A primer combination and kit for detecting trehalose positive pasteurella multocida, pasteurella multocida, and haemolytic manheimia haemolytica

Abstract

The application discloses a primer combination and a kit for detecting trehalose Bipartite Pasteurella, Pasteurella multocida and hemolytic Mannheimia, and belongs to the technical field of pathogenic microorganism detection. The application aims to improve the sensitivity and specificity of detection of trehalose Bipartite Pasteurella, Pasteurella multocida and hemolytic Mannheimia. The application provides a primer combination for detecting trehalose Bipartite Pasteurella, Pasteurella multocida and hemolytic Mannheimia, wherein the primer combination is primer pair 1, primer pair 2 and primer pair 3; the primer pair 1 is shown in SEQ ID NO. 1 and SEQ ID NO. 2, the primer pair 2 is shown in SEQ ID NO. 4 and SEQ ID NO. 5, and the primer pair 3 is shown in SEQ ID NO. 7 and SEQ ID NO. 8. The detection method is very stable in batch-to-batch repeatability and batch repeatability, and is suitable for large-scale clinical detection.

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology, specifically relating to a primer combination and kit for detecting trehalose biberstein bacillus, pasteurellosis malignant, and hemolytic mansonia. Background Technology

[0002] Trehalose-Biberstanbacterium ( Bibersteinia trehalosi, B. trehalosi Pasteurella multocida ( ) Pasteurella multocida, P. multocida ) and hemolytic Mansonia ( Mannheimia haemolytica, M. haemolytica All three are Gram-negative short bacilli belonging to the Pasteurella family. They are the main bacterial pathogens causing fatal pneumonia and septicemia in ruminants (cattle, goats, and sheep, etc.). When the host's immune resistance is weakened due to poor feeding conditions, long-distance transportation, sudden environmental changes, or other stressors, the three pathogens can rapidly proliferate and overcome the host's immune barrier, causing infection. In respiratory infection cases, affected animals may exhibit coughing, difficulty breathing, and increased nasal discharge, and may even die; in systemic infections, the bacteria can spread throughout the body via the bloodstream, causing septicemia and multiple organ dysfunction, ultimately leading to death. Currently, B. trehalosi, P. multocida and M. haemolytica Diagnostic methods for respiratory diseases in cattle and sheep mainly include pathogen isolation and conventional PCR, but these methods have significant limitations, primarily in sensitivity, specificity, and pathogen content determination. Furthermore, since the three pathogens cause similar clinical symptoms, separate testing is time-consuming and labor-intensive. Therefore, a detection method capable of simultaneously detecting all three pathogens with high sensitivity and specificity is urgently needed to address these issues, providing technical support for the prevention and control of respiratory diseases in cattle and sheep and safeguarding the healthy development of the livestock industry. Summary of the Invention

[0003] The purpose of this invention is to improve the sensitivity and specificity of detecting trehalose-bibsteinella, Pasteurella multocida, and hemolytic Mansonia.

[0004] This invention provides a method for detecting trehalose-bibstein bacteria (TBI). Bibersteinia trehalosi Pasteurella multocida ( ) Pasteurella multocida ), hemolytic Mansonia ( Mannheimia haemolytica The primer pair is primer pair 1, primer pair 2 and primer pair 3; primer pair 1 is shown in SEQ ID NO.1 and SEQ ID NO.2, primer pair 2 is shown in SEQ ID NO.4 and SEQ ID NO.5, and primer pair 3 is shown in SEQ ID NO.7 and SEQ ID NO.8.

[0005] To further specify, primer pair 1 amplifies the nucleic acid molecule shown in SEQ ID NO. 10.

[0006] Further specifying, primer pair 2 amplifies the nucleic acid molecule shown in SEQ ID NO. 11.

[0007] Further specifying, primer pair 3 amplifies the nucleic acid molecule shown in SEQ ID NO. 12.

[0008] This invention provides a kit for detecting *Trebrospinal spp.*, *Pasteurella multocida*, and *Mannella hemolytica*, the kit comprising the aforementioned primer pairs.

[0009] Furthermore, the concentration of the primer pair was limited to 10 μM.

[0010] Further specifying, the kit also includes probe combinations as shown in SEQ ID NO.3, SEQ ID NO.6 and SEQ ID NO.9; SEQ ID NO.3 is a probe for primer pair 1, SEQ ID NO.6 is a probe for primer pair 2 and SEQ ID NO.9 is a probe for primer pair 3.

[0011] Furthermore, the concentration of the primer pair was limited to 10 μM.

