Plant coenzyme q10 synthesis element for increasing plant coenzyme q10 synthesis level and application thereof

By using gene editing technology to mutate specific amino acid sequences of the plant Coq1 enzyme, a plant Q10 synthesis element was developed. This solved the problems of inaccurate coenzyme Q10 synthesis and biosafety in existing technologies, and enabled the efficient synthesis of coenzyme Q10 in plants, improving biosafety and application scope.

CN120051564BActive Publication Date: 2026-07-28SHANGHAI CHENSHAN BOTANICAL GARDEN +2
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI CHENSHAN BOTANICAL GARDEN
Filing Date
2024-08-01
Publication Date
2026-07-28

AI Technical Summary

Technical Problem

Existing technologies make it difficult to synthesize coenzyme Q10 in plants efficiently and precisely through genetic engineering, and transgenic methods pose biosafety risks.

Method used

By using gene editing technology to mutate specific amino acid sequences of plant Coq1 enzyme, plant Q10 synthesis elements were developed, which improved the coenzyme Q10 synthesis activity and avoided the biosafety issues of random gene transfer.

Benefits of technology

This technology enables the efficient synthesis of coenzyme Q10 in non-GMO plants, improving biosafety, enhancing public acceptance, and expanding its application scope.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120051564B_ABST
    Figure CN120051564B_ABST
Patent Text Reader

Abstract

The application discloses a plant Q10 synthesis element for significantly improving the synthesis level of plant coenzyme Q10 and application. Plants or recombination bacteria transformed by the plant Q10 synthesis element can synthesize coenzyme Q10. The plant Q10 synthesis element can be applied to the synthesis of coenzyme Q10 in non-transgenic plants such as rice, lettuce, cucumber, corn, wheat and sorghum, and can also be applied to the cultivation of transgenic crops, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This patent relates to the field of plant genetic engineering technology, and in particular to plant Q10 synthesis elements that improve the level of plant coenzyme Q10 synthesis. Background Technology

[0002] Coenzyme Q is a lipid-soluble terpenoid quinone compound widely distributed in organisms. As an electron carrier in the mitochondrial respiratory chain, it is essential for cellular energy production. The side chain of coenzyme Q typically consists of 6-10 isoprene units, with varying lengths among different species. Humans primarily synthesize coenzyme Q10, which has 10 isoprene units (C50) in its side chain, while some plants, including cereal crops such as rice, primarily synthesize coenzyme Q9, which has 9 isoprene units (C45) in its side chain.

[0003] Long-chain isopentenyltransferase Coq1 is a key enzyme in the coenzyme Q synthesis pathway, determining the number of isoprene units in the coenzyme Q side chain, i.e., the side chain length. It catalyzes the condensation reaction of isopentenyl pyrophosphate with an allyl acceptor to produce polyisoprene pyrophosphate. The product length varies among different Coq1 enzyme species.

[0004] The human body can synthesize coenzyme Q10, but its levels decline with age. For individuals deficient in coenzyme Q10, exogenous supplementation can improve symptoms to varying degrees. Therefore, coenzyme Q10 is one of the most consumed dietary supplements worldwide. While a regular diet is an important source of coenzyme Q10, major grain crops such as rice and wheat synthesize coenzyme Q9, not coenzyme Q10.

[0005] Because the mechanism of action of each site of the Coq1 enzyme was previously unknown, the only method for cultivating crop varieties that synthesize coenzyme Q10 was to use genetic engineering techniques to introduce the Coq1 gene, which is capable of synthesizing coenzyme Q10, from bacteria or eukaryotes into crops, thereby cultivating new transgenic crop varieties that synthesize coenzyme Q10. This transgenic technology involves the blind introduction of genes, with randomness throughout the entire process. Moreover, transgenic technology introduces exogenous DNA fragments that do not exist in the organism itself, and the biosafety needs to be tested. The Q10 synthesis element provided by this invention can be used to cultivate non-transgenic plants that synthesize coenzyme Q10, such as rice, lettuce, cucumber, corn, wheat, and sorghum. Summary of the Invention

[0006] The purpose of this invention is to provide a Q10 synthesis element (Q10SE, Q10synthase element) that can be achieved through gene editing, namely a long-chain isopentenyltransferase Coq1 mutant, which is derived from plants and, after editing and mutation, has the activity of synthesizing the coenzyme Q10 side chain.

[0007] In a first aspect, a plant Q10 synthetic element is provided that significantly improves the level of plant coenzyme Q10 synthesis. Compared with rice Coq1, the amino acid sequence of the plant Q10 synthetic element corresponds to the following mutations in rice Coq1: 1) mutation I / M240L / V / F / Y / C at position 240; 2) mutation A243V at position 243; 3) mutation I255M at position 255; 4) mutation S256T at position 256; 5) mutation K166D / E at position 166; mutation G245E at position 245; and / or 7) amino acid residues at positions 145-173 and 238-263 are replaced with the corresponding sequence of tomato Coq1, wherein the amino acid sequence of rice Coq1 is shown in SEQ ID NO. 1, and the amino acid sequence of tomato Coq1 is shown in SEQ ID NO. 69.

[0008] Furthermore, the amino acid sequence of the plant Q10 synthetic element is identical to or has at least 80%, 85%, 90%, 95%, 98%, or 99% homology to any of the following amino acid sequences: SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, SEQ ID NO.66, SEQ ID NO.67, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, SEQ ID NO.67.

[0009] Furthermore, the plant can be any one of rice, lettuce, cucumber, corn, and wheat.

[0010] Secondly, a coding gene is provided that encodes any of the aforementioned plant Q10 synthetic elements.

[0011] Furthermore, the base sequence of the above-mentioned encoding gene is identical to or has at least 80%, 85%, 90%, 95%, 98%, or 99% homology with any of the following base sequences: SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, SEQ ID NO.62, SEQ ID NO.64, SEQ ID NO.66, and SEQ ID NO. NO.68.

[0012] Thirdly, a vector containing the aforementioned coding genes is provided.

[0013] Fourthly, recombinant bacteria or recombinant cells containing the aforementioned vector are provided.

[0014] Fifthly, provide plant individuals, plant tissues, or plant cells containing the aforementioned genes.

[0015] Sixthly, a coenzyme Q10 extract is provided, which is extracted from the plant individuals, plant tissues or plant cells containing the aforementioned gene.

[0016] Seventhly, the application of any one of the above-mentioned plant Q10 synthesis elements in the cultivation of plants, microorganisms, and enzyme activation reaction systems that synthesize coenzyme Q10 is provided.

[0017] Furthermore, the above applications include: transforming a vector into a target plant, wherein the vector contains a gene encoding the Q10 synthetic element of the plant.

[0018] Furthermore, the above applications include: modifying the endogenous Coq1 gene of the target plant to encode the plant's Q10 synthetic element.

[0019] Furthermore, the above applications include: mutagenesis and screening of cells, tissues, individuals or populations of target plants to encode plant Q10 synthetic elements.

[0020] Furthermore, the target plants include plants of the Poaceae family, Solanaceae family, Cucurbitaceae family, Asteraceae family, Lamiaceae family, Amaryllidaceae family, Chenopodiaceae family, Amaranthaceae family, Malvaceae family, Araliaceae family, Asparagaceae family, etc.

[0021] Furthermore, the target plant is any one of the following: wheat, rice, barley, oats, corn, sorghum, water bamboo, millet, buckwheat, sorghum, sesame, sunflower, cucumber, zucchini, pumpkin, winter melon, bitter melon, loofah, cucumber, watermelon, cantaloupe, leek, scallion, onion, leek, spinach, lettuce, tomato, lettuce, garland chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, and kiwifruit.

[0022] The present invention has the following beneficial effects: The present invention provides a plant Q10 synthetic element that enables plants to synthesize Q10, based on the rice Coq1 synthesis of Q9. Compared to rice Coq1, the amino acid sequence of this plant Q10 synthetic element corresponds to the following mutations in rice Coq1: mutation I / M240L / V / F / Y / C at position 240, and / or mutation A243V at position 243, and / or mutation I255M at position 255, and / or mutation S256T at position 256, and / or mutation K166D / E at position 166, and / or mutation G245E at position 245. Mutations at position 240 and / or multiple mutations at these positions can enhance the activity of various plant Q10 synthetic elements in synthesizing coenzyme Q10 precursors while maintaining their own enzymatic catalytic activity. Compared to rice Coq1, the amino acid sequence of this plant Q10 synthesis element is obtained by replacing amino acid sequences corresponding to wild-type rice Coq1 in the wild-type plant Coq1 with those in tomato Coq1. Plants or recombinant bacteria transformed with the plant Q10 synthesis element provided by this invention can synthesize coenzyme Q10. This plant Q10 synthesis element can be used not only for synthesizing coenzyme Q10 in non-transgenic plants such as rice, lettuce, cucumber, corn, wheat, and sorghum, but also for the cultivation of transgenic crops, showing broad application prospects. Because gene editing technology is more precise than transgenic technology, it solves the problems of blindness and randomness associated with previous whole-gene transfer of Coq1. Compared with existing methods of transforming genes derived from microorganisms to synthesize coenzyme Q10, direct gene editing has more reliable biosafety, which is conducive to the promotion and application of new coenzyme Q10 synthesizing varieties and increases public acceptance.

[0023] References

[0024] 1. J. Wang, Z. He, G. Wang, R. Zhang, J. Duan, P. Gao, X. Lei, H.Qiu, C. Zhang, Y. Zhang, and H. Yin, Efficient targeted insertion of largeDNA fragments without DNA donors. Nat Methods, 2022. 19(3): p. 331-340.

[0025] 2. E. Weber, C. Engler, R. Gruetzner, S. Werner, and S. Marillonnet,A modular cloning system for standardized assembly of multigene constructs.PLoS One, 2011. 6(2): p. e16765.

[0026] 3. Yuan Zong, Yijing Liu, Chenxiao Xue, Boshu Li, Xiangyang Li,Yanpeng Wang, Ji Li, Guanwen Liu, Xingxu Huang, Xiaofeng Cao, and Caixia Gao,An engineered prime editor with enhanced editing efficiency in plants. Naturebiotechnology, 2022. 40(9): p. 1394-1402.

