InDel molecular marker closely linked with fruit color main effect QTL (quantitative trait loci) in green and ripe stage of white pepper, primer group and application
By developing InDel molecular markers and primer groups with closely linked QTL fruit color in the brunt of white pepper, the problems of green color and poor appearance quality of white pepper fruit are solved, and the QTL sites related to fruit color are quickly screened, which enhances the market competitiveness and commodity value of white pepper.
Patent Information
- Application Number
- CN202510264249.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-06
- Publication Date
- 2025-05-27
AI Technical Summary
In the long-term cultivation and breeding of existing white pepper varieties, the appearance quality is poor, the fruit color is green, which seriously affects the value of the commodity. There are few new varieties of high-quality white peppers, which limits the independent development of the white pepper industry.
The InDel molecular marker and primer group of the main effect QTL of the juicy white pepper was developed, and the fruit color genotype was identified through PCR amplification technology, and the main effect QTL sites closely linked to the fruit color of the juicy white pepper were accurately screened.
The main QTL sites related to the fruit color of white peppers in the blissful period have been quickly and accurately screened out, which has accelerated the breeding progress and enhanced the market competitiveness and commodity value of white peppers.
Smart Images
Figure CN120041602A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to InDel molecular markers, primer sets and applications closely linked to the major QTL of the fruit color at the green mature stage of white pepper. Background Art
[0002] Pepper (Capsicum spp.), as an annual or perennial plant of the genus Capsicum in the Solanaceae family, is the world's largest spice crop and the world's third largest vegetable crop. Since 2016, the planting area of peppers in China has been stable at over 2.1 million hectares (hm 2 ), with an agricultural output value of up to 250 billion yuan, becoming the vegetable with the largest planting area and the highest output value. With the continuous development of the economy and the improvement of consumers' living standards, consumers pay more and more attention to the safety, nutrition and quality of peppers, manifested in the pursuit of green, nutritious and healthy while paying more attention to the appearance color and taste flavor, so the high quality and high price are prominent in the consumer market.
[0003] As a special type of pepper, white pepper is favored for its unique spicy flavor and taste, and is an indispensable condiment and table ingredient in many famous and special fine foods. The application range of white pepper is wide, such as pickled or pickled into sour peppers, fermented into fermented white peppers, and directly used as a dipping sauce for fresh food. Its unique fruit color and flavor add special charm to the dishes. However, as the most intuitive appearance quality index of white pepper, the fruit color directly determines the level of its commercial value.
[0004] At present, in the long-term cultivation and breeding of local white pepper varieties, the variety characteristics have degenerated seriously, the appearance quality is poor, and the fruit color is greenish, which seriously affects the commercial value. The lack of new high-quality white pepper varieties suitable for making dipping sauces and pickling also restricts the independent development of the white pepper industry in China.
[0005] Therefore, in-depth understanding of the genetic law of the fruit color at the green mature stage of white pepper and the development of related molecular marker technologies are of great significance for improving the appearance quality of white pepper, increasing its commercial value, and accelerating the breeding of new white pepper varieties. As a modern breeding means, molecular marker technology can accurately and quickly locate the genetic loci closely linked to the target traits, providing a powerful tool for crop genetic improvement. Especially InDel molecular markers, due to their advantages of high polymorphism, good stability, simple operation, etc., have been widely used in crop genetic breeding.
[0006] In summary, the development of InDel molecular markers, primer sets and their applications closely linked to the major QTL of the fruit color at the green mature stage of white pepper has an urgent demand and important significance for promoting the sustainable and healthy development of the white pepper industry in China, enhancing the market competitiveness and commercial value of white pepper. Summary of the Invention
[0007] The object of the present invention is to overcome the deficiencies in the prior art and provide InDel molecular markers, primer sets and applications that are closely linked to the major QTL for fruit color at the green-ripe stage of white pepper.
[0008] To achieve the above object, the technical solution provided by the present invention is as follows:
[0009] An InDel molecular marker closely linked to the major QTL for fruit color at the green-ripe stage of white pepper, including M22 molecular marker and M28 molecular marker; the M22 molecular marker is located at 7474576 bp on chromosome 10. When the nucleotide sequence shown in SEQ ID NO.1 is inserted here, it indicates that the sample contains the major QTL of white pepper; the M45 molecular marker is located at 8255322 bp on chromosome 10. When the nucleotide sequence shown in SEQ ID NO.2 is deleted here, it indicates that the sample contains the major QTL of white pepper.