[0012] Further specifying, the kit also includes 2xOne Stepu Mix, One StepU Enzyme MIX, ROX II reference dye, positive control, and negative control.

[0013] Further specified, the positive control for *Trebrospinal trehalose* is a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO. 10, the positive control for *Pasteurella multocida* is a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO. 11, and the positive control for *Mannial leucocytogenes* is a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO. 12; the negative control is water.

[0014] This invention provides the application of the above-mentioned primer pair in the preparation of a kit for identifying Trehalobacterium bishopstan, Pasteurella multocida, and Mansonia hemolytica.

[0015] Beneficial effects: (1) The present invention can simultaneously detect within a single reaction system. B. trehalosi, P. multocida and M. haemolytica The detection of three pathogens significantly shortens the detection time, improves detection efficiency while saving costs, and has good application prospects.

[0016] (2) The detection primer set of the present invention is for B. trehalosi, P. multocida and M. haemolyticaConserved gene sequences were designed, and the primer set was used to detect Haemophilus hirudinea, Salmonella, Clostridium perfringens, Escherichia coli K99, and Mycoplasma caprineis subsp. caprineis. No bands were amplified in any of them, indicating that the primer set has high specificity.

[0017] (3) The present invention relates to B. trehalosi, P. multocida and M. haemolytica It has high detection sensitivity and is effective for bacterial genomes. B. trehalosi , P. multocida, M. haemolytica It can reach 10 copies / μL. For bacterial culture detection, this invention is effective. B. trehalosi, P. multocida and M. haemolytic The minimum detectable bacterial concentrations for a are 9.2 cfu / mL, 7.8 cfu / mL, and 9.6 cfu / mL.

[0018] (4) The detection method of the present invention is significantly superior to the conventional PCR method, and improves the sensitivity of detection.

[0019] (5) The detection method of the present invention has stable inter-batch and intra-batch repeatability, and is suitable for large-scale clinical testing. Attached Figure Description

[0020] Figure 1 for B. trehalosi Amplification curve results of singleton quantitative PCR;

[0021] Figure 2 for P. multocida Amplification curve results of singleton quantitative PCR;

[0022] Figure 3 for M. haemolytica Amplification curve results of singleton quantitative PCR;

[0023] Figure 4 for B. trehalosi The standard curve results of singlet quantitative PCR;

[0024] Figure 5 for P. multocida The standard curve results of singlet quantitative PCR;

[0025] Figure 6 for M. haemolytica The standard curve results of singlet quantitative PCR;

[0026] Figure 7 This is a graph showing the results of triple PCR amplification.

[0027] Figure 8 This is a graph showing the results of the triple PCR standard curve.

[0028] Figure 9This is a graph showing the results of specific detection by triple quantitative PCR. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are now described clearly and completely. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] Experimental materials:

[0031] The plasmid extraction kit was the Gene JET Plasmid Mini prep Kit (Thermo Scientific), the gel extraction kit was the Gene JET Gel Extraction Kit (Thermo Scientific), the DNA extraction kit was the EasyPureViral DNA / RNA Kit (ER201) purchased from Beijing TransGen Biotech Co., Ltd., and the HiScripto II U OneStep qRT-PCR Probe Kit (Q223) purchased from Novizan Biotechnology Co., Ltd.

[0032] Example 1.

[0033] 1.1 Primer and probe design.

[0034] Based on genome sequences indexed in GenBank, MegAlign was used for sequence alignment analysis to select... B. trehalosi The gene shown in SEQ ID NO.10, P. multocida The gene shown in SEQ ID NO.11 M. haemolytica The target gene is shown in SEQ ID NO. 12. Further comparison of the target gene sequence determined the candidate region of the gene sequence to be amplified. Then, quantitative PCR amplification primers were designed based on the determined gene sequence, and probe primers were designed in the middle of the designed amplification primers. The quantitative PCR primers and probes were synthesized by Harbin Ruiboxingke Biotechnology Co., Ltd., and their sequences are as follows:

[0035] Table 1 Primer and probe sequences

[0036]

[0037] 1.2 Preparation of plasmid standards.

[0038] (1) Amplification of the target fragment

[0039] Bacterial genome was extracted using the EasyPure Viral DNA / RNA Kit. Using the bacterial genome as a template, the target fragment was amplified using the primers listed above in a 10 μL PCR system (5 μL 2×Taq PCR Mix, 1 μL each of 10 mM forward and reverse primers, 1 μL bacterial DNA, and 2.7 μL ddH2O). The amplification conditions were: 95℃ for 5 min; 95℃ for 30 s, 53℃ for 30 s, 72℃ for 30 s, for 35 cycles; 72℃ for 10 min; 4℃ for 30 min. After amplification, the PCR products were analyzed by 1% agarose gel electrophoresis, and the target fragment was purified using a gel extraction kit.