[0027] 4. Y. Y. Jiang, Y. P. Chai, M. H. Lu, X. L. Han, Q. Lin, Y. Zhang, Q.Zhang, Y. Zhou, X. C. Wang, C. Gao, and Q. J. Chen, Prime editing efficientlygenerates W542L and S621I double mutations in two ALS genes in maize. GenomeBiol, 2020. 21(1): p. 257.

[0028] 5. Michelle F. Richter, Kevin T. Zhao, Elliot Eton, AudroneLapinaite, Gregory A. Newby, BW Thuronyi, Christopher Wilson, Luke W.Koblan, Jing Zeng, Daniel E. Bauer, Jennifer A. Doudna, and David R. Liu, Phage-assisted evolution of an adenine base editor with improved Cas domaincompatibility and activity. Nature biotechnology, 2020. 38(7): p. 883-891. Attached Figure Description

[0029] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 The amino acid sequences of the eight synthetic elements OsA, OsB, OsC, OsD, OsE, OsF, OsG and wild-type rice Coq1 provided in embodiments A1-A7 of this invention are fully aligned. Figure 2 The amino acid sequences of the eight synthetic elements LsA, LsB, LsC, LsD, LsE, LsF of lettuce Q10, Coq1 of wild lettuce, and Coq1 of wild rice provided in embodiments B1-B6 of this invention are compared. Figure 3 The complete amino acid sequence alignment results of the four synthetic elements CsA and CsB of cucumber Q10, wild-type cucumber Coq1, and wild-type rice Coq1 provided in embodiments C1-C2 of the present invention; Figure 4 The results of coenzyme Q detection are as follows: empty vector control (VEC), wild-type rice Coq1 (OsCoq1), and rice Q10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG provided in Examples A1-A7 of this invention. Figure 5The results of coenzyme Q detection are as follows: empty vector control (VEC), Escherichia coli transformed with wild-type lettuce Coq1 (LsCoq1), and lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, and LsF provided in Examples B1-B6 of this invention. Figure 6 The results of coenzyme Q detection are as follows: empty vector control (VEC), Escherichia coli transformed with wild-type cucumber Coq1 (CsCoq1), and Escherichia coli with cucumber Q10 synthesis elements CsA and CsB provided in Examples C1-C2 of this invention; Figure 7 The results of coenzyme Q detection are shown for the six rice lines and wild-type rice plants (WT) that obtained OsE synthetic elements through gene editing provided in Experimental Example 4 of this invention. Figure 8 The amino acid sequence alignment results of the seven synthetic elements ZmA, ZmB, ZmC, ZmD, ZmE, wild-type maize ZmCoq1, and wild-type rice OsCoq1 provided in embodiments D1-D5 of this invention are as follows: Figure 9 The amino acid sequence alignment results of the seven synthetic elements TaA, TaB, TaC, TaD, TaE, wild wheat TaCoq1, and wild rice OsCoq1 provided in embodiments E1-E5 of this invention are as follows: Figure 10 The amino acid sequences of the following eight components are compared: rice Q10 synthesis elements OsH and OsI in Examples A8-A9 of this invention; maize Q10 synthesis element ZmF in Example D6; wheat Q10 synthesis element TaF in Example E6; wild rice Coq1; wild maize ZmCoq1; wild wheat TaCoq1; and wild tomato SlCoq1. Figure 11 The results of coenzyme Q detection are as follows: empty vector control (VEC), Escherichia coli transformed with wild-type maize ZmCoq1 and maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD and ZmE provided in Examples D1-D5 of this invention; Figure 12 The results of coenzyme Q detection are as follows: empty vector control (VEC), Escherichia coli transformed with wild-type wheat TaCoq1 and wheat Q10 synthesis elements TaA, TaB, TaC, TaD, and TaE provided in Examples E1-E5 of this invention; Figure 13 The results of coenzyme Q detection are shown for two lettuce lines (numbered 130 and 106) that obtained LsB synthetic elements through gene editing and a wild-type lettuce plant (WT) provided in Experimental Example 7 of the present invention. Figure 14The results of coenzyme Q detection were obtained for Escherichia coli that had been transferred into rice Q10 synthesis elements OsH and OsI provided in Examples A8-A9 of this invention and rice Q10 synthesis element OsE provided in Example A5. Figure 15 The results of coenzyme Q detection were obtained for Escherichia coli that had been transferred to the corn Q10 synthesis element ZmF provided in Example D6 and the corn Q10 synthesis element ZmE provided in Example D5 of this invention. Figure 16 The results of coenzyme Q detection were obtained for Escherichia coli that had been transferred to the wheat Q10 synthesis element TaF provided in Example E6 and the wheat Q10 synthesis element TaE provided in Example E5. Detailed Implementation

[0031] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook, J. & Russell, DW, 2001), or according to the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well-known to those skilled in the art.

[0032] The following is a detailed description of the plant Q10 synthetic element, its encoding gene, and its applications according to the present invention.

[0033] On the one hand, the plant Q10 synthetic element provided by the present invention has a mutation in its amino acid sequence corresponding to positions 240, and / or 243, and / or 255, and / or 256, and / or 166, and / or 245 of rice Coq1.

[0034] In other words, the amino acid sequence of the plant Q10 synthetic element provided by this invention is compared with the amino acid sequence of rice Coq1. The amino acid sequence of the plant Q10 synthetic element corresponds to the following mutations in rice Coq1: at position 240, amino acid residue M or I is mutated to L or V or F or Y or C; at position 243, amino acid residue A is mutated to V; at position 255, amino acid residue I is mutated to M; at position 256, amino acid residue S is mutated to T; at position 166, amino acid residue K is mutated to D or E; or at position 245, amino acid residue G is mutated to E.

[0035] Of course, the plant Q10 synthetic element provided by the present invention can also have various combinations of the above-mentioned mutations.

[0036] In other words, the plant Q10 synthetic element provided by this invention is obtained through the following mutation: (1) The amino acid sequence of wild-type plant Coq1 and rice Coq1 is compared. The amino acid residue M or I of wild-type plant Coq1 corresponding to rice Coq1 at position 240 is mutated to L or V or F or Y or C to obtain the plant Q10 synthesis element with the measurement activity of synthesizing coenzyme Q10 provided by the present invention. (2) Alternatively, the amino acid sequence of wild-type plant Coq1 and rice Coq1 is compared, and the amino acid residue A at position 243 of wild-type plant Coq1 corresponding to rice Coq1 is mutated to V to obtain the plant Q10 synthesis element with coenzyme Q10 synthesis activity provided by the present invention. (3) Alternatively, the amino acid sequence of wild-type plant Coq1 and rice Coq1 is compared, and the amino acid residue I corresponding to the 255th position of rice Coq1 in wild-type plant Coq1 is mutated to M to obtain the plant Q10 synthesis element with coenzyme Q10 synthesis activity provided by the present invention. (4) Alternatively, the amino acid sequence of wild-type plant Coq1 and rice Coq1 is compared, and the amino acid residue S corresponding to the 256th position of rice Coq1 in wild-type plant Coq1 is mutated to T to obtain the plant Q10 synthesis element with coenzyme Q10 synthesis activity provided by the present invention. (5) Alternatively, the amino acid sequence of wild-type plant Coq1 and rice Coq1 is compared, and the amino acid residue K of wild-type plant Coq1 corresponding to rice Coq1 is mutated to D or E to obtain the plant Q10 synthesis element with coenzyme Q10 synthesis activity provided by the present invention. (6) Alternatively, the amino acid sequence of wild-type plant Coq1 and rice Coq1 is compared, and the amino acid residue G at position 245 of wild-type plant Coq1 corresponding to rice Coq1 is mutated to E to obtain the plant Q10 synthesis element with coenzyme Q10 synthesis activity provided by the present invention. It should be noted that the mutation position of Coq1 in wild-type plants corresponds to that in rice Coq1, and the specific position in the Coq1 sequence in wild-type plants varies depending on the species origin.

[0037] Furthermore, in some embodiments of the present invention, the amino acid sequence of rice Coq1 is shown in SEQ ID NO.1.

[0038] The plant Q10 synthetic element provided by this invention is obtained by mutation of wild-type Coq1 from plants of the Poaceae, Solanaceae, Cucurbitaceae, Asteraceae, Lamiaceae, Amaryllidaceae, Chenopodiaceae, Amaranthaceae, Malvaceae, Araliaceae, and Asparagaceae families, particularly from wheat, rice, barley, oats, corn, sorghum, water chestnut, millet, buckwheat, sorghum, sesame, sunflower, cucumber, zucchini, pumpkin, winter melon, bitter melon, loofah, cucumber, watermelon, cantaloupe, leek, scallion, onion, leek, spinach, lettuce, tomato, lettuce, garland chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, and kiwifruit, with rice, lettuce, cucumber, wheat, and corn being preferred, as it retains the characteristics of plant origin. The gene encoding the plant's coenzyme Q10 synthesis element can be applied to cultivate the aforementioned crop varieties that synthesize coenzyme Q10. This can be achieved, for example, through gene editing, mutagenesis screening, or transgenic methods. Compared to existing methods of transforming genes derived from microorganisms to synthesize coenzyme Q10, direct gene editing offers more reliable biosafety, facilitates the promotion and application of new coenzyme Q10 synthesized varieties, and increases public acceptance.

[0039] Furthermore, the amino acid sequence of the plant Q10 synthetic element is identical to or has at least 80%, 85%, 90%, 95%, 98%, or 99% homology with any of the following amino acid sequences: SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54.

[0040] Among them, the Q10 synthetic elements shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13 were obtained by mutation of wild-type rice Coq1 (SEQ ID NO.1) from rice (Oryza sativa), and the mutation sites include: positions 240, 243, 255, 256, and 166 corresponding to rice Coq1 shown in SEQ ID NO.1.

