Application of TNFRSF13B gene in regulating the adaptability of lake sheep to drought environment
By negatively regulating the TNFRSF13B gene and interfering with its expression in Hu sheep hepatocytes using siRNA precursor oligonucleotides, the expression of related genes was regulated, thus solving the problem of insufficient adaptability of Hu sheep to arid environments, enhancing their reproductive vitality and metabolic capacity, and enabling them to adapt to arid environments.
Patent Information
- Application Number
- CN202510194955.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-21
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-02-21
AI Technical Summary
There are relatively few reports on the adaptability and resistance of Hu sheep to drought environments in existing technologies, and there is a lack of effective gene regulation methods to improve the adaptability of Hu sheep to drought environments.
By negatively regulating the TNFRSF13B gene and interfering with the expression of the TNFRSF13B gene in sheep liver cells using siRNA precursor oligonucleotides, the expression of related genes, including BCL2, GLUT4, PPARG, and LPL, is regulated, thereby enhancing the proliferation, glucose uptake, and lipid synthesis of sheep liver cells.
It significantly improved the adaptability of Hu sheep to arid environments, enhanced the proliferation activity of hepatocytes, reduced the apoptosis rate, and improved the lipid synthesis and glucose uptake capacity of hepatocytes, thus adapting them to the arid environment of Xinjiang Uygur Autonomous Region.
Smart Images

Figure CN120041580B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular breeding, and particularly relates to application of a TNFRSF13B gene in regulating adaptability of a lake sheep to a drought environment. BACKGROUND
[0002] The lake sheep is a white skin sheep local breed animal. The lake sheep shows good environmental adaptability to a drought climate environment. At present, there are relatively few reports about drought environmental adaptability and resistance of the lake sheep. SUMMARY
[0003] The application aims to provide application of a TNFRSF13B gene in regulating adaptability of a lake sheep to a drought environment.
[0004] The application provides application of a TNFRSF13B gene in regulating adaptability of a lake sheep to a drought environment, wherein a CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0005] In the specific implementation process of the application, the application includes application of negative regulation of the TNFRSF13B gene in improving adaptability of the lake sheep to the drought environment, and the negative regulation includes knockdown or knockdown reduction.
[0006] The application further provides application of a reagent for negative regulation of a TNFRSF13B gene in improving adaptability of a lake sheep to a drought environment, wherein a CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0007] In the specific implementation process of the application, the reagent for negative regulation of the TNFRSF13B gene includes siRNA precursor oligonucleotides of the TNFRSF13B gene, the siRNA precursor oligonucleotides of the TNFRSF13B gene include at least one of siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3, and nucleotide sequences of the siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3 are shown as SEQ ID NO. 2 to SEQ ID NO. 4, respectively.
[0008] The application further provides application of a TNFRSF13B gene in regulating lake sheep hepatocytes, wherein a CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0009] The regulation of the lake sheep hepatocytes includes at least one of the following:
[0010] 1) regulating proliferation activity of the lake sheep hepatocytes;
[0011] 2) regulating the liver cell cycle of Hu sheep;
[0012] 3) regulating the apoptosis of liver cells of Hu sheep;
[0013] 4) regulating the lipid synthesis capacity of liver cells of Hu sheep;
[0014] 5) regulating the glucose uptake capacity of liver cells of Hu sheep;
[0015] The CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0016] In the specific implementation of the present application, the application includes at least one of the following:
[0017] 1) application of negative regulation of the TNFRSF13B gene in improving the proliferation activity of liver cells of Hu sheep;
[0018] 2) application of negative regulation of the TNFRSF13B gene in reducing the proportion of G0 / G1 phase cells of liver cells of Hu sheep and / or increasing the proportion of S phase cells of liver cells of Hu sheep;
[0019] 3) application of negative regulation of the TNFRSF13B gene in inhibiting the apoptosis of liver cells of Hu sheep;
[0020] 4) application of negative regulation of the TNFRSF13B gene in improving the lipid synthesis capacity of liver cells of Hu sheep;
[0021] 5) application of negative regulation of the TNFRSF13B gene in improving the glucose uptake capacity of liver cells of Hu sheep.
[0022] The present application also provides application of the TNFRSF13B gene in regulating apoptosis-related genes of Hu sheep, wherein the CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0023] In the specific implementation of the present application, the application includes application of negative regulation of the TNFRSF13B gene in positive regulation of the expression of the BCL2 gene; or, the application includes application of negative regulation of the TNFRSF13B gene in negative regulation of the expression of the BAX gene, the P53 gene and / or the CASP3 gene; the NCBI GenBank accession numbers of the BCL2 gene, the BAX gene, the P53 gene and the CASP3 gene are GeneID: 101119602, GeneID: 443059, GeneID: 443421 and GeneID: 443031, respectively.
[0024] The present application also provides application of the TNFRSF13B gene in regulating liver cell metabolism-related genes of Hu sheep, wherein the CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0025] In the specific implementation of the present application, the application includes the application of negatively regulating the expression of the TNFRSF13B gene in the positive regulation of the expression of the GLUT4 gene and / or the PPARG gene; or, the application includes the application of negatively regulating the expression of the TNFRSF13B gene in the negative regulation of the expression of the LPL gene; the NCBI GenBank accession numbers of the GLUT4 gene, the PPARG gene and the LPL gene are GeneID: 442992, GeneID: 443513 and GeneID: 443408 respectively.