[0040] B. trehalosi The target fragment sequence for amplification is "SEQ ID NO.10:

[0041] AGAAAGGTAATGAGCCAAGAATAACAAGAGTCAACTTCGGACTGTAATACCACATCACGGCAAAGAAGATAAAAGAGAATAATAAATCTAGAACAGAAGTTAATGCTTGC;

[0042] P. multocida The amplified target fragment sequence is "SEQ ID NO.11:

[0043] GAGTGGGCTTGTCGGTAGTCTTTTAATTGGCTTGTGGCAAAGAAAAGCACAGTTTTGTTGGGCGGAGTTTGGTGTGTTGAGCCAATCTGCTTCCTTGACAACGGCGCAACTGATTGGACGTTATTTATTACTCAGCTTATTGTTATTTGCCGG;

[0044] M. haemolytica The target fragment sequence for amplification is

[0045] "SEQ ID NO. 12: AGCGACTACTCGTGTTGGTTCAGGCTGGGCGTGGTTAGTATTAGAAGAGGGTAAATTAGCCGTTGTTTCAACCGCTAACCAGGACAACCACTAATGGGTAAAGAAGTGGCAGGCGTTTCAGGCTATCCGATTTTAGTCTT.

[0046] (2) Connection transformation

[0047] The recovered gel product was ligated into the pMD18-T vector (TaKaRa), and the ligation product was added to DH5α competent cells (ice bath for 30 min; heat shock at 42℃ for 90 s; ice bath for 2 min). The bacterial culture was transferred to antibiotic-free LB medium and cultured with shaking at 37℃ and 200 rpm for 45 min. 50 μL of the bacterial culture was evenly spread on LB agar plates containing ampicillin and incubated overnight at 37℃.

[0048] (3) Screening and identification of positive clones

[0049] Single colonies were picked from LB agar plates and added to 5 mL of ampicillin-resistant LB medium. The culture was incubated at 37°C and 200 rpm for 12 h with shaking. Using the corresponding primers, bacterial PCR was performed for verification (amplification of the target fragment), followed by sequencing. Plasmids were extracted using a plasmid DNA mini-extraction kit. The correctly identified positive recombinant plasmids were named pMD-Bt, pMD-Pm, and PMD-Mh. Plasmid concentrations were measured using a NanoDrop instrument. The concentrations of the pMD-Bt, pMD-Pm, and PMD-Mh recombinant plasmids were 431 ng / μL, 316.8 ng / μL, and 283.7 ng / μL, respectively. The copy numbers of the recombinant plasmids were calculated to be 1.40 × 10⁻⁶. 11 Copy / μL, 1.02×10 11 Copies / μL, 9.13 × 10 10 Copies / μL were used as plasmid standards.

[0050] The formula for calculating the copy number is as follows: Copy number = plasmid concentration × 6.02 × 10⁻⁶ 23 / (660×total plasmid length).

[0051] 1.3 Single-pair quantitative PCR method.

[0052] DNA was extracted from the samples using the EasyPure Viral DNA / RNA Kit. Real-time PCR was performed using the HiScripto II U OneStep qRT-PCR Probe Kit. The reaction mixture consisted of 10 μL of water, 2.7 μL of 2×One StepUMix, 1 μL of One StepU Enzyme MIX, 0.2 μL each of forward and reverse primers, 0.2 μL of probe, 0.2 μL of ROX II reference dye, and 1 μL of template. The PCR program was: 95℃ for 5 min; 95℃ for 10 s; 53℃ for 30 s, for 45 cycles.

[0053] To plot the standard curve for singlet quantitative PCR amplification, the plasmid standard was serially diluted 10-fold (using 10... 1 10 2 10 3 10 4 10 5 10 6 10 7 Amplification was performed using copies / μL (7 dilutions) as template, with a negative control included. The reaction was conducted on an Applied Biosystems QuantStudio 5 real-time quantitative PCR instrument, and amplification curves were obtained. The correlation coefficient R was analyzed using software. 2 They are: 1.000 ( B.trehalosi ), 0.996 ( P.multocida ), 0.998 ( M. haemolytica The amplification efficiencies were all greater than 90%, exhibiting good linearity and meeting the requirements of the standard curve (R²). 2 >0.99), the amplification curves of the three pathogens and the established standard curves are as follows: Figures 1 - Figures 6 As shown. The linear equation between the obtained copy number (x) and the Ct value (y) is:

[0054] B. trehalosi Y = -3.256 log(X) + 39.761 R 2 = 1.000 Eff% = 102.818%,

[0055] P. multocida Y = -3.445log(X) + 39.565 R 2 =0.996 Eff%=95.097%,

[0056] M. haemolytica Y = -3.220log(X) + 41.068 R 2 =0.998 Eff%=104.437%.