[0041] For example, the rice Q10 synthetic element shown in SEQ ID NO.7 (named OsA) corresponds to position 240 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as M240L). The rice Q10 synthetic element shown in SEQ ID NO.8 (named OsB) corresponds to positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as M240L, A243V). The rice Q10 synthetic element shown in SEQ ID NO.9 (named OsC) corresponds to positions 240, 243, and 255 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as M240L, A243V, I255M). The rice Q10 synthetic element shown in SEQ ID NO.10 (named OsD) corresponds to positions 240, 243, 255 and 256 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as M240L, A243V, I255M, S256T). The rice Q10 synthetic element shown in SEQ ID NO.11 (named OsE) corresponds to positions 240, 243, 255, 256, and 166 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as M240L, A243V, I255M, S256T, K166D). The rice Q10 synthetic element shown in SEQ ID NO.12 (named OsF) corresponds to positions 240, 243, 255, 256, and 166 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as M240L, A243V, I255M, S256T, K166E). The rice Q10 synthetic element shown in SEQ ID NO.13 (named OsG) corresponds to positions 243, 255, 256 and 166 of wild-type rice Coq1 (SEQ ID NO.1) (this mutation can also be represented as A243V, I255M, S256T, K166D). Among them, the Q10 synthetic elements shown in SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19 were obtained by mutation of wild-type lettuce Coq1 (SEQ ID NO.3) from lettuce (Lactuca sativa), and the mutation sites include positions 240 and 243 corresponding to rice Coq1 shown in SEQ ID NO.1.

[0042] For example, the lettuce Q10 synthetic element shown in SEQ ID NO.14 (named LsA) has a mutation I240L at position 240 of wild-type rice Coq1 (SEQ ID NO.1), which corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO.3) (this position can also be represented as I221(240)L). The lettuce Q10 synthetic element shown in SEQ ID NO.15 (named LsB) has a mutation I240V at position 240 of wild-type rice Coq1 (SEQ ID NO.1), and this position corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO.3) (this position can also be represented as I221(240)V). The lettuce Q10 synthetic element shown in SEQ ID NO.16 (named LsC) has a mutation I240F at position 240 of wild-type rice Coq1 (SEQ ID NO.1) and at position 221 of wild-type lettuce Coq1 (SEQ ID NO.3) (this site can also be represented as I221(240)F). The lettuce Q10 synthetic element shown in SEQ ID NO.17 (named LsD) has a mutation I240Y at position 240 of wild-type rice Coq1 (SEQ ID NO.1), which corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO.3) (this position can also be represented as I221(240)Y). The lettuce Q10 synthetic element shown in SEQ ID NO.18 (named LsE) has a mutation I240C at position 240 of wild-type rice Coq1 (SEQ ID NO.1), which corresponds to position 221 of wild-type lettuce Coq1 (SEQ ID NO.3) (this position can also be represented as I221(240)C). The lettuce Q10 synthetic element shown in SEQ ID NO.19 (named LsF) has a mutation I240L and A243V at positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO.1), and the same site corresponds to positions 221 and 224 of wild-type lettuce Coq1 (SEQ ID NO.3) (this site can also be represented as I221(240)L, A224(243)V). Among them, the Q10 synthetic element shown in SEQ ID NO.20 and SEQ ID NO.21 was obtained by mutation of wild-type cucumber Coq1 (SEQ ID NO.5) from cucumber (Cucumissativus), and the mutation site includes position 240 corresponding to rice Coq1 shown in SEQ ID NO.1.

[0043] For example, the cucumber Q10 synthetic element shown in SEQ ID NO.20 (named CsA) has a mutation I240L at position 240 of wild-type rice Coq1 (SEQ ID NO.1), which corresponds to position 233 of wild-type cucumber Coq1 (SEQ ID NO.5) (this position can also be represented as I233(240)L). The cucumber Q10 synthetic element shown in SEQ ID NO.21 (named CsB) has a mutation I240V at position 240 of wild-type rice Coq1 (SEQ ID NO.1), and this position corresponds to position 233 of wild-type cucumber Coq1 (SEQ ID NO.5) (this position can also be represented as I233(240)V). Among them, the Q10 synthetic elements shown in SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, and SEQ ID NO.42 are obtained by mutation of wild-type maize Coq1 (SEQ ID NO.37) from maize (Zea mays), and the mutation sites include: positions 240, 243, 255, 256, and 166 corresponding to rice Coq1 shown in SEQ ID NO.1.

[0044] For example, the maize Q10 synthetic element shown in SEQ ID NO.38 (named ZmA) has a mutation M240L at position 240 of wild-type rice Coq1 (SEQ ID NO.1), which corresponds to position 238 of wild-type maize Coq1 (SEQ ID NO.37) (this position can also be represented as M238(240)L; The maize Q10 synthetic element shown in SEQ ID NO.39 (named ZmB) has a mutation M240L and A243V at positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 238 and 241 of wild-type maize Coq1 (SEQ ID NO.37) (this site can also be represented as M238(240)L, A241(243)V). The maize Q10 synthetic element shown in SEQ ID NO.40 (named ZmC) has a mutation at positions 240, 243 and 255 of wild-type rice Coq1 (SEQ ID NO.1), with the mutations M240L, A243V and I255M. This site corresponds to positions 238, 241 and 253 of wild-type maize Coq1 (SEQ ID NO.37). (This site can also be represented as M238(240)L, A241(243)V, I253(255)M.) The maize Q10 synthetic element shown in SEQ ID NO.41 (named ZmD) has a mutation at positions 240, 243, 255 and 256 of wild-type rice Coq1 (SEQ ID NO.1), namely M240L, A243V, I255M, S256T. This site corresponds to positions 238, 241, 253 and 254 of wild-type maize Coq1 (SEQ ID NO.37). (This site can also be represented as M238(240)L, A241(243)V, I253(255)M, S254(256)T.) The maize Q10 synthetic element shown in SEQ ID NO.42 (named ZmE) has mutations M240L, A243V, I255M, S256T, and K166 at positions 240, 243, 255, 256, and 166 of wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 238, 241, 253, 254, and 164 of wild-type maize Coq1 (SEQ ID NO.37). (This site can also be represented as M238(240)L, A241(243)V, I253(255)M, S254(256)T, and K164(166)D.) The Q10 synthetic elements shown in SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, and SEQ ID NO.54 were obtained by mutation of wild-type wheat Coq1 (SEQ ID NO.49) from wheat (Triticum aestivum), with mutation sites including positions 240, 243, 245, 256, and 166 corresponding to positions 240, 243, 245, 256, and 166 of rice Coq1 shown in SEQ ID NO.1.

[0045] For example, the wheat Q10 synthetic element shown in SEQ ID NO.50 (named TaA) has a mutation M240L at position 240 of wild-type rice Coq1 (SEQ ID NO.1), which corresponds to position 236 of wild-type wheat Coq1 (SEQ ID NO.49) (this position can also be represented as M236(240)L; The wheat Q10 synthetic element shown in SEQ ID NO.51 (named TaB) has a mutation M240L and A243V at positions 240 and 243 of wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 236 and 239 of wild-type wheat Coq1 (SEQ ID NO.49) (this site can also be represented as M236(240)L, A239(243)V). The wheat Q10 synthetic element shown in SEQ ID NO.52 (named TaC) has a mutation at positions 240, 243, and 245 of wild-type rice Coq1 (SEQ ID NO.1), namely M240L, A243V, and G245E. This site corresponds to positions 236, 239, and 241 of wild-type wheat Coq1 (SEQ ID NO.49). (This site can also be represented as M236(240)L, A239(243)V, G241(245)E.) The wheat Q10 synthetic element shown in SEQ ID NO.53 (named TaD) has mutations M240L, A243V, G245E, and S256T at positions 240, 243, 245, and 256 of wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 236, 239, 241, and 252 of wild-type wheat Coq1 (SEQ ID NO.49). (This site can also be represented as M236(240)L, A239(243)V, G241(245)E, and S252(256)T. The wheat Q10 synthetic element shown in SEQ ID NO.54 (named TaE) has mutations M240L, A243V, G245E, S256T, and K166D at positions 240, 243, 245, 256, and 166 of wild-type rice Coq1 (SEQ ID NO.1). This site corresponds to positions 236, 239, 241, 252, and 162 of wild-type wheat Coq1 (SEQ ID NO.49). (This site can also be represented as M236(240)L, A239(243)V, G241(245)E, S252(256)T, and K162(166)D.) Compared to wild-type rice Coq1 (SEQ ID NO.1), wild-type lettuce Coq1 (SEQ ID NO.3), wild-type cucumber Coq1 (SEQ ID NO.5), wild-type maize Coq1 (SEQ ID NO.37), and wild-type wheat Coq1 (SEQ ID NO.49), the following types of Coq1 have a single mutation at position 240 of rice Coq1 where amino acid residue M or I is changed to L, V, F, Y, or C, or simultaneously have mutations at positions 240 and 243, 255, 256, 166, and 245, such as SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.14. The plant Q10 synthesis elements shown in NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, and SEQ ID NO.54 all have coenzyme Q10 synthesis activity. Escherichia coli transformed with these Q10 synthesis elements and plants with edited sites can synthesize coenzyme Q10.

[0046] Furthermore, the aforementioned plant Q10 synthetic elements are preferably derived from any one of rice, lettuce, cucumber, wheat, and corn.

[0047] Secondly, a second plant Q10 synthesis element that significantly improves the level of plant coenzyme Q10 synthesis is provided. The amino acid sequence of the plant Q10 synthesis element is obtained by replacing a portion of the amino acid sequence fragment of wild-type plant Coq1 with tomato Coq1. The amino acid sequence fragment includes: segments 145-173 and 238-263 corresponding to wild-type rice Coq1, wherein the amino acid sequence of tomato Coq1 is shown in SEQ ID NO.69.

[0048] Furthermore, the wild-type plant Coq1 comes from any one of rice, corn, or wheat.

[0049] Four plant Q10 synthetic elements were obtained by replacing amino acid sequences 145-173 and 238-263 of wild-type rice Coq1, wild-type maize Coq1, and wild-type wheat Coq1, respectively, corresponding to wild-type rice Coq1: SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, and SEQ ID NO.67. All the obtained plant Q10 synthetic elements have coenzyme Q10 synthesis activity. Escherichia coli transformed with these Q10 synthetic elements and plants with these sites edited can synthesize coenzyme Q10.

