Application of Sialin protein or reagent targeting Sialin protein Gln325 site in preparation of medicine for treating Alzheimer's disease

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a sialic acid transporter (Sialin) or a reagent targeting a Sialin protein Gln325 site in preparation of a medicine for treating the Alzheimer's disease. The invention finds that the Sialin protein or the Gln325 site of the Sialin protein can be used as a therapeutic target for treating the Alzheimer's disease, and tests find that overexpression of the Sialin protein can improve various characteristic pathologies of cognitive impairment, myelin sheath reduction and A beta increase of the Alzheimer's disease. Therefore, not only is a new function of the Sialin protein found, but also an accurate target spot capable of treating the Alzheimer's disease is found, and an important technical support is provided for treatment of the Alzheimer's disease and drug development.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the use of Sialin protein or a reagent targeting the Gln325 site of Sialin protein in the preparation of a drug for treating Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD) is a neurodegenerative disease mainly characterized by progressive cognitive decline, and its characteristic pathological changes include Aβ deposition, synaptic protein loss, myelin protein reduction, etc. In recent years, the prevalence of AD has been increasing year by year globally. However, there is currently no standard therapy for AD in clinical practice, and the drugs for AD have drawbacks such as insignificant effects and potential side effects. The reason may be that most of the existing therapeutic drugs lack precise targets, that is, these drugs do not precisely intervene in specific and key molecular or cellular links in the pathogenesis of AD, but rather act in a relatively broad manner and cannot precisely target the core problems leading to the occurrence and development of AD for targeted treatment. By precisely analyzing the targets, drugs or treatment strategies can be designed more specifically to directly act on the key molecular mechanisms, thereby enhancing the effectiveness of treatment. Therefore, there is an urgent need to conduct research on precise targets for AD treatment.

[0003] Sialin (sialic acid transporter) is a nitrate transport channel on the mammalian cell membrane and is mainly expressed in neurons in the central nervous system. In the central nervous system, Sialin can mediate a variety of cell biological functions. The fact that Sialin plays numerous functions is mainly related to the complexity of its structure. The Sialin protein has 12 transmembrane segments, with multiple extracellular and intracellular segments as well as transmembrane regions. Therefore, different segments and different sites of Sialin may be responsible for different functions. However, at present, the functions of different segments and different sites of Sialin have not been deeply explored. Clarifying the functions of each site of Sialin can provide more targeted strategies for targeted intervention and regulation of Sialin. In particular, it is urgent to clarify the precise site analysis of Sialin related to the pathogenesis and pathology of AD. Summary of the Invention

[0004] The object of the present invention is to provide the use of Sialin protein or a reagent targeting the Gln325 site of Sialin protein in the preparation of a drug for treating Alzheimer's disease. The Sialin protein or the Gln325 site of Sialin protein can be used as a therapeutic target for treating Alzheimer's disease, and overexpression of Sialin protein can improve various characteristic pathologies such as cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease.

[0005] The present invention provides the use of Sialin protein in the preparation of a medicament for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0006] The present invention also provides the use of a reagent targeting the Gln325 site of Sialin protein in the preparation of a medicament for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0007] Preferably, the medicament includes a medicament having one or more pathological functions of improving cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease.

[0008] The present invention also provides the use of a reagent for overexpressing Sialin protein in the preparation of a medicament for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0009] Preferably, the reagent for overexpressing Sialin protein includes a recombinant plasmid containing the Slc17a5 gene and / or an adeno-associated virus containing the Slc17a5 gene; the Slc17a5 gene is the gene encoding the Sialin protein.

[0010] Preferably, the initial plasmid of the recombinant plasmid containing the Slc17a5 gene includes an adeno-associated virus vector plasmid.

[0011] Preferably, the adeno-associated virus vector plasmid includes GV503, and the Slc17a5 gene is inserted between the Nhe I and HindIII restriction enzyme sites of GV503.

[0012] Preferably, the medicament includes a medicament having one or more pathological functions of improving cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease.

[0013] The present invention also provides a medicament for treating Alzheimer's disease, and the active ingredient of the medicament includes a reagent for overexpressing Sialin protein and / or a reagent targeting the Gln325 site of Sialin protein; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0014] Preferably, the reagent for overexpressing Sialin protein includes a recombinant plasmid containing the Slc17a5 gene and / or an adeno-associated virus containing the Slc17a5 gene; the Slc17a5 gene is the gene encoding the Sialin protein.

[0015] Advantageous effects:

[0016] The present invention provides the use of Sialin protein or a reagent targeting the Gln325 site of Sialin protein in the preparation of a medicament for treating Alzheimer's disease. The present invention discovers that Sialin protein or the Gln325 site of Sialin protein can be used as a therapeutic target for treating Alzheimer's disease, and through experiments, it is found that overexpression of Sialin protein can improve various characteristic pathologies such as cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease; while mutating the 325th amino acid of Sialin protein from glutamine Q to glycine A will cause cytoskeleton collapse and exacerbate the reduction of myelin basic protein (MBP) and increase in phosphorylated tubulin polymerization-promoting protein (p-TPPP) in the AD cell model (it is known that an increase in p-TPPP level can lead to cytoskeleton disorder and a decrease in the synthesis of myelin basic protein MBP). It can be seen that the present invention not only discovers a new function of Sialin protein, but also discovers an accurate target for treating Alzheimer's disease, providing important technical support for the treatment and drug development of Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0018] Figure 1 Electrophoresis gel diagram of the amplified product of the target fragment in Example 1;