[0026] The present application provides the application of the TNFRSF13B gene in regulating the adaptability of lake sheep to a drought environment, and the CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1. The present application mines the TNFRSF13B gene by using the transcriptome and whole genome methylation method, and after the siRNA precursor oligonucleotide sequence of the TNFRSF13B gene is used to interfere with the expression of the TNFRSF13B gene of lake sheep hepatocytes, the expression of the BCL2 gene (encoding an anti-apoptosis protein) related to cell apoptosis is significantly higher (P<0.05), BCL2 prevents the release of pro-apoptotic factors (such as cytochrome C) by inhibiting the permeability of the outer membrane of mitochondria, and further prevents the transmission of apoptosis signals; the expression amounts of the hepatocyte metabolism-related genes GLUT4 and PPARG are both significantly higher than those of the control group (P<0.05), and the expression amount of the LPL gene and its protein is significantly lower than that of the control group (P<0.05), indicating that the decrease of the expression of the TNFRSF13B gene leads to the increase of the lipid synthesis capacity and glucose uptake capacity of lake sheep liver cells and the decrease of the lipid decomposition capacity, and the He Tian region is a drought region, and after the lake sheep is introduced into the He Tian region from the Taihu region, in order to well adapt to the local climate environment, the body size of the lake sheep becomes smaller, and the lipid synthesis capacity also increases, indicating that in order to adapt to the drought environment, the TNFRSF13B gene is highly methylated and lowly expressed, and participates in the signal pathway of energy metabolism, thereby providing a reference for improving the adaptability of sheep to a drought environment. BRIEF DESCRIPTION OF DRAWINGS
[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.
[0028] Figure 1 Indicates the interaction between 38 gene hub proteins;
[0029] Figure 2Figure for the expression difference of metabolism related genes of Hu sheep in different regions (Taihu region and Hetian region) ;
[0030] Figure 3 Figure for the identification result of liver cell immunofluorescence of Hu sheep;
[0031] Figure 4 Figure for the identification result of liver cell glycogen staining of Hu sheep;
[0032] Figure 5 Figure for the expression result of TNFRSF13B gene mRNA of Hu sheep liver cell after transfection of siRNA for 48 h;
[0033] Figure 6 Figure for the effect of TNFRSF13B gene on the proliferation of Hu sheep liver cell;
[0034] Figure 7 Figure for the apoptosis of Hu sheep liver cell after interference of TNFRSF13B gene;
[0035] Figure 8 Figure for the expression result of apoptosis related genes and proteins of Hu sheep liver cell after interference of TNFRSF13B gene; wherein, the left graph is the expression of apoptosis related genes, the right graph is the expression of apoptosis related proteins, PC represents the control group, and SI represents the interference group;
[0036] Figure 9 Figure for the expression result of metabolism related genes and proteins of Hu sheep liver cell after interference of TNFRSF13B gene; wherein, the left graph is the expression of liver cell metabolism related genes, the right graph is the expression of liver cell metabolism related proteins, PC represents the control group, and SI represents the interference group. DETAILED DESCRIPTION
[0037] The application provides application of TNFRSF13B gene in regulation and control of adaptability of lake sheep to drought environment, a CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1, Gene ID: 101122200, and the application is specifically: gggggctgacaccactctag gggctgggac ctcagggccc aaacctcaca cgcacatgtggacagtggag ccatcttgctggaacattcc gtctggctga gtaattccacctaaggaactcaagccttag caggagacac agaaaagccccacagggccc gcggcggggggtggccatggagccctgccc ggaagagcag tactgggact cgctgctgaacacctgcgtctcctgcaaacccatctgcag cagccagatt ccgcgcacct gtgcggccttctgcaagtcactcagttgccgcgaagagca aggcaggtac tatgacctgc tcctgagggactgcatcagctgtgcctccatctgcggacg tcaccccaag cagtgcacac actactgtgagaagacgctgaggagccaagtgagcctcct accagagttc aggagacagc gggccggagaggccccgacccgagcagacaccctggggaa gcaccaggtg ccagagcaca gaggcttggatgcgggtccagcgcctgcagggctgaagct gagcgctgac cagctggccc tggtctacagcacgctgggcctatgtctctgtgccatcgt ctgctgcttc ctgctggccg tggcctgctt cctcaagaggaggggggtccaggtctccttcccgacccgc ccagggccgt gtcccacgca ggccaaggcctccaaggatgattggatgga agccggccgcgtggcaggga cgcctcccga gccagtggagacttgtagcttctgcttccc ggagtgcagg gcgcccacccaggagagtgc aggcgcgcccccgacacccgtgtccgagcg cacagggaggagggcgagcc aggaacagag agcagccggacagccctgcgtgcgcgctgc gaacggcggg atcgaggtgg tgtacacaccagcgcaggaaggaggcctggccacgtgaac ctgggggaat ggtcaccgtc acctcaacgcacctgcggtaaaggcaccacccctgctgga ctcagccccg gggccccttg gcggaaataa aacctcccacactgcccgctc。
[0038] In the present application, the TNFRSF13B gene is related to the metabolism of Hu sheep, and is a candidate gene for the drought adaptability of Hu sheep. After the TNFRSF13B gene is interfered, the apoptosis-related gene BCL2 gene is significantly highly expressed, the liver cell metabolism-related genes GLUT4 and PPARG are highly expressed, and the LPL gene is lowly expressed. After the TNFRSF13B gene is interfered, the activity of Hu sheep cells is enhanced, and the liver lipid synthesis capacity is enhanced, which are all performances of adapting to the drought environment. Therefore, Hu sheep can better adapt to the environment of Xinjiang Uygur Autonomous Region.