[0050] Among them, the Q10 synthetic elements shown in SEQ ID NO.61 and SEQ ID NO.63 are obtained by mutation of wild-type rice Coq1 (SEQ ID NO.1) from rice (Oryzasativa), and the mutation sites include amino acid residues at positions 145-173 and 238-263, which are replaced by the corresponding fragment of tomato Coq1 shown in SEQ ID NO.69; For example, in the rice Q10 synthetic element (named OsH) shown in SEQ ID NO.61, amino acid residues at positions 145-173 and 238-263 are replaced by the corresponding fragment of tomato Coq1 shown in SEQ ID NO.69; For example, in the rice Q10 synthetic element (named OsI) shown in SEQ ID NO.63, amino acid residues at positions 145-173, 238-239, and 241-263 are replaced by the corresponding fragment of tomato Coq1 shown in SEQ ID NO.69; Among them, the Q10 synthetic element (named ZmF) shown in SEQ ID NO.65 was obtained by mutation of wild-type maize Coq1 (SEQ ID NO.37) from maize (Zea mays). The mutation sites include amino acid residues at positions 145-173 and 238-263 of wild-type rice Coq1, which are replaced by the corresponding fragment of tomato Coq1 shown in SEQ ID NO.69. Among them, the Q10 synthetic element (named TaF) shown in SEQ ID NO.67 is obtained by mutating wild-type wheat Coq1 (SEQ ID NO.49) from wheat (Triticumaestivum). The mutation sites include amino acid residues at positions 145-173 and 238-263 corresponding to wild-type rice Coq1, which are replaced by the corresponding fragment of tomato Coq1 shown in SEQ ID NO.69.

[0051] On the other hand, the present invention also provides a coding gene that encodes the plant Q10 synthetic element as described above, wherein the base sequence of these coding genes is selected from any of the following sequences: SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, SEQ ID NO.62, SEQ ID NO.64, SEQ ID NO.66, SEQ ID NO.68 and SEQ ID NO.70.

[0052] in, SEQ ID NO.22 encodes the rice Q10 synthetic element OsA shown in SEQ ID NO.7; SEQ ID NO.23 encodes the rice Q10 synthetic element OsB shown in SEQ ID NO.8; SEQ ID NO.24 encodes the rice Q10 synthetic element OsC shown in SEQ ID NO.9; SEQ ID NO.25 encodes the rice Q10 synthetic element OsD shown in SEQ ID NO.10; SEQ ID NO.26 encodes the rice Q10 synthetic element OsE shown in SEQ ID NO.11; SEQ ID NO.27 encodes the rice Q10 synthetic element OsF shown in SEQ ID NO.12; SEQ ID NO.28 encodes the rice Q10 synthetic element OsG shown in SEQ ID NO.13; SEQ ID NO.29 encodes the lettuce Q10 synthetic element LsA shown in SEQ ID NO.14; SEQ ID NO.30 encodes the lettuce Q10 synthetic element LsB shown in SEQ ID NO.15; SEQ ID NO.31 encodes the lettuce Q10 synthetic element LsC shown in SEQ ID NO.16; SEQ ID NO.32 encodes the lettuce Q10 synthetic element LsD shown in SEQ ID NO.17; SEQ ID NO.33 encodes the lettuce Q10 synthetic element LsE shown in SEQ ID NO.18; SEQ ID NO.34 encodes the lettuce Q10 synthetic element LsF shown in SEQ ID NO.19; SEQ ID NO.35 encodes the cucumber Q10 synthetic element CsA shown in SEQ ID NO.20; SEQ ID NO.36 encodes the cucumber Q10 synthetic element CsB shown in SEQ ID NO.21; SEQ ID NO.44 encodes the corn Q10 synthetic element ZmA shown in SEQ ID NO.38; SEQ ID NO.45 encodes the corn Q10 synthetic element ZmB shown in SEQ ID NO.39; SEQ ID NO.46 encodes the corn Q10 synthetic element ZmC shown in SEQ ID NO.40; SEQ ID NO.47 encodes the corn Q10 synthetic element ZmD shown in SEQ ID NO.41; SEQ ID NO.48 encodes the corn Q10 synthetic element ZmE shown in SEQ ID NO.42; SEQ ID NO.56 encodes the wheat Q10 synthetic element TaA shown in SEQ ID NO.50; SEQ ID NO.57 encodes the wheat Q10 synthetic element TaB shown in SEQ ID NO.51; SEQ ID NO.58 encodes the wheat Q10 synthetic element TaC shown in SEQ ID NO.52; SEQ ID NO.59 encodes the wheat Q10 synthetic element TaD shown in SEQ ID NO.53; SEQ ID NO. 60 encodes the wheat Q10 synthetic element TaE shown in SEQ ID NO. 54; SEQ ID NO.62 encodes the rice Q10 synthetic element OsH shown in SEQ ID NO.61; SEQ ID NO.64 encodes the rice Q10 synthetic element OsI shown in SEQ ID NO.63; SEQ ID NO. 66 encodes the corn Q10 synthetic element ZmF shown in SEQ ID NO. 65; SEQ ID NO.68 encodes the wheat Q10 synthetic element TaF shown in SEQ ID NO.67; SEQ ID NO.70 encodes the tomato Coq1 shown in SEQ ID NO.69.

[0053] It should be readily understood by those skilled in the art that, due to the degeneracy of codons, it is easy to substitute one or more nucleotides in the above-mentioned coding gene sequence to obtain a corresponding derived sequence that encodes the plant Q10 synthetic element provided by this invention. Therefore, substituting one or more nucleotides in the above-mentioned coding gene sequence to obtain a corresponding derived sequence that encodes the plant Q10 synthetic element provided by this invention also falls within the scope of protection of this invention.

[0054] On the other hand, the present invention also provides a vector containing the coding gene as described above. The vector can be a cloning vector or an expression vector; the expression vector can be a prokaryotic expression vector, such as the ptrc99a vector, or a eukaryotic expression vector. Those skilled in the art can select a suitable vector as a tool for carrying the above-mentioned coding gene, and all such vectors fall within the scope of protection of the present invention.

[0055] On the other hand, the present invention provides recombinant bacteria or recombinant cells containing the above-mentioned vector. The recombinant bacteria can be cocci, bacilli such as *Escherichia coli*, or spirilla; they can also be autoaerobic or heteroaerobic. The recombinant cells can be prokaryotic or eukaryotic cells; eukaryotic cells can be animal cells or plant cells; plant cells can be dicotyledonous or monocotyledonous plant cells. It is readily understood that those skilled in the art can select suitable bacteria or cells as hosts for the above-mentioned encoding genes, as needed, and all such selections fall within the scope of protection of the present invention.

[0056] On the other hand, the present invention provides the application of the above-mentioned plant Q10 synthesis element in the cultivation of plants that synthesize coenzyme Q10, including: transforming a vector into a target plant, wherein the vector contains a gene encoding the plant Q10 synthesis element.

[0057] For example, by transforming cells, such as rice callus, with a vector containing the gene encoding the rice Q10 synthesis element shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, and SEQ ID NO.64, and culturing it to differentiate into a complete rice plant, rice that synthesizes coenzyme Q10 can be cultivated. Transgenic rice plants transformed using this type of gene do not introduce exogenous genes, i.e., genes from different species, which can increase public acceptance.

[0058] For example, cells such as lettuce callus can be transformed with vectors containing the lettuce Q10 synthesis element encoding genes shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, and SEQ ID NO.34. These cells are then cultured to differentiate into complete lettuce plants, thus producing lettuce that synthesizes coenzyme Q10. Transgenic lettuce plants transformed using these encoding genes do not introduce exogenous genes (i.e., genes from different species), which can increase public acceptance.

[0059] For example, transforming cells such as cucumber callus tissue with a vector containing the gene encoding the cucumber Q10 synthesis element shown in SEQ ID NO.35 and SEQ ID NO.36, and culturing it to differentiate into a complete cucumber plant, can cultivate cucumbers that synthesize coenzyme Q10. Transgenic cucumber plants transformed using this type of gene do not introduce exogenous genes, i.e., genes from different species, which can increase public acceptance.

[0060] For example, transforming cells, such as maize callus tissue, with a vector containing the gene encoding the maize Q10 synthesis element shown in SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, and SEQ ID NO.48, and culturing it to differentiate into a complete maize plant, can cultivate maize that synthesizes coenzyme Q10. Transgenic maize plants transformed using these gene encodings do not introduce exogenous genes, i.e., genes from different species, which can increase public acceptance.

[0061] For example, transforming cells, such as wheat callus, with a vector containing the wheat Q10 synthesis element encoding genes shown in SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59, and SEQ ID NO. 60, and culturing them to differentiate into complete wheat plants, can cultivate wheat that synthesizes coenzyme Q10. Transgenic wheat plants transformed using these encoding genes do not introduce exogenous genes, i.e., genes from different species, which can increase public acceptance. The above applications include modifying the endogenous Coq1 gene of the target plant to encode the plant's Q10 synthesis element: For example, using part or all of the rice Q10 synthetic element encoding genes shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, and SEQ ID NO.64 as templates, the endogenous Coq1 gene in the rice genome can be modified, thereby breeding non-transgenic rice.

[0062] For example, using part or all of the lettuce Q10 synthetic element encoding genes shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, and SEQ ID NO.34 as templates, the endogenous Coq1 gene in the lettuce genome can be modified, thereby cultivating non-transgenic lettuce.

[0063] For example, using part or all of the cucumber Q10 synthetic element encoding gene shown in SEQ ID NO.35 and SEQ ID NO.36 as a template, the endogenous Coq1 gene of the cucumber genome can be modified, thereby cultivating non-transgenic cucumbers.

[0064] For example, using part or all of the maize Q10 synthetic element encoding genes shown in SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, and SEQ ID NO.48 as templates, the endogenous Coq1 gene in the maize genome can be modified, thereby breeding non-transgenic maize.