[0057] 1.4 Triple Real-Time PCR Method.

[0058] Real-time PCR was performed using the HiScripto II U One Step qRT-PCR Probe Kit. The reaction mixture consisted of 20 μL of water, 3.5 μL of water, 10 μL of 2×One StepU Mix, 1 μL of One StepU Enzyme MIX, 0.2 μL each of BtL-F, Bt-R, and Bt-P, 0.4 μL each of Pm-F, Pm-R, and Pm-P, 0.4 μL each of Mh-F and Mh-P, 0.5 μL of Mh-R, 0.4 μL of ROX II reference dye, and 2 μL of template. The triplet real-time PCR program was: 95℃ for 5 min, 95℃ for 10 s, 53℃ for 30 s, for 45 cycles.

[0059] To plot the standard curve for triplet real-time PCR amplification, the three prepared plasmid standards were serially diluted 10-fold. B.trehalosi, P.multocida, M.haemolytica Take a concentration range of 10 7 -10 1 After copy / μL, quantitative real-time PCR amplification was performed, and recombinant plasmid standards were prepared at a concentration of 10. 7 -10 1 Fluorescent signals can be detected at a copy number / μL. Analyzing the data using the system's automated software allows for the creation of a standard curve for quantitative PCR, plotted with the logarithm of the copy number on the ordinate and the Ct value on the x-axis. The results are shown below. Figure 7 and Figure 8 As shown, where Figure 7 The amplification curves are for three plasmids. Figure 8 The graph shows the standard curves for three plasmids. As can be seen from the graph, B. trehalosi, P. multocida, M. haemolytica In 10 7 -10 1 The amplification efficiency of standards constructed in the range of copies / μL was greater than 90%, and the correlation coefficient R was [missing value]. 2 All values ​​were above 0.99, indicating a good linear relationship between the starting template number and Ct value for various standards.

[0060] The linear equation between the resulting copy number (x) and the Ct value (y) is as follows:

[0061] B. trehalosi Y = -3.361log(X) + 40.663 R 2 =0.996 Eff%=98.391%,

[0062] P. multocida Y = -3.318log(X) + 40.486 R 2 =1.000 Eff%=100.177%,

[0063] M. haemolytica Y = -3.438log(X) + 42.459 R 2 =0.999 Eff%=95.393%

[0064] Sensitivity test:

[0065] Will B. trehalosi, P. multocida, M. haemolytica Bacterial culture was serially diluted 10-fold and triple quantitative PCR was performed, with a detection limit as low as 9.2 CFU / mL. B.trehalosi 7.8 cfu / mL P. multocida 9.6 cfu / mL M. haemolytica Conventional PCR has only recently been able to detect concentrations up to 330.8 cfu / mL. B. trehalosi 810.7 cfu / mL P. multocida 420.7 cfu / mL M. haemolytica Therefore, the sensitivity of triple quantitative PCR is 34-104 times that of conventional PCR.

[0066] Three plasmid standards were serially diluted 10-fold and triplet quantitative PCR was performed. The results are shown below. B. trehalosi , P.multocida, M.haemolytica Ten copies were detected in both. These results indicate that... B. trehalosi , P. multocida and M. haemolytica Triple real-time PCR has high sensitivity and can be used for clinical sample testing.

[0067] Specificity test:

[0068] use B. trehalosi, P. multocida and M. haemolytica The standard was used as a positive control, and Haemophilus neonatorum (Haemophilus neonatorum) was used as a positive control. Histophilus of sleep ),salmonella( Salmonella Clostridium perfringens ( ) Clostridium penetrating ), Escherichia coli K99 ( Escherichia coli K99), Mycoplasma caprine pneumonia subspecies ( Mycoplasma capricolum subsp. caprepneumonia DNA was extracted from samples containing water and used as templates for quantitative real-time PCR. Based on the established optimal reaction conditions, quantitative real-time PCR amplification was performed, and the results are as follows: Figure 9 As shown, the amplification curves of the three standards were detected separately, while no amplification curves were observed for other pathogens and the negative control, indicating that the method has good specificity.