[0039] In the present application, the BCL2 gene is an anti-apoptosis protein encoding gene. BCL2 prevents the release of pro-apoptotic factors (such as cytochrome C) by inhibiting the permeability of the outer membrane of mitochondria, thereby preventing the transmission of apoptosis signals. It prevents them from forming pores on the outer membrane of mitochondria by combining with pro-apoptotic proteins (such as BAX), and protects cells from apoptosis when responding to external stimuli (such as stress, DNA damage, etc.).
[0040] The expression amount of TNFRSF13B in the liver cells of Hu sheep in Hetian area is significantly lower than that of Hu sheep in Taihu area, and the TNFRSF13B gene is highly methylated, indicating that the liver metabolism function of Hu sheep has changed in the drought area of Hetian.
[0041] In the specific implementation process of the present application, the application includes the application of negatively regulating the TNFRSF13B gene in improving the adaptability of Hu sheep to the drought environment. The negative regulation includes knockdown or knockdown.
[0042] In the specific implementation process of the present application, the application also includes the application of the TNFRSF13B gene as a target gene in preparing a related preparation of Hu sheep not adapting to the environment. In the specific implementation process of the present application, the related preparation includes but is not limited to at least one of a related vaccine, a detection preparation and a gene drug.
[0043] The application also provides application of a reagent for negatively regulating a TNFRSF13B gene in improving the adaptability of a lake sheep to a drought environment, a CDS sequence of the TNFRSF13B gene being shown as SEQ ID NO. 1.
[0044] In the implementation of the application, the reagent for negatively regulating the TNFRSF13B gene comprises siRNA precursor oligonucleotides of the TNFRSF13B gene; the siRNA precursor oligonucleotides of the TNFRSF13B gene comprise at least one of siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3, and further siTNFRSF13B-2, which has the highest interference efficiency; and nucleotide sequences of the siTNFRSF13B-1, siTNFRSF13B-2 and siTNFRSF13B-3 are shown as SEQ ID NO. 2-SEQ ID NO. 4.
[0045] The application also provides application of a TNFRSF13B gene in regulating lake sheep hepatocytes, a CDS sequence of the TNFRSF13B gene being shown as SEQ ID NO. 1.
[0046] The regulation of the lake sheep hepatocytes comprises at least one of the following:
[0047] 1) regulating the proliferation activity of the lake sheep hepatocytes;
[0048] 2) regulating the cell cycle of the lake sheep hepatocytes;
[0049] 3) regulating the apoptosis of the lake sheep hepatocytes;
[0050] 4) regulating the lipid synthesis capacity of the lake sheep hepatocytes;
[0051] 5) regulating the glucose uptake capacity of the lake sheep hepatocytes;
[0052] The CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0053] In the implementation of the application, the application comprises at least one of the following:
[0054] 1) application of the negatively regulated TNFRSF13B gene in improving the proliferation activity of the lake sheep hepatocytes;
[0055] 2) application of the negatively regulated TNFRSF13B gene in reducing the proportion of G0 / G1 phase cells of the lake sheep hepatocytes and / or improving the proportion of S phase cells of the lake sheep hepatocytes;
[0056] 3) application of the negatively regulated TNFRSF13B gene in inhibiting the apoptosis of the lake sheep hepatocytes;
[0057] 4) Application of the negative regulation of the TNFRSF13B gene in improving the lipid synthesis capacity of liver cells;
[0058] 5) Application of the negative regulation of the TNFRSF13B gene in improving the glucose uptake capacity of liver cells of Hu sheep.
[0059] In the present application, after interfering with the TNFRSF13B gene, the cell proliferation activity of liver cells of Hu sheep is significantly enhanced.
[0060] In the present application, after interfering with the TNFRSF13B gene, the proportion of G0 / G1 phase cells of liver cells is reduced, the proportion of S phase cells of liver cells of Hu sheep is increased, and the proportion of G2 phase cells is not significantly changed; wherein, the G0 / G1 phase is the cell resting phase and the pre-DNA synthesis phase, and the S phase is the DNA synthesis phase.
[0061] In the present application, after interfering with the TNFRSF13B gene, the apoptosis rate of liver cells of Hu sheep is significantly reduced.
[0062] In the present application, after interfering with the TNFRSF13B gene, the BCL2 gene in liver cells of Hu sheep is significantly highly expressed, and the expression amounts of BAX, P53 and CASP3 genes are relatively reduced.