[0010] The present invention also provides a primer set for detecting the above InDel molecular marker, including primer M22-F and primer M22-R for detecting the M22 molecular marker, and also including primer M28-F and primer M28-R for detecting the M28 molecular marker; the nucleotide sequence of the primer M22-F is as shown in SEQ ID NO.3, the nucleotide sequence of the primer M22-R is as shown in SEQ ID NO.4, the nucleotide sequence of the primer M28-F is as shown in SEQ ID NO.5, and the nucleotide sequence of the primer M28-R is as shown in SEQ ID NO.6.
[0011] The present invention also provides a reagent or kit containing the above primer set.
[0012] The application of the above InDel molecular marker in assisting the identification of fruit color at the green-ripe stage of white pepper also belongs to the protection scope of the present invention.
[0013] The application of the above primer set, reagent or kit containing the primer set in assisting the identification of fruit color at the green-ripe stage of white pepper also belongs to the protection scope of the present invention.
[0014] The present invention also provides a method for identifying the fruit color at the green-ripe stage of white pepper, including the following steps:
[0015] (1) Extract the genomic DNA of the sample to be tested;
[0016] (2) Perform PCR amplification on the genomic DNA of the sample to be tested using primer M22-F and primer M22-R, and primer M28-F and primer M28-R respectively;
[0017] (3) Analyze the size of the PCR amplification product. When the gene fragment of 216 bp is amplified by primer M22-F and primer M22-R, it indicates that the fruit color at the mature green stage is white. When the gene fragment of 194 bp is amplified by primer M22-F and primer M22-R, it indicates that the fruit color at the mature green stage is green. When both the 216 bp and 194 bp gene fragments are amplified simultaneously, it indicates that the fruit color at the mature green stage is an intermediate color between green and white;
[0018] When the gene fragment of 181 bp is amplified by primer M28-F and primer M28-R, it indicates that the fruit color at the mature green stage is white. When the gene fragment of 202 bp is amplified by primer M28-F and primer M28-R, it indicates that the fruit color at the mature green stage is green. When both the 2029 bp and 181 bp gene fragments are amplified simultaneously, it indicates that the fruit color at the mature green stage is an intermediate color between green and white.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] By using the InDel molecular markers and primer sets provided by the present invention, the major QTL loci tightly linked to the fruit color at the mature green stage of white pepper can be accurately and quickly screened out, accelerating the breeding progress, thereby guiding the breeding work of new white pepper varieties and enhancing the market competitiveness and commercial value of white pepper.
[0021] Drawings of the specification
[0022] Figure 1 For F 2 Fruit color at the mature green stage of the segregating population;
[0023] Figure 2 Amplification results of polymorphic primers between parents; In the figure, M is DL2000 marker, and U8-D4 is the polymorphic primer;
[0024] Figure 3 For the genetic linkage map;
[0025] Figure 4 Verification of the application of molecular marker M22 and M28 genotyping in materials with different fruit colors; In the figure, P1: white female parent; P2 green male parent; M: DL2000 marker; Wp: white single-plant mixed pool; Gp: green single-plant mixed pool; 1-8: white preferred small population; 9-16 green preferred small population. Detailed implementation manners
[0026] The following is a detailed description in combination with specific implementation manners, but it should be understood that the protection scope of the present invention is not limited by the specific implementation manners. The raw materials and actuals used in the examples are all commercially available unless otherwise specified.