[0065] For example, using part or all of the wheat Q10 synthetic element encoding genes shown in SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, and SEQ ID NO.60 as templates, the endogenous Coq1 gene in the wheat genome can be modified, thereby breeding non-transgenic wheat.

[0066] The above applications include mutagenesis and screening of plant cells, tissues, individuals, or populations to encode the plant's Q10 synthetic element: For example, using the genes encoding the OsA, OsB, OsC, OsD, OsE, OsF, OsG, OsH, and OsI mutants shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, and SEQ ID NO.64 as a guide, rice materials can be mutagenized through methods such as chemical or radiation mutagenesis, thereby cultivating rice with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can be modified using CRISPR / Cas9 technology to the base sequence of that coding gene (SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, SEQ ID NO.64). This results in a target plant that encodes a protein identical to the rice OsA, OsB, OsC, OsD, OsE, OsF, OsG, OsH, and OsI mutants provided in this invention (SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.62, SEQ ID NO.64), enabling the final target plant to synthesize coenzyme Q10.

[0067] For example, using the LsA, LsB, LsC, LsD, LsE, and LsF mutant encoding genes shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, and SEQ ID NO.34 as a guide, lettuce materials can be mutagenized through methods such as chemical or radiation mutagenesis, thereby cultivating lettuce with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can be modified to the base sequence of the coding gene (SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34) using CRISPR / Cas9 technology, thereby encoding a protein in the target plant that is identical to the LsA, LsB, LsC, LsD, LsE, and LsF mutants (SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34) provided in this invention, so that the final target plant can synthesize coenzyme Q10.

[0068] For example, guided by the CsA and CsB mutant coding genes shown in SEQ ID NO.35 and SEQ ID NO.36, cucumber materials can be mutagenized through methods such as chemical or radiation mutagenesis, thereby cultivating cucumbers with endogenous Coq1 gene mutations. Alternatively, the coding sequence of the endogenous Coq1 gene can be modified to the base sequence of the coding gene (SEQ ID NO.35 and SEQ ID NO.36) using CRISPR / Cas9 technology, resulting in a target plant that encodes the same protein as the cucumber CsA and CsB mutants (SEQ ID NO.35 and SEQ ID NO.36) provided by this invention, enabling the final target plant to synthesize coenzyme Q10.

[0069] For example, using the genes encoding the ZmA, ZmB, ZmC, ZmD, ZmE, and ZmF mutants shown in SEQ ID NO.44, SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.48, and SEQ ID NO.66 as a guide, maize materials can be mutagenized through methods such as chemical or radiation mutagenesis, thereby cultivating maize with endogenous Coq1 gene mutations. For example, the coding sequence of the endogenous Coq1 gene can be modified using CRISPR / Cas9 technology to the base sequence of that coding gene (SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 66), encoding a protein in the resulting target plant that is identical to the maize ZmA, ZmB, ZmC, ZmD, ZmE, and ZmF mutants (SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 66) provided in this invention, so that the final target plant can synthesize coenzyme Q10.

[0070] For example, guided by the TaA, TaB, TaC, TaD, TaE, and TaF mutant coding genes shown in SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, and SEQ ID NO.68, wheat materials can be mutagenized through methods such as chemical or radiation mutagenesis, thereby cultivating wheat with endogenous Coq1 gene mutations. Alternatively, the coding sequence of the endogenous Coq1 gene can be modified using CRISPR / Cas9 technology to match the base sequence of that coding gene (SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, and SEQ ID NO.68), resulting in a target plant that encodes the same protein as the wheat (T SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60, and SEQ ID NO.68) provided by this invention, enabling the final target plant to synthesize coenzyme Q10.

[0071] The aforementioned target plants are plants belonging to the Poaceae, Solanaceae, Cucurbitaceae, Asteraceae, Lamiaceae, Amaryllidaceae, Chenopodiaceae, Amaranthaceae, Malvaceae, Araliaceae, and Asparagaceae families. Specifically, they can be any one of the following: wheat, rice, barley, oats, corn, sorghum, water chestnut, millet, buckwheat, sorghum, sesame, sunflower, cucumber, zucchini, pumpkin, winter melon, bitter melon, loofah, cucumber, watermelon, cantaloupe, leek, scallion, onion, leeks, spinach, lettuce, tomato, lettuce, garland chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, and kiwifruit. It is readily understood that those skilled in the art can choose any crop variety to cultivate as needed, as long as it utilizes the plant Q10 synthetic element and / or its encoding gene provided by this invention, it falls within the scope of protection of this invention.

[0072] It should be noted that the protein sequence alignment used in this invention is Clustal online alignment, the website of which is: http: / / www.ebi.ac.uk / Tools / msa / clustalo / . Results obtained using other sequence alignment tools (such as MAFFT, with relevant parameter settings at default) are basically consistent with those obtained using Clustal online alignment.

[0073] In summary, the Q10 synthetic elements provided by this invention, such as SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20 or SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, have amino acid sequences corresponding to those of rice Coq1 (SEQ ID NO. 50). NO.1) has a mutation at position 240 (M / I240L / V / F / Y / C) and / or a mutation at position 243 (A243V) and / or a mutation at position 255 (I255M) and / or a mutation at position 256 (S256T) and / or a mutation at position 166 (K166D / E) and / or a mutation at position 245 (G245E).

[0074] Mutations at position 240 and at multiple other positions can enhance the activity of various plant Q10 synthetic elements in synthesizing coenzyme Q10 precursors while maintaining their own bio-enzyme catalytic activity.

[0075] Four plant Q10 synthetic elements were obtained by replacing amino acid sequences 145-173 and 238-263 of wild-type rice Coq1, wild-type maize Coq1, and wild-type wheat Coq1, respectively, corresponding to wild-type rice Coq1: SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, and SEQ ID NO.67. All the obtained plant Q10 synthetic elements have coenzyme Q10 synthesis activity. Escherichia coli transformed with these Q10 synthetic elements and plants with these sites edited can synthesize coenzyme Q10.

[0076] These plant Q10 synthesis elements can be used not only to cultivate non-GMO plants that synthesize coenzyme Q10, such as rice, lettuce, cucumber, corn, wheat, and watermelon, but also to cultivate GMO crops, showing broad application prospects.

[0077] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0078] Examples A1-A7 (Rice)

[0079] The rice Q10 synthetic element provided in Example A1, named OsA, has the amino acid sequence shown in SEQ ID NO.7. It is obtained by mutating amino acid residue M to L at position 240 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsA, with the base sequence shown in SEQ ID NO.22.

[0080] The rice Q10 synthetic element provided in Example A2, named OsB, has the amino acid sequence shown in SEQ ID NO. 8. It is obtained by mutating amino acid residue M to L at position 240 and amino acid residue A to V at position 243 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsB, with the base sequence shown in SEQ ID NO. 23.

[0081] The rice Q10 synthetic element provided in Example A3, named OsC, has the amino acid sequence shown in SEQ ID NO. 9. It was obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, and amino acid residue I to M at position 255 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsC, with the base sequence shown in SEQ ID NO. 24.

[0082] The rice Q10 synthetic element provided in Example A4, named OsD, has the amino acid sequence shown in SEQ ID NO.10. It was obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue I to M at position 255, and amino acid residue S to T at position 256 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsD, with the base sequence shown in SEQ ID NO.25.

[0083] The rice Q10 synthetic element provided in Example A5, named OsE, has the amino acid sequence shown in SEQ ID NO.11. It was obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue I to M at position 255, amino acid residue S to T at position 256, and amino acid residue K to D at position 166 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsE, with the base sequence shown in SEQ ID NO.26.

[0084] The rice Q10 synthetic element provided in Example A6, named OsF, has the amino acid sequence shown in SEQ ID NO.12. It was obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue I to M at position 255, amino acid residue S to T at position 256, and amino acid residue K to E at position 166 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsF, the base sequence of which is shown in SEQ ID NO.27.

[0085] The rice Q10 synthetic element provided in Example A7, named OsG, has the amino acid sequence shown in SEQ ID NO.13. It was obtained by mutating amino acid residue A to V at position 243, amino acid residue I to M at position 255, amino acid residue S to T at position 256, and amino acid residue K to D at position 166 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsG, with the base sequence shown in SEQ ID NO.28.

[0086] The amino acid sequences of the eight synthetic elements OsA, OsB, OsC, OsD, OsE, OsF, OsG, and wild-type rice Coq1 in Examples A1-A7 are compared as follows: Figure 1 As shown.

[0087] The rice Q10 synthetic elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG, as well as the nucleic acid molecules encoding them, can all be obtained through various chemical synthesis methods.

[0088] Examples B1-B6 (Lettuce)

[0089] The lettuce Q10 synthetic element provided in Example B1, named LsA, has the amino acid sequence shown in SEQ ID NO.14. It is obtained by mutating amino acid residue I to L at position 240 of wild-type lettuce Coq1 (named LsCoq1, amino acid sequence shown in SEQ ID NO.3) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthetic element LsA, with the base sequence shown in SEQ ID NO.29.

[0090] The lettuce Q10 synthetic element provided in Example B2, named LsB, has the amino acid sequence shown in SEQ ID NO.15. It is obtained by mutating amino acid residue I to V at position 240 of wild-type lettuce Coq1 (named LsCoq1, amino acid sequence shown in SEQ ID NO.3) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthetic element LsB, with the base sequence shown in SEQ ID NO.30.

[0091] The lettuce Q10 synthetic element provided in Example B3, named LsC, has the amino acid sequence shown in SEQ ID NO.16. It is obtained by mutating amino acid residue I to F at position 240 of wild-type lettuce Coq1 (named LsCoq1, amino acid sequence shown in SEQ ID NO.3) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthetic element LsC, with the base sequence shown in SEQ ID NO.31.

[0092] The lettuce Q10 synthetic element provided in Example B4, named LsD, has the amino acid sequence shown in SEQ ID NO.17. It is obtained by mutating amino acid residue I to Y at position 240 of wild-type lettuce Coq1 (named LsCoq1, amino acid sequence shown in SEQ ID NO.3) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthetic element LsD, with the base sequence shown in SEQ ID NO.32.