[0063] In the present application, after interfering with the TNFRSF13B gene, the expression amounts of the glucose metabolism related gene GLUT4 and the lipid synthesis related gene PPARG gene and its protein in liver cells of Hu sheep are significantly higher than those of the control group, and the expression amount of the lipid decomposition metabolism related gene LPL gene and its protein is significantly reduced, indicating that the reduction of the expression of the TNFRSF13B gene leads to the enhancement of the lipid synthesis capacity and the glucose uptake capacity of liver cells of Hu sheep and the reduction of the lipid decomposition capacity.
[0064] The present application also provides application of the TNFRSF13B gene in regulating apoptosis related genes of Hu sheep, and the CDS sequence of the TNFRSF13B gene is shown in SEQ ID NO. 1.
[0065] In the specific implementation process of the present application, the application includes application of the negative regulation of the TNFRSF13B gene in the positive regulation of the expression of the BCL2 gene; or, the application includes application of the negative regulation of the TNFRSF13B gene in the negative regulation of the expression of the BAX gene, the P53 gene and / or the CASP3 gene; the NCBI GenBank accession numbers of the BCL2 gene, the BAX gene, the P53 gene and the CASP3 gene are GeneID: 101119602, GeneID: 443059, GeneID: 443421 and GeneID: 443031, respectively.
[0066] The application also provides application of the TNFRSF13B gene in regulating liver cell metabolism related genes of Hu sheep, and a CDS sequence of the TNFRSF13B gene is shown as SEQ ID NO. 1.
[0067] In the implementation of the application, the application includes application of the TNFRSF13B gene in negatively regulating expression of the GLUT4 gene and / or the PPARG gene; or the application includes application of the TNFRSF13B gene in negatively regulating expression of the LPL gene; NCBI GenBank accession numbers of the GLUT4 gene, the PPARG gene and the LPL gene are GeneID: 442992, GeneID: 443513 and GeneID: 443408 respectively.
[0068] In order to further illustrate the application, the application of the TNFRSF13B gene in regulating the adaptability of Hu sheep to a drought environment is described in detail below with reference to the drawings and examples, but they should not be understood as limiting the protection scope of the application.
[0069] In the application, the sample is obtained from a Hu sheep fetus at 100-130 days, from a Hu sheep slaughterhouse in Wuhan City, Hubei Province, and is put into 1% double-antibody-containing 37 DEG C physiological saline, and is transported back to the laboratory within 2 hours.
[0070] In the application, the reagents and consumables used are: anhydrous ethanol from the National Medicine Group Chemical Reagent Co., Ltd., dimethylbenzene from the National Medicine Group Chemical Reagent Co., Ltd., BSA from Solaybao Technology Co., Ltd., PBS buffer from Wuhan Bolif Biological Technology Co., Ltd., DAPI dye from Wuhan Bolif Biological Technology Co., Ltd., fluorescence quenching mounting agent from Wuhan Bolif Biological Technology Co., Ltd., and primary antibody / secondary antibody from Thermo.
[0071] In the application, the instruments used are: a CO2 incubator from Sanyo, an ultra-clean bench from Hadonglian, a PCR instrument from BIO RAD, an inverted microscope from Olympus, an automatic cell counter from Ruisheng Biological Technology Co., Ltd., an embedding machine from Wuhan Junjie Electronics Co., Ltd., a dehydration machine from Wuhan Junjie Electronics Co., Ltd., a pathological section machine from Leica Instrument Co., Ltd., a freezing table from Wuhan Junjie Electronics Co., Ltd., a tissue slice machine from Jinhua Kedi Instrument Equipment Co., Ltd., a glass slide / cover glass from Jiangsu Shetai Experimental Equipment Co., Ltd., a decoloring shaker from Jiangsu Xinkang Medical Instrument Co., Ltd., a vortex mixer from SCILOGEX, and a flow cytometer from Thermo.
[0072] All reagents, instruments and materials selected in the present application are well known in the art, but do not limit the implementation of the present application, and other reagents and devices well known in the art can be suitable for the implementation of the following embodiments of the present application.
[0073] Example 1: Transcriptional analysis of Hu sheep in Hetian area of Xinjiang Uygur Autonomous Region and Taihu area
[0074] Select Hu sheep in Hetian area of Xinjiang Uygur Autonomous Region and Taihu area, 6 in each area, and perform transcriptional analysis on the whole blood of 12 Hu sheep, screen out 107 differentially expressed genes, perform interaction analysis on the encoded proteins by String online analysis tool, and then screen Hub genes by using CytoHubba plug-in in Cytoscape, screen by degree score, find that 38 genes can interact Figure 1 ), of which IGF2, EFNA4, HPD, ALDH1A1 and TNFRSF13B are related to metabolism, SMAD6, CYP2E1, CYP2D6, AGT and NECTIN2 are related to immunity, and TNFRSF13B is located in the center of the network, and has interaction relationship with a variety of proteins (metabolism and immunity related gene regulated proteins).