[0027] Example 1 Development of InDel Molecular Markers for the Fruit Color of White Pepper
[0028] Step 1, Population Construction and Genetic Analysis
[0029] Using white and green chili pepper inbred lines as parents, hybridize to obtain F 1 , F 1 The fruit color at the green mature stage is light green. The constructed F 2 segregating population shows continuous segregation of different colors such as white, yellowish green, and green at the green mature stage (see Figure 1 ). By combining the method of color difference meter and visual inspection to identify the fruit color of the segregating population at the green mature stage, and dividing the fruit color by the L value with a larger variation range. The results show that the L value shows a continuous change trend in the range of 45.53 - 90.31. The larger the L value, the whiter the fruit color. It can be seen that this trait is controlled by quantitative traits. Among the 462 F 2 plants identified in the population, the ratio of green fruits to white fruits at the green mature stage is 359:103. After χ2 test (χ2 = 1.80, χ20.05,1 = 3.84), the segregation ratio conforms to the segregation ratio of 3:1, indicating that the white fruit color at the green mature stage of chili pepper is controlled by 1 recessive QTL with a larger effect value
[0030] Step 2, Preliminary Mapping of QTL for the Fruit Color of White Pepper at the Green Mature Stage Based on GradedPool-seq
[0031] Using white (Z1536) and green (ZG14-1) chili pepper inbred lines as parents, on the basis of obtaining a large-scale F 2 population, accurately identify the fruit color of the F 2 segregating population at the green mature stage by combining the method of visual inspection and color difference meter. Divide it into 3 obvious subgroups according to the fruit color: green, yellowish green, and white. Select 50 individual plants with similar brightness, red-green value, and yellow-blue value (Lab value) from each subgroup to construct a subgroup mixed pool according to the measurement results of the color difference meter. Resequence the parents and the 3 subgroup mixed pools. The reference genome version is: solgenomics_C.annuum_zunla. Based on the Ridit algorithm, compare the SNP difference significance among the 3 subgroups, obtain the P value of each SNP, judge the correlation between SNP and fruit color, and locate the major QTL for the fruit color of white pepper at the green mature stage in the interval of Chr10:2399999 - 10500000, a total of 8.1M
[0032] Step 3, Genetic Map Construction and Fruit Color QTL Mapping Analysis
[0033] A total of 66 pairs of primers were designed for the homozygous differential InDel sites between parents within the initial mapping interval on chromosome 10 and within 1 - 2 M on both sides. The PCR reaction system was 10 μL, among which the primers were: 0.4 μL, mix 5 μL, DNA 0.8 μL, ddH 2 O 3.4 μL. The PCR reaction conditions were: denaturation at 95°C for 3 min, 95°C for 15 s, 55°C for 15 s, 72°C for 30 s, with 35 amplification cycles, and finally a final extension at 72°C for 5 min. 3 μL of loading buffer was added to the amplification products, and electrophoresis was carried out on an 8% polyacrylamide gel at a constant voltage of 150 v for 70 minutes. After silver staining and color development, photographs were taken. Using 10 pairs of polymorphic high-quality primers screened from the parents (see Figure 2 ), the genotypes of individual plants in a population of 190 F 2 were detected. Using the QTL IciMapping software, the mapping parameters were set as a step size of 1.0 cM, a probability of 0.001, and an LOD threshold of 3. The inclusive composite interval mapping method (ICIM-ADD) was used to construct a genetic map for the genotype and L value phenotypic data of the 190 F 2 population (see Figure 3 ). The results showed that there was a significant QTL locus between markers M22 and M28, with an LOD value of 25.86, which could explain 47.59% of the phenotypic variation, and the additive effect was 7.7496. The M22 molecular marker was located at 7474576 bp on chromosome 10, and the M45 molecular marker was located at 8255322 bp on chromosome 10.
[0034] Among them, the nucleotide sequences of the primers M22-F, M22-R for amplifying marker M22 and the primers M28-F, M28-R for amplifying marker M28 are shown in Table 1.
[0035] Table 1 Primer nucleotide sequences
[0036] Primer name Nucleotide sequence Sequence number M22-F CAATTGCACACAGACATGGG SEQ ID NO.3 M22-R TTTGGATTTTACTATGGAGTTGAAA SEQ ID NO.4 M28-F TTTGAACTAGGAGAAGTGAGGGA SEQ ID NO.5 M28-R TTGCAACAAGGAAAATATCTGG SEQ ID NO.6
[0037] Example 2 Verification of the application of molecular markers M22 and M28 genotyping in different fruit color materials
[0038] Twenty samples each of white and green pepper materials at the green-ripe stage were selected from the F 2:3 population to construct mixed pools. At the same time, 8 individual plants each from the white and green preferred small populations were selected, and DNA was extracted using the CTAB method. Amplification was carried out using the primers M22-F and M22-R, M28-F and M28-R respectively. The amplification products were electrophoresed on an 8% non-denaturing polyacrylamide (PAGE) gel. The results are as Figure 4 shown.