[0069] Repeatability test:

[0070] Will B. trehalosi, P. multocida, M. haemolyticaThe recombinant plasmid was serially diluted 10-fold and then mixed in equal proportions to obtain three concentration gradients (final concentrations of 10, ... 6 copies / μL, 10 4 copies / μL, 10 2 A plasmid mixture of (copy / μL) was used, with water as a negative control. The established quantitative real-time PCR method was used for three repeated detections to perform intra-group repeatability tests. Inter-group repeatability tests were performed on the same concentration of standards diluted at three different time points. The results were statistically analyzed to evaluate the repeatability of the method, and the results are shown in Table 2. Table 2 shows that the intra-group coefficient of variation was less than 3%, and the inter-group coefficient of variation was less than 2%, indicating that the multiplex quantitative real-time PCR method established in this invention has good repeatability.

[0071] Table 2. Repeatability results of multiplex quantitative PCR

[0072]

[0073] Example 2. Clinical Sample Testing

[0074] The established triplet quantitative PCR method was used to detect 590 clinical sheep respiratory disease samples collected from 5 regions. DNA was extracted from the samples using the EasyPure Viral DNA / RNA Kit, and quantitative PCR was performed using the HiScripto II U One Step qRT-PCR Probe Kit. The reaction mixture consisted of 20 μL of water, 3.5 μL of water, 10 μL of 2×One StepU Mix, 1 μL of One StepU Enzyme MIX, 0.2 μL each of BtL-F, Bt-R, and Bt-P, 0.4 μL each of Pm-F, Pm-R, and Pm-P, 0.4 μL each of Mh-F and Mh-P, 0.5 μL of Mh-R, 0.4 μL of ROX II reference dye, and 2 μL of template. The triplet quantitative PCR reaction program was: 95℃ for 5 min, 95℃ for 10 s, 53℃ for 30 s, for 45 cycles. After analyzing the amplification curves and Ct values ​​of quantitative real-time PCR, the results are shown in Table 3. The three pathogens were prevalent in all five regions. B. trehalose The highest positive rate was observed in the affected sheep flocks in Ningxia, reaching 34%. P. multocida The highest positive rate was observed in the affected sheep flocks in Henan, reaching 28.89%. ;M. haemolytica The positive rate was highest in sheep flocks affected in Xinjiang, reaching 18.89%. In Xinjiang and Ningxia, the combined positive rates of the three pathogens were the highest, reaching 60% in affected sheep flocks, indicating that the pathogen prevalence in these two regions was more severe than in other regions.

[0075] Table 3. Clinical sample test results from different regions

[0076]

[0077] The quantitative real-time PCR method in this invention is 34-104 times more sensitive than conventional PCR, and the detection time is shorter. More importantly, the triple quantitative real-time PCR method can simultaneously detect three major bacterial pathogens in the respiratory tract of cattle and sheep, making it suitable for high-throughput rapid diagnosis.

Claims

1. A primer combination for detecting Pasteurella trehalosi (P. trehalosi) Bibersteinia trehalosi , Pasteurella multocida (P. multocida) Pasteurella multocida and Mannheimia haemolytica (M. haemolytica) Mannheimia haemolytica , characterized in that The primer combination is primer pair 1, primer pair 2 and primer pair 3; primer pair 1 is shown as SEQ ID NO. 1 and SEQ ID NO. 2, primer pair 2 is shown as SEQ ID NO. 4 and SEQ ID NO. 5, and primer pair 3 is shown as SEQ ID NO. 7 and SEQ ID NO.

8. ​​​​​​ 2. A kit for detecting Bibersteinia trehalosi, Pasteurella multocida and Mannheimia haemolytica, characterized in that, The kit comprises the primer combination of claim 1.

3. The kit of claim 2, wherein The kit further comprises a probe combination, such as shown as SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9; SEQ ID NO. 3 is the probe for primer pair 1, SEQ ID NO. 6 is the probe for primer pair 2, and SEQ ID NO. 9 is the probe for primer pair 3.

4. The kit of claim 3, wherein The concentrations of the upstream and downstream primers of the primer pair are each 10 μM.

5. The kit of claim 3, wherein The kit further comprises positive and negative controls; the positive control for Bibersteinia trehalosi is a recombinant vector containing the nucleic acid molecule shown as SEQ ID NO. 10, the positive control for Pasteurella multocida is a recombinant vector containing the nucleic acid molecule shown as SEQ ID NO. 11, and the positive control for Mannheimia haemolytica is a recombinant vector containing the nucleic acid molecule shown as SEQ ID NO. 12; the negative control is water.

6. Use of the primer combination of claim 1 in the preparation of a kit for identifying Bibersteinia trehalosi, Pasteurella multocida and Mannheimia haemolytica.

Images