[0075] Example 2: Expression difference analysis of TNFRSF13B gene of Hu sheep in different areas
[0076] For the key genes screened out in the transcriptional analysis in Example 1, the expression amount of the tissue is detected, first, the RNA in the liver tissue is extracted, and the specific steps are as follows:
[0077] (1) Take the collected liver tissue sample out of the-80℃ refrigerator and quickly transfer it to a sterilized mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind the tissue with a pestle, add liquid nitrogen while grinding until it is ground into powder, transfer the ground powder sample to a 1.5mL centrifuge tube without enzyme, add 1mL Trizol, and mix well with a vortex shaker to fully lyse the sample, repeatedly blow and suck with a pipette gun, and stand at room temperature for 5min.
[0078] (2) Add 200μL of chloroform per tube, shake up and down for 30s. Incubate at room temperature for 2-3min, centrifuge at 12,000g (4℃, 15min).
[0079] (3) After centrifugation, the liquid is divided into three layers (the colorless water sample is the RNA in the upper layer, the white cream sample is the DNA in the middle layer, and the red organic bottom layer is the protein), carefully pipette the upper layer RNA into a new sterile EP tube.
[0080] (4) Add equal volume of isopropanol (about 500 μL), mix well, incubate at 15-30 ℃ for 10-30 min, centrifuge at 12,000 g (4 ℃, 10 min). Note: If after adding equal volume of isopropanol, sealed with PE gloves on the test tube rack, placed in the 4 ℃ refrigerator, the precipitation is better after 30 min.
[0081] (5) Discard the supernatant, add 1 ml of 75% ethanol aqueous solution to the precipitate, vortex vigorously for 30 s, centrifuge at 7,500 g (4 ℃, 5 min).
[0082] (6) Carefully remove the supernatant, and the precipitate in the tube is blown dry in the clean bench for 3-5 min. Preferably, the supernatant is removed by suction with a gun.
[0083] (7) Add 20 μL DEPC water to dissolve, aliquot 5 μL / tube, and store in a -80 ℃ refrigerator.
[0084] Then the primer sequence of the gene is designed, the qPCR primer is designed by Primer premier 6, and the primer sequence details are shown in Table 1. The β-actin gene is used as an internal reference, and the relative expression amount of each gene in the liver tissue is calculated by the method of 2-△△CT.
[0085] Table 1 Primer sequence
[0086]
[0087] Among them, the reverse transcription system is as shown in Table 2.
[0088] Table 2 Reverse transcription system
[0089]
[0090] The qRT-PCR reaction system is as shown in Table 3.
[0091] Table 3 qRT-PCR reaction system
[0092] (1) qPCR Master Mix 10 μL (2) cDNA 1 μL (3) F-primer upstream primer 0.5 μL (4) R-primer downstream primer 0.5 μL (5) ROX 0.1 μL (6) Nuclease-free Water 7.9 μL Total 20 μL
[0093] The amplification conditions of qRT-PCR are as follows: 95 ℃, 2 min; 95 ℃, 5 s, 60 ℃, 30 s, 72 ℃, 30 s, 40 cycles; 72 ℃, 5 min.
[0094] The expression amount of the TNFRSF13B gene in the liver tissue of Hu sheep in two regions is counted, which is expressed in the liver tissue of Hu sheep, and the expression in the liver of Hu sheep in different regions is different, among which the expression amount of TNFRSF13B in Hetian region is extremely significantly lower than that in Taihu region ( Figure 2 ), indicating that the liver metabolic function of Hu sheep in the arid Hetian region has changed.
[0095] Example 3: Whole genome methylation analysis of Hu sheep in Hetian region of Xinjiang Uygur Autonomous Region and Taihu region
[0096] Blood samples were collected from Hu sheep in the two regions, and whole genome methylation was performed. The genomic DNA of peripheral blood of Hu sheep in different regions was extracted according to the instructions of the blood sample DNA extraction kit. The DNA purity was detected by Nano Drop 2000 (OD260 / 280>1.80), and the DNA concentration was determined by Qubit2.0. The DNA was treated with bisulfite conversion using EZ DNA Methylation-Gold kit, and Lambda phage DNA was added to evaluate the conversion efficiency. The genomic DNA was broken to 300-500 bp using Covaris S220, the ends were repaired and connected to sequencing adapters, and the DNA library was generated by PCR amplification. The library was quantified by Qubit2.0, the insert size was detected by Agilent2100, and finally the library was detected by fluorescent quantitative PCR. The samples that passed the quality control were treated according to the concentration and sequencing requirements, and then sequenced using the Hiseq2500 platform (Beijing Baimaikexun Technology Co., Ltd.). After obtaining the raw data, fastp software was used for quality control filtering to obtain Clean Data. Bsmap software was used to align Clean Data with the sheep reference genome (ARS_UI_Ramb_v3.0) and perform bioinformatics analysis. The sorted bam file was de-redundant using sambamba software. After obtaining the de-redundant alignment results, MethylDackel was used to extract methylation sites. Then metilene software was used to identify differentially methylated regions (DMR, s differentially methylated regions). After sequencing and quality control, 619.11G of Cleanbases data was obtained, and the percentage of CleanData of all samples was more than 79.91%. The average alignment efficiency with the reference genome was about 70.80%, and the Q30 value was between 96.63% and 97.37%, indicating that the sequencing quality was good and suitable for subsequent bioinformatics analysis. The genome coverage of all samples was more than 98.71%, indicating high data quality. Whole genome methylation difference analysis was performed on the peripheral blood of Hu sheep in Taihu region and Hetian region. There were 5745 regions with higher methylation level in Hetian region than in Taihu region, and the difference regions were distributed in 2076 corresponding genes. There were 29,996 regions with lower methylation level in Hetian region than in Taihu region, and the difference regions were distributed in 5247 corresponding genes. Joint analysis of the methylation level of the methylation region related genes and the expression level of the corresponding transcriptome differential genes found that TNFRSF13B gene was highly methylated and down-regulated.