[0039] The results showed that primers M22-F and M22-R, M28-F and M28-R could amplify a 216bp and an 181bp fragment band respectively in the white pool and its preferred small population single plants, and this band was consistent with the white parent band, indicating that this material contained the major QTL of white pepper. Primers M22-F and M22-R, M28-F and M28-R could amplify a 194bp, a 202bp fragment band or two fragment bands respectively in the green pool and its preferred small population. Among them, single plant 13 in the preferred small population amplified two bands, indicating that this single plant contained a heterozygous genotype.
[0040] Comparing the 216bp and 194bp fragments amplified by M22-F and M22-R, a nucleotide sequence with a size of 22bp was inserted into the 194bp fragment (as shown in SEQ ID NO.1).
[0041] Comparing the 202bp and 181bp fragments amplified by M28-F and M28-R, a nucleotide sequence with a size of 21bp was deleted from the 202bp fragment (as shown in SEQ ID NO.2).
[0042] The position of the major gene detected by the molecular markers developed in this application is clear and the identification is convenient. By detecting the molecular markers closely linked to this gene, the fruit color of white pepper can be identified at an early stage. Its detection method is rapid and convenient and is not affected by the environment.
[0043] The foregoing description of specific exemplary embodiments of the invention is for purposes of illustration and exemplification. These descriptions are not intended to limit the invention to the precise forms disclosed, and obviously, many modifications and variations are possible in light of the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the invention and its practical applications, so that those skilled in the art can implement and utilize various different exemplary embodiments of the invention as well as various different selections and modifications. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. An InDel molecular marker tightly linked to a major QTL for fruit color in the green and ripe stage of white pepper, characterized in that: The InDel molecular markers include M22 molecular markers and M28 molecular markers; The M22 molecular marker is located at 7474576 bp on chromosome 10. When the nucleotide sequence shown in SEQ ID NO.1 is inserted therein, it indicates that the sample contains the major effect QTL of white pepper; The M28 molecular marker is located at 8255322 bp on chromosome 10. When the nucleotide sequence shown in SEQ ID NO. 2 is missing here, it indicates that the sample contains the major effect QTL of white pepper.
2. A primer set for detecting the InDel molecular marker according to claim 1, characterized in that: It includes primers M22-F and primer M22-R for detecting the M22 molecular marker, and also includes primers M28-F and primer M28-R for detecting the M28 molecular marker; the nucleotide sequence of the primer M22-F is shown in SEQ ID NO.3, the nucleotide sequence of the primer M22-R is shown in SEQ ID NO.4, the nucleotide sequence of the primer M28-F is shown in SEQ ID NO.5, and the nucleotide sequence of the primer M28-R is shown in SEQ ID NO.
6.
3. A reagent or kit comprising the primer set according to claim 2.
4. Use of the InDel molecular marker described in claim 1 in assisting the identification of the fruit color of white peppers at the green and ripe stage.
5. Use of the primer set described in claim 2 in assisting the identification of the fruit color of white pepper at the green and ripe stage.
6. Use of the reagent or kit according to claim 3 in assisting identification of the fruit color of white peppers at the green and ripe stage.
7. A method for identifying the fruit color of white pepper at the green and ripe stage, characterized in that: The following steps are involved: (1) extracting genomic DNA from the sample to be tested; (2) using the primers M22-F and M22-R, the primers M28-F and M28-R described in claim 2, respectively, to perform PCR amplification on the genomic DNA of the sample to be tested; (3) Analyze the size of the PCR amplified product. When primers M22-F and primers M22-R amplify a 216 bp gene fragment, it indicates that the fruit color in the green-ripening period is white. When primers M22-F and primers M22-R amplify a 194 bp gene fragment, it indicates that the fruit color in the green-ripening period is green. When both 216 bp and 194 bp gene fragments are amplified, it indicates that the fruit color in the green-ripening period is an intermediate color between green and white. When primer M28-F and primer M28-R amplify a gene fragment of 181bp, it indicates that the fruit color in the green-ripening period is white. When primer M28-F and primer M28-R amplify a gene fragment of 202bp, it indicates that the fruit color in the green-ripening period is green. When gene fragments of 181bp and 202bp are amplified at the same time, it indicates that the fruit color in the green-ripening period is an intermediate color between green and white.