target cells Aspc-1 and effector cells activated T cells, CD19 CAR-T, c-Met CAR-T and PD-1 / c-MetCAR-T were co-cultured at an effector-to-target ratio of 5:1 for 24 h, 48 h, and 72 h. The results are as Figure 4 shown. It shows that the cell numbers of c-MetCAR-T and PD-1 / c-Met CAR-T at 24 h, 48 h, and 72 h are much higher than those of activated T cells and CD19 CAR-T, but there is no significant difference in the cell proliferation rates of c-Met CAR-T and PD-1 / c-Met CAR-T at 24 h and 48 h. At 72 h, PD-1 / c-Met CAR-T shows a higher cell proliferation number than c-Met CAR-T under the stimulation of target cells.
[0061] Experimental Example 7: PD-1 antibody-secreting CAR-T shows strong tumor killing efficiency
[0062] Pancreatic cancer cells were co-cultured with activated T cells, CD19 CAR-T, c-Met CAR-T and PD-1 / c-Met CAR-T for 6 hours respectively, and the killing effect of CAR-T on target cells was detected by the LDH release experiment. The results are as Figure 5As shown, the killing rate of tumor by effector cells increases with the increase of the effector-to-target ratio. At the effector-to-target ratios of 1:1, 5:1, 10:1, and 20:1 set, the cancer cell killing rates of c-Met CAR-T and PD-1 / c-Met CAR-T are much higher than those of activated T cells and CD19 CAR-T. At the effector-to-target ratios of 10:1 and 20:1, PD-1 / c-Met CAR-T shows higher target cell killing efficiency than c-Met CAR-T.
[0063] Experimental Example 8. PD-1 antibody-secreting CAR-T shows strong cytokine secretion
[0064] The effector cells and target cells were co-cultured at an effector-to-target ratio of 1:1 for 24 h, and the secretion levels of three cytokines, namely IL-2, IFN-γ, and TNF-α, were detected by an ELISA kit. The results are as Figure 6 shown, indicating that the secretion amounts of the three cytokines of c-Met CAR-T and PD-1 / c-Met CAR-T are higher than those of activated T cells and CD19 CAR-T; for the secretion amounts of two cytokines, IL-2 and TNF-α, PD-1 / c-Met CAR-T shows higher than c-Met CAR-T. For the secretion amount of INF-γ, c-Met CAR-T shows higher than PD-1 / c-Met CAR-T.
[0065] The nucleotide sequence of the EF1a promoter is as shown in SEQ ID NO.1 and is:
[0066]
[0067] The nucleotide sequence of the first domain hc-Met scFv is shown in SEQ ID NO.2 and is as follows:
[0068] GACATCCAGATGACCCAGAGCCCCAGCAGCGTGAGCGCCAGCGTGGGCGACCGGGTGACCATCACCTGCCGGGCCAGCCAGGGCATCAACACCTGGCTGGCCTGGTATCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACGCCGCCAGCAGCCTGAAGAGCGGCGTGCCCAGCCGGTTTAGCGGCTCTGGCTCTGGCGCCGACTTCACCCTGACCATCAGCAGCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCAGCAGGCCAACAGCTTCCCCCTGACCTTTGGCGGCGGAACAAAGGTGGAGATCAAGGGCAGCACCTCCGGCAGCGGCAAGCCTGGCAGCGGCGAGGGCAGCACCAAGGGCCAGGTGCAGCTGGTGCAGAGCGGAGCCGAGGTGAAGAAGCCTGGCGCCTCCGTCAAGGTGTCCTGCGAGGCCAGCGGCTACACCTTCACCAGCTACGGCTTCAGCTGGGTGCGGCAGGCACCAGGCCAGGGCCTCGAATGGATGGGCTGGATCAGCGCCAGCAACGGCAACACCTACTACGCCCAGAAGCTGCAGGGCAGGGTCACCATGACCACCGACACCAGCACCAGCAGCGCCTACATGGAACTGCGGAGCCTGAGAAGCGACGACACCGCCGTGTACTACTGCGCCAGGGTGTACGCCGACTACGCCGATTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGC。
[0069] The nucleotide sequence of the second domain hPD-1 scFv is shown in SEQ ID NO.3 and is as follows:
[0070] CAGTCCGTGCTGACACAGCCTCCAAGCGTGAGTGTGGCCCCTGGCAAGACCGCCAGAATTACCTGTGGCGGCAACAACATTGGCAGCAAGAGCGTGCACTGGTATCAGCAGAGACCCGGACAGGCCCCCGTGCTGGTGATTTATTACGACAGTGATAGACCTTCTGGCATCCCAGAGCGGTTCTCCGGGTCCAACTCCGGAAACACCGCTACACTGACTATCTCTAGAGTGGAAGCCGGGGATGAGGCCGATTACTACTGCCAGGTGTGGGATTCCAGCAGCGATTACGTGTTTGGGATCGGAACAAAGGTGACAGTCCTGGGCGGCGGCGGCGGGAGCGGCGGCGGCGGGAGCGGAGGGGGAGGGAGCGAGGTGCAGCTGGTGGAGAGCGGCGGCGGCCTGATCCAGCCTGGAGGCTCCCTGAGACTGTCATGCGCTGCCTCTGGCTTCACCTTTAGCAGTTACGCCATGTCTTGGGTGCGCCAGGCCCCTGGAAAGGGGCTGGAGTGGGTGAGTGCTATTTCCGGATCCGGCGGGTCCACATACTATGCTGACTCCGTGAAGGGCAGGTTTACCATCAGCAGAGACAATTCTAAGAACACTCTCTACCTGCAGATGAACTCACTGAGGGCCGAAGACACAGCCGTGTACTACTGTGCTCGCAATTACATTAGCATGTTCGACAGCTGGGGGCAGGGAACACTGGTGACCGTGTCCTCC。
[0071] The nucleotide sequence of the third domain is shown in SEQ ID NO.4 and is as follows:
[0072] ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCG
[0073] CGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCG
[0074] GGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATATCTAC
[0075] ATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC。
[0076] The nucleotide sequence of the CD8 signal peptide at the front end of the first domain hc-Met scFv is shown in SEQ ID NO.5 and is:
[0077] ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGTGAGCTGCCCCACCC CGCCTTTCTGCTGATCCCC。
[0078] The nucleotide sequence of the CD8 signal peptide at the front end of the second domain hPD-1 scFv is shown in SEQ ID NO.6 and is:
[0079] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCT CCACGCCGCCAGGCCG。
[0080] The nucleotide sequence of the co-stimulatory domain CD137 is shown in SEQ ID NO.7 and is:
[0081] AAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTAT GAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTT CCAGAAGAAGAAGAAGGAGGATGTGAACTG。
[0082] The nucleotide sequence of the CD3ζ intracellular signaling domain is shown in SEQ ID NO.8 and is:
[0083] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC。
[0084] The nucleotide sequence of FP2A is shown in SEQ ID NO.9 and is as follows:
[0085] CGGCGGAAGCGGGGCAGCGGCGCCACCAACTTCAGCCTGCTGAAG CAGGCCGGTGACGTGGAGGAGAATCCCGGCCCT。
[0086] The nucleotide sequence of the his tag is shown in SEQ ID NO.10 and is as follows:
[0087] CACCATCACCACCACCAC。
[0088] The nucleotide sequence of P2A is shown in SEQ ID NO.11 and is as follows:
[0089] Ggatccatgggcagcggcgccaccaacttcagcctgctgaagcaggccggtgacgtggaggagaatcccgg ccct。
[0090] The nucleotide sequence of EGFP is shown in SEQ ID NO.12 and is as follows:
[0091] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag。
[0092] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered to be within the scope described in this specification.
[0093] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.
Claims
1. A dual-affinity chimeric antigen receptor, characterized in that The dual-affinity chimeric antigen receptor is composed of a first domain hc-Met scFv, a second domain hPD-1 scFv, a third domain and a fourth domain in series; the first domain is composed of a light chain variable region and a heavy chain variable region of an anti-human c-Met monoclonal antibody in series; the second domain is composed of a light chain variable region and a heavy chain variable region of an anti-human PD-1 monoclonal antibody in series, the third domain is composed of a human CD8 hinge region and a transmembrane region in series, and the fourth domain is composed of a costimulatory domain CD137 and a CD3ζ intracellular signaling domain in series.
2. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The nucleotide sequence of the first domain hc-MetscFv is shown in SEQ ID NO.
2.
3. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The nucleotide sequence of the second domain hPD-1scFv is shown in SEQ ID NO.
3.
4. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The nucleotide sequence of the third domain is shown in SEQ ID NO.
4.
5. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The front end of the first domain hc-MetscFv contains a CD8 signal peptide, and its nucleic acid sequence is shown in SEQ ID NO.
5.
6. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The front end of the second domain hPD-1scFv contains a CD8 signal peptide, and its nucleic acid sequence is shown in SEQ ID NO.
6.
7. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The nucleotide sequence of the costimulatory domain CD137 is shown in SEQ ID NO.
7.
8. The dual-affinity chimeric antigen receptor according to claim 1, characterized in that The nucleotide sequence of the CD3ζ intracellular signaling domain is shown in SEQ ID NO.
8.
9. Use of the dual-affinity chimeric antigen receptor according to claim 1 in preparing chimeric antigen receptor T cells.
10. Use of the dual-affinity chimeric antigen receptor according to claim 9 in preparing chimeric antigen receptor T cells, characterized in that: The chimeric antigen receptor T cells are used to prepare solid tumor immunotherapy preparations.