[0097] Example 4: Immunofluorescence identification of liver cells of Hu sheep
[0098] Cell separation and culture: Cells were seeded in 12-well plates coated with tail collagen at 2 x 10 5 cells per well, and cultured at 37°C in 50 mL / L CO2. WME containing 100 mL / L FBS was used as the complete culture medium for liver cells of Hu sheep. When the cell density reached about 80%, the cells were subcultured. The steps were as follows: the old culture medium was discarded, and the cells were washed with PBS containing double antibodies for 3 times; 400 μL of 0.25% trypsin containing EDTA was added for 3 min, and after the cells were rounded, the culture dish was gently tapped to suspend the cells, and twice the volume of culture solution was added and mixed by blowing. Half of the suspension was aspirated and inoculated into a new culture bottle, which was then observed under a microscope and placed in a culture box for continuous culture.
[0099] Immunofluorescence preparation:
[0100] (1) Liver cells of Hu sheep were seeded in 12-well plates at 2.5 x 10 5 cells per well, and cultured in a constant temperature (37°C) cell culture box for 24 h;
[0101] (2) When the cell confluence reached 70%, the old culture medium was aspirated, and the adherent cells were washed with PBS slowly for 3 times, and fixed with 4% paraformaldehyde for 15 min, and washed with PBS for 3 times, 5 min each time;
[0102] (3) The cells were fixed with 4°C cold paraformaldehyde for 20 min, and washed with PBS for 3 times, 3 min each time;
[0103] (4) Permeated with 0.2% Triton X-100 for 10 min, and washed with PBS for 3 times, 3 min each time;
[0104] (5) Blocked with BSA for 30 min, and washed with PBS for 3 times, 3 min each time;
[0105] (6) Added the first antibody, and incubated in a 4°C wet box overnight, and washed with PBS for 3 times, 3 min each time;
[0106] (7) Added the second antibody, and incubated at 37°C for 90 min, and washed with PBS for 3 times, 3 min each time;
[0107] (8) Added DAPI staining solution at room temperature in the dark, and incubated for 10 min, and aspirated the DAPI, and washed with PBS for 3 times;
[0108] (9) Observed the cells and took pictures using a fluorescence microscope.
[0109] CK18 immunofluorescence was used for identification. CK18 positive staining was localized in the cell nucleus, while the cytoplasm emitted red fluorescence. DAPI staining showed that the cell nucleus appeared blue and oval. Figure 3 The presence of these cells indicates that the adherent cells are hepatocytes.
[0110] Example 5: Glycogen staining identification of sheep liver cells
[0111] Hepatocytes, as the site of glycogen synthesis and storage, can be stained light red to dark red by PAS, the cytoplasm is stained purplish-red, and the nucleus is stained blue, indicating that these cells can synthesize glycogen, thus identifying the isolated cells as hepatocytes. Figure 4 ).
[0112] Example 6: Design and transfection of siRNA in Hu sheep liver cells
[0113] Based on the known TNFRSF13B (XM_042255769.2) gene sequence of Hu sheep in the NCBI database, and following the principles of siRNA design, three pairs of siRNA precursor oligonucleotide sequences targeting the TNFRSF13B gene were designed and synthesized using Invitrogen's online design tool (Table 4). The steps are as follows:
[0114] ① 24 hours after transfection, hepatocytes were seeded into 12-well plates to achieve 80% cell confluence. 2 hours before transfection, the medium was changed to serum-free medium.
[0115] ② Dilute the plasmid with 100 μL of serum-free opti-MEM, 0.2 μg per well, and gently mix with a pipette tip. Let stand at room temperature for 5 min.
[0116] ③ Before use, gently mix Lipofectamine™ 2000, then take 5 μL of Lipofectamine™ 2000 and dilute it in 100 μL of opti-MEM, and let it stand at room temperature for 5 min;
[0117] ④ Mix Lipofectamine™ 2000 and the plasmid dilution (total volume 200 μL), mix gently and let stand at room temperature for 20 min;
[0118] ⑤ Add 200 μL of the mixture to each culture well. Change the medium after 6 hours and use qPCR to detect the transfection efficiency.