[0093] The lettuce Q10 synthetic element provided in Example B5, named LsE, has the amino acid sequence shown in SEQ ID NO.18. It is obtained by mutating amino acid residue I to C at position 240 of wild-type lettuce Coq1 (named LsCoq1, amino acid sequence shown in SEQ ID NO.3) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthetic element LsE, with the base sequence shown in SEQ ID NO.33.

[0094] The lettuce Q10 synthetic element provided in Example B6, named LsF, has the amino acid sequence shown in SEQ ID NO.19. It is obtained by mutating amino acid residue I to L at position 240 and amino acid residue A to V at position 243 of wild-type lettuce Coq1 (named LsCoq1, amino acid sequence shown in SEQ ID NO.3), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the lettuce Q10 synthetic element LsF, with the base sequence shown in SEQ ID NO.34.

[0095] The amino acid sequences of the eight synthetic elements LsA, LsB, LsC, LsD, LsE, LsF of lettuce Q10, Coq1 of wild-type lettuce, and Coq1 of wild-type rice in Examples B1-B6 are compared as follows: Figure 2As shown.

[0096] The lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, and LsF, as well as the nucleic acid molecule encoding it, can all be obtained through various chemical synthesis methods.

[0097] Examples C1-C2 (Cucumber)

[0098] The cucumber Q10 synthetic element provided in Example C1, named CsA, has the amino acid sequence shown in SEQ ID NO. 20. It is obtained by mutating amino acid residue I to L at position 240 of wild-type cucumber Coq1 (named CsCoq1, amino acid sequence shown in SEQ ID NO. 5) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the cucumber Q10 synthetic element CsA, with the base sequence shown in SEQ ID NO. 35.

[0099] The cucumber Q10 synthetic element provided in Example C2, named CsB, has the amino acid sequence shown in SEQ ID NO. 21. It is obtained by mutating amino acid residue I to V at position 240 of wild-type cucumber Coq1 (named CsCoq1, amino acid sequence shown in SEQ ID NO. 5) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the cucumber Q10 synthetic element CsB, with the base sequence shown in SEQ ID NO. 36.

[0100] The amino acid sequences of the four synthetic elements CsA and CsB of cucumber Q10, wild-type cucumber Coq1, and wild-type rice Coq1 in Examples C1-C2 are compared as follows: Figure 3 As shown.

[0101] The synthetic elements CsA and CsB of cucumber Q10, as well as the nucleic acid molecule encoding it, can all be obtained through various chemical synthesis methods.

[0102] Examples D1-D5 (Corn)

[0103] The maize Q10 synthetic element provided in Example D1, named ZmA, has the amino acid sequence shown in SEQ ID NO. 38. It is obtained by mutating amino acid residue M to L at position 240 of wild-type maize Coq1 (named ZmCoq1, amino acid sequence shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthetic element ZmA, with the base sequence shown in SEQ ID NO. 44.

[0104] The maize Q10 synthetic element provided in Example D2, named ZmB, has the amino acid sequence shown in SEQ ID NO. 39. It is obtained by mutating amino acid residue M to L at position 240 of wild-type maize Coq1 (named ZmCoq1, amino acid sequence shown in SEQ ID NO. 37) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1), and mutating amino acid residue A to V at position 243. Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthetic element ZmB, with the base sequence shown in SEQ ID NO. 45.

[0105] The maize Q10 synthetic element provided in Example D3, named ZmC, has the amino acid sequence shown in SEQ ID NO. 40. It is obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, and amino acid residue I to M at position 255 of wild-type maize Coq1 (named ZmCoq1, amino acid sequence shown in SEQ ID NO. 37), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthetic element ZmC, with the base sequence shown in SEQ ID NO. 46.

[0106] The maize Q10 synthetic element provided in Example D4, named ZmD, has the amino acid sequence shown in SEQ ID NO.41. It is obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue I to M at position 255, and amino acid residue S to T at position 256 of wild-type maize Coq1 (named ZmCoq1, amino acid sequence shown in SEQ ID NO.37), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthetic element ZmD, with the base sequence shown in SEQ ID NO.47.

[0107] The maize Q10 synthetic element provided in Example D5, named ZmE, has the amino acid sequence shown in SEQ ID NO.42. It is obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue I to M at position 255, amino acid residue S to T at position 256, and amino acid residue K to D at position 166 of wild-type maize Coq1 (named ZmCoq1, amino acid sequence shown in SEQ ID NO.37), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO.1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthetic element ZmE, with the base sequence shown in SEQ ID NO.48.

[0108] The amino acid sequences of the seven synthetic elements ZmA, ZmB, ZmC, ZmD, ZmE, wild-type maize Coq1, and wild-type rice Coq1 in Examples D1-D5 are compared as follows: Figure 8 As shown.

[0109] The maize Q10 synthetic elements ZmA, ZmB, ZmC, ZmD, ZmE and the nucleic acid molecules encoding them can all be obtained through various chemical synthesis methods.

[0110] Examples E1-E5 (wheat)

[0111] The wheat Q10 synthetic element provided in Example E1, named TaA, has the amino acid sequence shown in SEQ ID NO. 50. It is obtained by mutating amino acid residue M to L at position 240 of wild-type wheat Coq1 (named TaCoq1, amino acid sequence shown in SEQ ID NO. 49) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthetic element TaA, with the base sequence shown in SEQ ID NO. 56.

[0112] The wheat Q10 synthetic element provided in Example E2, named TaB, has the amino acid sequence shown in SEQ ID NO. 51. It is obtained by mutating amino acid residue M to L at position 240 of wild-type wheat Coq1 (named TaCoq1, amino acid sequence shown in SEQ ID NO. 49) corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1), and mutating amino acid residue A to V at position 243. Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthetic element TaB, with the base sequence shown in SEQ ID NO. 57.

[0113] The wheat Q10 synthetic element provided in Example E3, named TaC, has the amino acid sequence shown in SEQ ID NO. 52. It is obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, and amino acid residue G to E at position 245 of wild-type wheat Coq1 (named TaCoq1, amino acid sequence shown in SEQ ID NO. 49), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthetic element TaC, with the base sequence shown in SEQ ID NO. 58.

[0114] The wheat Q10 synthetic element provided in Example E4, named TaD, has the amino acid sequence shown in SEQ ID NO. 53. It is obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue G to E at position 245, and amino acid residue S to T at position 256 of wild-type wheat Coq1 (named TaCoq1, amino acid sequence shown in SEQ ID NO. 49), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthetic element TaD, with the base sequence shown in SEQ ID NO. 59.

[0115] The wheat Q10 synthetic element provided in Example E5, named TaE, has the amino acid sequence shown in SEQ ID NO. 54. It is obtained by mutating amino acid residue M to L at position 240, amino acid residue A to V at position 243, amino acid residue G to E at position 245, amino acid residue S to T at position 256, and amino acid residue K to D at position 166 in wild-type wheat Coq1 (named TaCoq1, amino acid sequence shown in SEQ ID NO. 49), corresponding to wild-type rice Coq1 (amino acid sequence shown in SEQ ID NO. 1). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthetic element TaE, with the base sequence shown in SEQ ID NO. 60.

[0116] The amino acid sequences of the seven synthetic elements TaA, TaB, TaC, TaD, TaE of wheat Q10, Coq1 of wild-type wheat, and Coq1 of wild-type rice in Examples E1-E5 are compared as follows: Figure 9 As shown.

[0117] The wheat Q10 synthetic elements TaA, TaB, TaC, TaD, and TaE, as well as the nucleic acid molecules encoding them, can all be obtained through various chemical synthesis methods.

[0118] Examples A8-A9 (rice)

[0119] The rice Q10 synthetic element provided in Example A8, named OsH, has the amino acid sequence shown in SEQ ID NO. 61. It is obtained by modifying amino acid residues 145-173 and 238-263 of wild-type rice Coq1 (named OsCoq1, amino acid sequence shown in SEQ ID NO. 1) to correspond to the tomato Coq1 sequence (named SlCoq1, amino acid sequence shown in SEQ ID NO. 69, base sequence shown in SEQ ID NO. 70). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsH, with the base sequence shown in SEQ ID NO. 62.

[0120] The rice Q10 synthetic element provided in Example A9, named OsI, has the amino acid sequence shown in SEQ ID NO. 63. It is obtained by modifying amino acid residues 145-173, 238-239, and 241-263 of wild-type rice Coq1 (named SlCoq1, amino acid sequence shown in SEQ ID NO. 1) to correspond to the tomato Coq1 sequence (named SlCoq1, amino acid sequence shown in SEQ ID NO. 69, base sequence shown in SEQ ID NO. 70). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the rice Q10 synthetic element OsI, with the base sequence shown in SEQ ID NO. 64.

[0121] The rice Q10 synthetic elements OsH and OsI, as well as the nucleic acid molecules encoding them, can all be obtained through various chemical synthesis methods.

[0122] Example D6 (Corn)

[0123] The maize Q10 synthetic element provided in Example D6, named ZmF, has the amino acid sequence shown in SEQ ID NO. 65. It is obtained by modifying amino acid residues 145-173 and 238-263 of wild-type maize Coq1 (named ZmCoq1, amino acid sequence shown in SEQ ID NO. 37) to correspond to the tomato Coq1 sequence (named SlCoq1, amino acid sequence shown in SEQ ID NO. 69, base sequence shown in SEQ ID NO. 70). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the maize Q10 synthetic element ZmF, with the base sequence shown in SEQ ID NO. 66.

[0124] Both the corn Q10 synthetic element ZmF and the nucleic acid molecule encoding it can be obtained through various chemical synthesis methods.

[0125] Example E6 (Wheat)

[0126] The wheat Q10 synthetic element provided in Example E6, named TaF, has the amino acid sequence shown in SEQ ID NO. 67. It is obtained by modifying amino acid residues 145-173 and 238-263 of wild-type wheat Coq1 (named TaCoq1, amino acid sequence shown in SEQ ID NO. 49) to correspond to the tomato Coq1 sequence (named SlCoq1, amino acid sequence shown in SEQ ID NO. 69, base sequence shown in SEQ ID NO. 70). Additionally, this example also provides a nucleic acid molecule (i.e., encoding gene) encoding the wheat Q10 synthetic element TaF, with the base sequence shown in SEQ ID NO. 68.

[0127] The wheat Q10 synthetic element TaF and the nucleic acid molecule encoding it can both be obtained through various chemical synthesis methods.

[0128] The amino acid sequences of the following eight components are compared: rice Q10 synthesis elements OsH and OsI in Examples A8-A9; maize Q10 synthesis element ZmF in Example D6; wheat Q10 synthesis element TaF in Example E6; wild-type rice Coq1; wild-type maize Coq1; wild-type wheat Coq1; and wild-type tomato Coq1. Figure 10 As shown.

[0129] Experimental Example 1

[0130] The enzyme activity products of the rice Q10 synthetic elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG provided in Examples A1-A7 were detected by the following method: Based on the nucleic acid molecule sequences provided in the examples, the coding genes for the rice Q10 synthetic elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG were synthesized using chemical synthesis methods and inserted into the *E. coli* expression vector ptrc99a, which was then transformed into wild-type *E. coli* strain MG1655. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and a strain transformed with wild-type rice Coq1 (OsCoq1).

[0131] Three single clones from each transformant were selected and cultured in 50 mL sterile centrifuge tubes with 10 mL of LB broth containing ampicillin. The cells were incubated at 37°C and 220 rpm until the OD600 reached approximately 1.0. Then, 1 mM IPTG was added, and the cells were incubated overnight at 28°C and 220 rpm. The next day, the cells were collected by centrifugation at 4000 rpm for 10 min, the supernatant was discarded, and the precipitate was resuspended in 1 mL of ultrapure water and transferred to a pre-weighed 2 mL centrifuge tube. The tubes were centrifuged at 12000 rpm for 10 min, the supernatant was aspirated, and the cells were weighed again to calculate the wet weight. Ethanol was added at a ratio of 0.5 mL of extraction buffer per 10 mg of cells. The cells were then extracted by sonication at low temperature in the dark for 1 h. The filtered sample was then analyzed by liquid chromatography-mass spectrometry (LC-MS). The mass spectrometry detection method is as follows: The filtered sample was injected into a liquid chromatography-mass spectrometry (LC-MS) system for analysis. The LC conditions were as follows: HPLC-DAD-MS (1260 Infinity II-6460, Agilent) was used with a ZORBAX Eclipse XDB C18 column (3.5 μm, 2.1 × 50 mm). The mobile phase consisted of (A) isopropanol and (B) 87.5% acetonitrile aqueous solution (containing 10 mmol / L ammonium acetate). The mobile phase conditions were 0–6 min, 65–15% B; the flow rate was 0.4 mL / min. The mass spectrometry conditions were as follows: an ESI ion source was used, with capillary voltage of 4.0 kV, nebulizer pressure of 35 psi, high-purity nitrogen as the carrier gas, and a flow rate of 11 L / min. Positive ion mode was selected for the determination of Coenzyme Q9 (mother ion m / z 795.6, daughter ion m / z 197.1), fragmentation voltage of 216 V, and collision energy of 36 V. Coenzyme Q10 (mother ion m / z 863.6, daughter ion m / z 197.1), fragmentation voltage 230V, collision energy 42V.

[0132] according to Figure 4 The results show that: E. coli transformed into wild-type rice Coq1 (OsCoq1) synthesizes almost no coenzyme Q10, but can synthesize coenzyme Q9. E. coli transformed with rice Q10 synthesis elements OsA, OsB, OsC, OsD, OsE, OsF, and OsG can synthesize different levels of coenzyme Q10. A comparison between OsE and OsG leads to the conclusion that the 240-site mutation is very important.

[0133] Experiment Example 2

[0134] Referring to the detection method in Experimental Example 1, the products of the lettuce Q10 synthetic elements LsA, LsB, LsC, LsD, LsE, and LsF provided in Examples B1-B6 were verified. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and wild-type lettuce Coq1 transformed into LsCoq1. The results are as follows: Figure 5 As shown.

[0135] according to Figure 5 The results show that: E. coli introduced into wild-type lettuce Coq1 (LsCoq1) hardly synthesizes coenzyme Q10, but can synthesize coenzyme Q9. E. coli introduced into lettuce Q10 synthesis elements LsA, LsB, LsC, LsD, LsE, and LsF can synthesize different levels of coenzyme Q10.

[0136] Experimental Example 3

[0137] Referring to the detection method in Experimental Example 1, the products of cucumber Q10 synthetic elements CsA and CsB provided in Examples C1-C2 were verified. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and a strain transformed with wild-type cucumber Coq1 (CsCoq1). The results are as follows... Figure 6 As shown.

[0138] according to Figure 6 The results show that: E. coli transformed into wild-type cucumber Coq1 (CsCoq1) synthesizes almost no coenzyme Q10, but can synthesize coenzyme Q9. E. coli transformed into cucumber Q10 synthesis elements CsA and CsB can synthesize different levels of coenzyme Q10.

[0139] Experiment Example 4

[0140] Guided editing based on the CRISPR / Cas9 system was used to edit the corresponding DNA sequence on the wild-type rice Coq1 (OsCoq1) genome to include the OsE Q10 synthetic element. For the 166 site, Spector (caatattttgctgtctcgtg), RT template (tactggcaaatGACctccgcac), and PBS (gagacagcaa) were designed using the PlantPegDesigner website. For fragments containing 240, 243, 255, and 256, the GRAND sequence was followed. 1The strategy involved designing two pegRNAs to replace sequences 240-256 at once: Sper1 (TTTCTCTACATTGTTTCTTC), with RT template + PBS (GGAGATTTGCATGGTTTCACCAGTAACTAGATGTTCTACAGCAGTAGCCATTAGAGATACCACCTGAAGAAACAATGTAG), and Sper2 (AAATCTAAGATAATGATATT), with RT template + PBS (ACTGGTGAAACCATGCAAATCTCCACAAGTAGAGAGCAAAGGCGAAGGTAGTTGCTCTAATACCTAAATCTAAGATAATG). These three pegRNAs were designed into an expression cassette using tRNA (transfer RNA) and HDV (hepatitis delta virus) primitives, and driven by the same polyII promoter as described in the literature. 2 Using the engineered plant prime editor (ePPE) system ( 3 The addgene vector number is #183095.

[0141] The constructed binary vector was transformed into Agrobacterium tumefaciens competent cells, and then transformed into the rice variety Zhonghua 11 using conventional rice transgenic methods to obtain transgenic positive rice plants. DNA was extracted from the T0 generation plants, and PCR was performed (primer 1: AGGCTTCAGACTGAGCACTA, primer 2: ACAGCCTTGCAGCTATTTGA). The PCR products were sequenced at a company (primer 1: AGGCTTCAGACTGAGCACTA) to detect the desired sequence.

[0142] Six independent, successfully edited lines were obtained (numbered 45, 49, 87, 109, 120, and 124, respectively), of which site 166 remained a heterozygous mutation, while sites 240, 243, 255, and 256 were homozygous mutations.

[0143] Coenzyme Q10 extract extraction process: Rice leaves were freeze-dried at low temperature, ground with a ball mill, and 10 mg of powder was weighed and added to 1 mL of isopropanol. The mixture was then extracted by ultrasonication at low temperature in the dark for 1 h. The filtered extract sample was then injected into liquid chromatography-mass spectrometry for analysis under the same conditions as in Experiment 1.

[0144] according to Figure 7 The results show that: Wild-type rice (WT) mainly synthesizes coenzyme Q9, while rice lines with OsE-enzyme Q10 synthesis elements edited in 6 genes mainly synthesize coenzyme Q10.

[0145] Experimental Example 5

[0146] Referring to the detection method in Experimental Example 1, the products of the maize Q10 synthetic elements ZmA, ZmB, ZmC, ZmD, and ZmE provided in Examples D1-D5 were verified. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and a strain transformed with wild-type maize Coq1 (ZmCoq1). The results are as follows... Figure 11 As shown.

[0147] according to Figure 11 The results show that: E. coli transformed with wild-type maize Coq1 (ZmCoq1) hardly synthesizes coenzyme Q10, but can synthesize coenzyme Q9. E. coli transformed with maize Q10 synthesis elements ZmA, ZmB, ZmC, ZmD, and ZmE can synthesize different levels of coenzyme Q10.

[0148] Experimental Example 6

[0149] Referring to the detection method in Experimental Example 1, the products of wheat Q10 synthetic elements TaA, TaB, TaC, TaD, and TaE provided in Examples E1-E5 were verified. Comparative strains were prepared using an empty vector control (VEC) and wild-type wheat Coq1 transformed into TaCoq1. The results are as follows: Figure 12 As shown.

[0150] according to Figure 12 The results show that: Escherichia coli transformed with wild-type wheat Coq1 (TaCoq1) synthesizes almost no coenzyme Q10, but can synthesize coenzyme Q9. Escherichia coli transformed with wheat Q10 synthesis elements TaA, TaB, TaC, TaD, and TaE can synthesize different levels of coenzyme Q10.

[0151] Experimental Example 7

[0152] A single-base adenine editing system based on CRISPR / Cas9 was used to edit the corresponding DNA sequence on the genome of wild-type lettuce Coq1 (LsCoq1) to enable it to possess the Q10 synthetic element of LsB. For site 240, an sgRNA (ATCACTAATAGCAACAGCTG) was designed and used with the 35S-CmYLCV-U6 promoter ( 4 ) driver. ABE8e ( 5 Use Ubi10 to start the sub-driver.

[0153] The constructed binary vector was transformed into Agrobacterium tumefaciens competent cells, and then transformed into lettuce variety WD40 using conventional lettuce transgenic methods to obtain transgenic positive lettuce plants. DNA was extracted from T0 generation plants, and PCR was performed (primer 1: CTTGCAGTATTGGCTGGAGA, primer 2: CAGCATGGCAACCTCAGTAG). The PCR products were sequenced at the company (primer 1: CTTGCAGTATTGGCTGGAGA) to detect the edited target sequence.