[0119] Table 4 Sequence of the TNFRSF13B gene targeting Hu sheep
[0120] Name Target sequence (5'-3') siTNFRSF13B-1 CAGUUGCCGCGAAGAGCAAGG (SEQ ID NO. 2) siTNFRSF13B-2 CAAGGAUGAUUGGAUGGAAGC (SEQ ID NO. 3) siTNFRSF13B-3 GCGGGAUCGAGGUGGUGUACA (SEQ ID NO. 4)
[0121] Example 7: Detection of interference efficiency of siRNA
[0122] The 3 siRNA (siTNFRSF13B-1, siTNFRSF13B-2, siTNFRSF13B-3) interference sequences in Example 6 were transfected for 48 h, and the liver cells of Hu sheep were collected. The expression of TNFRSF13B gene was detected by qRT-PCR (refer to Table 1 in Example 2). The 3 siRNA interference sequences can interfere with the expression of TNFRSF13B gene, among which, siTNFRSF13B-2 has the highest interference efficiency, and the inhibition rate is greater than 76% (P < 0.01). siTNFRSF13B-2 was selected for subsequent experiments. Figure 5
[0123] The detection steps of qRT-PCR are as follows:
[0124] 1) Dissolve the Mix at 4℃, gently invert up and down, mix well and centrifuge briefly.
[0125] 2) Prepare the reaction solution in Table 5 on ice.
[0126] Table 5 PCR reaction system
[0127]
[0128] 3) Centrifuge the reaction tube briefly to ensure that all the reaction solution is at the bottom of the reaction well.
[0129] 4) Perform the reaction by using a three-step method program (Table 6):
[0130] Table 6 PCR reaction program
[0131]
[0132]
[0133] Example 8: Effect of TNFRSF13B gene on proliferation of Hu sheep liver cells
[0134] (1) Take the Hu sheep liver cells in logarithmic growth phase and in good condition, adjust the density to 5×10 4 / mL, inoculate into 96-well plates, 100 μL of cell suspension per well, set a blank group, and culture at 37℃ overnight, and add 100 μL of sterile PBS around the cell well.
[0135] (2) Divide the cells in step (1) into 3 groups: PC group (control group): Hu sheep liver cells; siNC group: Hu sheep liver cells + empty load; siTNFRSF13B group: Hu sheep liver cells + siTNFRSF13B-2, 9 replicate wells per group, and culture at 37℃ for 24 h.
[0136] (3) After the end of culture, 10 μL CCK-8 was added to each well, and the cells were cultured at 37°C for 4 h;
[0137] (4) The OD 450 value of each well was determined by an enzyme-labeled instrument.
[0138] (5) The absorbance of cells at 48 h after infection was detected by a CCK-8 kit, and the cell proliferation was detected.
[0139] The results showed that the cell proliferation activity of the liver cells of Hu sheep was significantly enhanced after the liver cells were interfered by siTNFRSF13B. Figure 6 ).
[0140] Example 9: Effect of TNFRSF13B gene on the cell cycle of Hu sheep liver cells
[0141] After the cells in the interference group in Example 8 were treated for 48 h, the liver cells were trypsinized for 3 min without EDTA, centrifuged to collect the liver cells, washed twice with pre-cooled PBS (1000 r / min, 5 min), and then the cells were fixed with pre-cooled 70% ethanol, and incubated at 4°C overnight. After fixation, the cells were washed twice with pre-cooled PBS, and then 500 μL of PI / RNase solution was added, and the cells were incubated at room temperature for 15 min in the dark. The flow cytometry was used for detection, and at least 20,000 cells were counted each time, and finally the ModFit software was used for analysis of the cell cycle. The results of flow cytometry showed that the distribution of the cell cycle was significantly changed. The G0 / G1, S and G2 / M periods of the control group were 68.29±3.22%, 21.17±0.98% and 10.55±0.85%, respectively; and the G0 / G1, S and G2 / M periods of the interference group were 47.11±2.18%, 39.97±1.17% and 12.92±0.96%, respectively. Compared with the control group, the proportion of cells in the G0 / G1 period (cell resting period and pre-DNA synthesis period) of the interference group was significantly reduced, the proportion of cells in the S period (DNA synthesis period) was significantly increased, and the proportion of cells in the G2 period was not significantly different (Table 7).
[0142] Table 7: Effect of TNFRSF13B gene on the cell cycle of Hu sheep liver cells
[0143] Group G0 / G1 (%) S(%) G2 / M (%) Control group 68.29±3.22 21.17±0.98 10.55±0.85 Interference group 47.11±2.18* 39.97±1.17* 12.92±0.96
[0144] Example 10: Effect of TNFRSF13B gene on the apoptosis of Hu sheep liver cells
[0145] After the cells in the interference group in Example 8 were treated for 48 h, the liver cells were labeled by Annexin V-FITC / PI double staining, and the specific operation was as follows:
[0146] (1) After the cells were treated for 48 h, the cells were trypsinized for 3 min without EDTA, and then the trypsinization was terminated by adding serum-containing culture medium, and the cells were transferred into a 5 mL centrifuge tube and centrifuged at 1000 g for 5 min;
[0147] (2) Wash the cells twice with PBS, centrifuge at 1000 r / min for 5 min, and discard the supernatant;
[0148] (3) Add 500 μL of 1×BindingBuffer to suspend the cells, add 5 μL of Annexin V-FITC and 5 μL of PI, mix well and react at room temperature in the dark for 15 min, and detect by flow cytometry within 1 h.