[0154] Two independent, successfully edited lines (numbered 130 and 106, respectively) were obtained, and plants with homozygous mutations at 240 sites were isolated from T1 generation plants.

[0155] The extraction process and liquid phase conditions for the coenzyme Q10 extract were the same as in Experiment 4.

[0156] according to Figure 13 The results show that: Wild-type lettuce (WT) mainly synthesizes coenzyme Q9, while two gene-edited lettuce lines with LsB-containing Q10 synthesis elements synthesize a certain level of coenzyme Q10.

[0157] Experimental Example 8

[0158] Referring to the detection method of Experimental Example 1, the products of rice Q10 synthetic elements OsH and OsI provided in Examples A8-A9 were verified. Simultaneously, comparative strains were prepared using the same method as those prepared by introducing the rice Q10 synthetic element OsE provided in Example A5. The results are as follows: Figure 14 As shown.

[0159] according to Figure 14 The results show that: E. coli transformed with the rice Q10 synthesis element OsH can synthesize a certain level of coenzyme Q10, more than OsE. Comparing OsH and OsE, it can be concluded that altering more amino acids at five key amino acid sites (positions 166, 240, 243, 255, and 256) can further increase coenzyme Q10 levels. Comparing OsH and OsI, it can be concluded that the mutation at position 240 is very important.

[0160] Experimental Example 9

[0161] Referring to the detection method of Experimental Example 1, the product of the corn Q10 synthetic element ZmF provided in Example D6 was verified. Simultaneously, a comparative strain was prepared using the same method as that used for transferring the corn Q10 synthetic element ZmE provided in Example D5. The results are as follows... Figure 15 As shown.

[0162] according to Figure 15 The results show that: E. coli transferred with the maize Q10 synthesis element ZmF can synthesize a certain level of coenzyme Q10, more than ZmE. Comparing ZmF and ZmE, it can be concluded that changing more amino acids at five key amino acid sites (positions 166, 240, 243, 255, and 256) can further increase the level of coenzyme Q10.

[0163] Experimental Example 10

[0164] Referring to the detection method of Experimental Example 1, the product of wheat Q10 synthetic element TaF provided in Example E6 was verified. Simultaneously, comparative strains were prepared using the same method as those prepared by transferring wheat Q10 synthetic element TaE provided in Example E5. The results are as follows: Figure 16 As shown.

[0165] according to Figure 16 The results show that: E. coli transferred with the wheat Q10 synthesis element TaF can synthesize a certain level of coenzyme Q10, more than TaE. Comparing TaF and TaE, it can be concluded that changing more amino acids at five key amino acid sites (positions 166, 240, 243, 255, and 256) can further increase the level of coenzyme Q10.

[0166] Furthermore, referring to the methods in Experiments 4 and 7, commercially available crop varieties were transformed using CRISPR / Cas9 guided editing and existing conventional transgenic technologies to obtain successfully gene-edited plants containing plant Q10 synthesis elements, including wheat, rice, barley, oats, corn, sorghum, water chestnuts, millet, buckwheat, sorghum, sesame, sunflower, cucumber, zucchini, pumpkin, winter melon, bitter melon, loofah, cucumber, watermelon, cantaloupe, leek, scallion, onion, lettuce, tomato, spinach, lettuce, garland chrysanthemum, blueberry, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, wolfberry, ginseng, American ginseng, dragon fruit, and kiwifruit. Following the method in Experiment 4, coenzyme Q10 extracts were extracted and analyzed by liquid chromatography-mass spectrometry. This revealed beneficial changes in the coenzyme Q10 synthesis capacity of these plants.

[0167] Comparative Example D1

[0168] Comparative Example D1 used the same detection method as Experimental Example 1 to detect the products of rice Q10 synthetic elements OsA, OsB, OsC, OsD, OsE, OsF, OsG, and other rice Coq1 point mutations M240I, M240V, and M240A provided in Examples A1-A7. Comparative strains were prepared using an empty vector control (VEC) and wild-type rice Coq1 (OsCoq1). The results are shown in Table 1, where the data represent the mean ± standard deviation of three biological replicates.

[0169] Table 1. Detection results of enzyme activity products of Q10 synthetic elements in Comparative Example D1

[0170] Comparative Example D2

[0171] Comparative Example D2, following the detection method of Experiment 1, detected the enzyme activity products of the lettuce Q10 synthetic elements LsA, LsB, LsC, LsD, LsE, LsF provided in Examples B1-B6, as well as other lettuce Coq1 point mutations I240M, I240T, I240P, I240S, and I240A. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and wild-type lettuce Coq1 (LsCoq1). The results are shown in Table 2, where the data represent the mean ± standard deviation of three biological replicates.

[0172] Table 2. Detection results of enzyme activity products of Q10 synthetic elements in Comparative Example D2

[0173] Comparative Example D3

[0174] Comparative Example D3, following the detection method of Experimental Example 1, detected the enzyme activity products of cucumber Q10 synthetic elements CsA and CsB, as well as other cucumber Coq1 point mutations I240M and I240A, provided in Examples C1-C2. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and wild-type cucumber Coq1 (CsCoq1). The results are shown in Table 3, where the data represent the mean ± standard deviation of three biological replicates.

[0175] Table 3. Detection results of Q10 synthetic element enzyme activity products in Comparative Example D3

[0176] Comparative Example D4

[0177] Comparative Example D4 used the same detection method as Experimental Example 1 to detect the enzyme activity products of maize Q10 synthetic elements ZmA, ZmB, ZmC, ZmD, and ZmE provided in Examples D1-D5. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and wild-type maize Coq1 transformed into ZmCoq1 (ZmCoq1). The results are shown in Table 4, where the data represent the mean ± standard deviation of three biological replicates.

[0178] Table 4. Results of enzyme activity detection of Q10 synthetic elements in Comparative Example D4

[0179] Comparative Example D5

[0180] Comparative Example D5, following the detection method of Experimental Example 1, detected the enzyme activity products of wheat Q10 synthetic elements TaA, TaB, TaC, TaD, and TaE provided in Examples E1-E5. Simultaneously, comparative strains were prepared using an empty vector control (VEC) and wild-type wheat Coq1 transformed into TaCoq1 (TaCoq1). The results are shown in Table 5, where the data represent the mean ± standard deviation of three biological replicates.

[0181] Table 5. Results of enzyme activity detection of Q10 synthetic elements in Comparative Example D5

[0182] Comparative Example D6

[0183] Comparative Example D6 used the same detection method as Experimental Example 1 to detect the enzyme activity products of rice Q10 synthetic elements OsH and OsI provided in Examples A8-A9. Simultaneously, a comparative strain was prepared using the same method as that used to transfer the rice Q10 synthetic element OsE provided in Example A5. The results are shown in Table 6, where the data represent the mean ± standard deviation of three biological replicates.

[0184] Table 6. Detection results of Q10 synthetic element enzyme activity products in Comparative Example D6

[0185] Comparative Example D7

[0186] Comparative Example D7 used the same detection method as Experimental Example 1 to detect the enzyme activity product of the maize Q10 synthetic element ZmF provided in Example D6. Simultaneously, a comparative strain was prepared using the same method as that used for transferring the maize Q10 synthetic element ZmE provided in Example D5. The results are shown in Table 7, where the data represent the mean ± standard deviation of three biological replicates.

[0187] Table 7. Detection results of enzyme activity products of Q10 synthetic elements in Comparative Example D7

[0188] Comparative Example D8

[0189] Comparative Example D8 used the same detection method as Experimental Example 1 to detect the enzyme activity product of the wheat Q10 synthetic element TaF provided in Example E6. Simultaneously, a comparative strain was prepared using the same method as that used to transfer the wheat Q10 synthetic element TaE provided in Example E5. The results are shown in Table 8, where the data represent the mean ± standard deviation of three biological replicates.

[0190] Table 8. Detection results of enzyme activity products of Q10 synthetic elements in Comparative Example D8

[0191] The above results fully demonstrate that the amino acid sequence of the plant Q10 synthesis element can be altered by changing amino acid residues M or I to L, V, F, Y, or C at position 240 of rice Coq1, and / or by changing amino acid residue A to V at position 243 of rice Coq1, and / or by changing amino acid residue I to M at position 255 of rice Coq1, and / or by changing amino acid residue S to T at position 256 of rice Coq1, and / or by changing amino acid residue K to D or E at position 166 of rice Coq1, and / or by changing amino acid residue G to E at position 245 of rice Coq1, and / or by changing amino acid residues 145-173 and 238-263 of rice Coq1 to the corresponding sequence of tomato Coq1, thereby conferring or enhancing the plant's ability to synthesize coenzyme Q10.

[0192] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A plant Q10 synthesis element for significantly increasing the level of plant coenzyme Q10 synthesis, characterized by, The amino acid sequence of the plant Q10 synthetic element is identical to any of the following amino acid sequences: SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.61, SEQ ID NO.63, SEQ ID NO.65, SEQ ID NO.67; The plant is any one of rice, lettuce, cucumber, corn, and wheat.

2. A gene encoding a gene, characterized in that, It encodes the plant Q10 synthetic element as described in claim 1.

3. A vector containing the encoding gene as described in claim 2.

4. Recombinant bacteria or recombinant cells containing the vector described in claim 3.

5. A plant individual, plant tissue, or plant cell containing the gene described in claim 2.

6. The application of the plant Q10 synthesis element according to claim 1 in the cultivation of plants, microorganisms, and enzyme activation reaction systems for synthesizing coenzyme Q10.

7. Use according to claim 6, characterized in that, It includes: The vector is used to transform the target plant, and the vector contains a gene encoding the Q10 synthetic element of the plant.

8. Use according to claim 6, characterized in that, It includes: The endogenous Coq1 gene of the target plant is modified to encode the plant's Q10 synthetic element.

9. Use according to claim 6, characterized in that, It includes: The cells, tissues, individuals, or populations of the target plant are subjected to mutagenesis or gene editing, and through screening, they are made to encode the plant's Q10 synthetic element.

10. Use according to any one of claims 6 to 9, characterized in that, The target plant is any one of wheat, rice, corn, cucumber, and lettuce.