[0149] The results showed that after interfering with the expression of the TNFRSF13B gene, Annexin V-FITC / PI staining was performed, as shown in the figure. Figure 7 The detection results distinguished apoptotic cells (early and late apoptosis), normal living cells, and necrotic cells. The apoptosis rates of the control group and the interference group were 7.23±0.21% and 2.67±0.36%, respectively. The apoptosis rate of the interference group was significantly lower than that of the control group.
[0150] Example 11: Expression of related genes and proteins after interfering with the TNFRSF13B gene
[0151] (1) WB
[0152] The cells isolated and cultured in Example 4 were washed three times with pre-cooled PBS. 100 μl of RIPA lysis buffer (containing PMSF) was added to each culture well. After incubation at 4°C for 30 min, the cells were collected with a scraper. The lysate was collected by centrifugation at 12,000 rpm and then analyzed by Western blotting.
[0153] (2) qPCR gene expression verification
[0154] The effects of different expression levels of the TNFRSF13B gene on the expression levels of metabolism-related genes (GLUT4, PPARG, FASN, and LPL) and apoptosis genes (BCL-2, BAX, P53, and CASP3) were detected using qPCR. Primers were designed using AlleleID 6.0 software based on the gene sequences published in Gene Bank. The primer sequences are shown in Table 8. The PCR reaction system and reaction procedure were the same as in Example 2.
[0155] Table 8 Primer sequences
[0156]
[0157]
[0158] (3) Expression of apoptosis-related genes and proteins in hepatocytes of Hu sheep
[0159] After interfering with the expression of TNFRSF13B gene, BCL2 gene was significantly highly expressed, while the expression of BAX, P53 and CASP3 genes was relatively reduced, and the high expression of BCL2 gene protected the cells from apoptosis acceleration. Figure 8 )。
[0160] (4) Expression of genes and proteins related to liver cell metabolism after interfering with TNFRSF13B gene in Hu sheep
[0161] After interfering with the expression of TNFRSF13B gene, the expression of GLUT4 and PPARG genes and their proteins was significantly higher than that of the control group, and the expression of LPL gene and its protein was significantly lower than that of the control group, indicating that the decrease of TNFRSF13B gene expression led to the increase of the lipid synthesis ability and glucose uptake ability of Hu sheep liver cells and the decrease of the lipid decomposition ability Figure 9 )。
[0162] Therefore, it is proved that TNFRSF13B gene is a key candidate gene for Hu sheep to adapt to the dry environment, and the low expression model of TNFRSF13B gene is successfully constructed to verify its function. ① After interfering with the expression of TNFRSF13B gene, the cell proliferation activity was significantly enhanced; the cell cycle was changed, the proportion of G0 / G1 phase cells was significantly reduced, the proportion of S phase cells was significantly increased, and the apoptosis rate was significantly reduced; ② After interfering with the expression of TNFRSF13B gene, the expression of lipid synthesis related gene PPARG and glucose metabolism related gene GLUT4 and their proteins was significantly increased, and the expression of lipid decomposition metabolism related gene LPL and its protein was significantly reduced, indicating that the lipid synthesis and glucose metabolism ability of Hu sheep liver cells was enhanced, and in order to adapt to the dry environment in Hetian area, Hu sheep in Hetian area must improve the cell activity, enhance the ability of liver cells to synthesize lipids, at the same time, the energy storage ability of Hu sheep in Hetian area is enhanced, in order to better adapt to the dry environment in Hetian area.
[0163] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and people can also obtain other embodiments according to the present embodiments without creativity, and these embodiments all belong to the protection scope of the present application.
Claims
1. TNFRSF13B Application of the gene in regulating the adaptability of Lake sheep to drought environment, the gene TNFRSF13B The CDS sequence of the gene is shown as SEQ ID NO.
1. The application comprises negative regulation TNFRSF13B Application of the gene in improving the adaptability of Hu sheep to drought environment; the negative regulation comprises knockdown or knockdown.
2. Negative regulation TNFRSF13B The application relates to application of a reagent of a gene in improving the adaptability of a lake sheep to a drought environment. TNFRSF13B The CDS sequence of the gene is shown in SEQ ID NO. 1; the negative regulation comprises knockdown or knockdown.
3. Use according to claim 2, characterized in that, The negative regulation TNFRSF13B The reagents include TNFRSF13B siRNA precursor oligonucleotides of the genes The TNFRSF13B The siRNA precursor oligonucleotides of the gene include si TNFRSF13B -1、si TNFRSF13B -2 and si TNFRSF13B At least one of -3; the Si TNFRSF13B -1、si TNFRSF13B -2 and si TNFRSF13B The nucleotide sequences of -3 are shown in SEQ ID NO.2 to SEQ ID NO.4, respectively.
Citation Information
Patent Citations
Marker related to Hu sheep muscle cell proliferation and detection primer and application thereof
CN116144790A
SNP (Single Nucleotide Polymorphism) molecular marker related to dry and wet environment adaptability of sheep and application thereof
CN119410791A