[0019] Figure 2 Electrophoresis gel diagram of the PCR amplification identification of the recombinant plasmid vector in Example 1;

[0020] Figure 3 Result diagram of neuron-specific overexpression of Slc17a5 in Example 3, where "**" in Figure C indicates significant difference P < 0.01;

[0021] Figure 4 Result diagram of neuron-specific Slc17a5 overexpression improving AD pathology and cognitive behavioral disorders in Example 3, where "*", "**", "***", "****", and "#" respectively represent P < 0.05, P < 0.01, P < 0.001, P < 0.0001, and P < 0.05;

[0022] Figure 5 Result diagram of the interaction between Sialin protein and p-TPPP in the COIP experiment in Example 3;

[0023] Figure 6 Result diagram of discovering the interaction between the Gln325 site of Sialin protein and p-TPPP by machine learning method in Example 4;

[0024] Figure 7 The lentivirus (LV-sialin-p.Q325A) with the Sialin Gln325 mutation (the 325th amino acid of the Sialin protein is mutated from glutamine Q to glycine A) in Example 4 was successfully transfected into the SY5Y cell line, where the scale bar is 100 μm;

[0025] Figure 8 It is a result diagram that the Sialin Gln325 mutation in Example 4 causes a decrease in the interaction between Sialin and p-TPPP on one side and an increase in p-TPPP, where "*" and "**" represent P < 0.05 and P < 0.01 respectively;

[0026] Figure 9 It is a result diagram that the Sialin Gln325 mutation in Example 4 causes the collapse of the SY5Y cell cytoskeleton, where the scale bar is 10 μm;

[0027] Figure 10 It is that the Sialin Gln325 mutation in Example 4 exacerbates the reduction of myelin basic protein MBP and the increase in p-TPPP in the AD cell model, where "*", "**", "***" and "#" represent P < 0.05, P < 0.01, P < 0.001 and P < 0.05 respectively. Detailed implementation mode

[0028] The present invention provides the application of the Sialin protein in the preparation of drugs for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0029] The present invention also provides the application of a reagent targeting the Gln325 site of the Sialin protein in the preparation of drugs for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82. The Gln325 site of the Sialin protein of the present invention can bind to phosphorylated tubulin polymerization promoting protein (p-TPPP) and reduce the phosphorylation of TPPP (it is known that an increase in the level of p-TPPP can lead to cytoskeleton disorder and a decrease in the synthesis of myelin basic protein MBP), so as to improve the pathological conditions such as myelin reduction and Aβ increase in AD.

[0030] As an implementation mode, the drug of the present invention includes drugs having one or more pathological functions of improving cognitive impairment, myelin reduction and Aβ increase in Alzheimer's disease; as another implementation mode, the drug is a drug having the pathological functions of improving cognitive impairment, myelin reduction and Aβ increase in Alzheimer's disease.

[0031] The present invention provides the use of a reagent for overexpressing Sialin protein in the preparation of a medicament for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0032] As an embodiment, the reagent for overexpressing Sialin protein includes a recombinant plasmid containing the Slc17a5 gene and / or an adeno-associated virus containing the Slc17a5 gene; the Slc17a5 gene is the gene encoding the Sialin protein. As an embodiment, the accession number of the Slc17a5 gene in NCBI is NM_172773.

[0033] As an embodiment, the initial plasmid of the recombinant plasmid containing the Slc17a5 gene can be an adeno-associated virus vector plasmid; as another embodiment, the adeno-associated virus vector plasmid can be GV503, and the element sequence of GV503 is hSyn promoter-EGFP-MCS-SV40 PolyA; the promoter of hSyn in GV503 can enable the recombinant plasmid containing the Slc17a5 gene to better target neurons; as another embodiment, the Slc17a5 gene is inserted between the Nhe I and Hind III restriction enzyme sites in GV503. As an embodiment, the adeno-associated virus containing the Slc17a5 gene is obtained by packaging the recombinant plasmid containing the Slc17a5 gene with adeno-associated virus; the packaging method is not particularly limited, and the conventional adeno-associated virus packaging method in the art can be used.

[0034] As an embodiment, the medicament can be a medicament having one or more of the pathological functions of improving cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease; as another embodiment, the medicament can be a medicament having the pathological functions of improving cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease.

[0035] As an embodiment, the medicament can be a medicament having one or more of the pathological functions of improving cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease; as another embodiment, the medicament can be a medicament having the pathological functions of improving cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease. The present invention also provides a medicament for treating Alzheimer's disease, and the active ingredient of the medicament includes a reagent for overexpressing Sialin protein and / or a reagent targeting the Gln325 site of Sialin protein; the accession number of the Sialin protein in the UniProt database is Q8BN82.

[0036] As an implementation manner, the active ingredient of the drug can be a reagent that expresses the Sialin protein or a reagent that targets the Gln325 site of the Sialin protein.

[0037] As an implementation manner, the reagent for overexpressing the Sialin protein includes a recombinant plasmid containing the Slc17a5 gene and / or an adeno-associated virus containing the Slc17a5 gene; the Slc17a5 gene is the gene encoding the Sialin protein; the relevant definitions of the recombinant plasmid containing the Slc17a5 gene and the adeno-associated virus containing the Slc17a5 gene have been defined in the above solutions and will not be elaborated here.

[0038] To further illustrate the present invention, the technical effects provided by the present invention will be described in detail below in conjunction with the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example 1

[0040] The construction method of a neuron-specific adeno-associated virus (AAV) overexpressing the Slc17a5 gene is as follows:

[0041] The gene name is: Slc17a5, and the accession number in the NCBI database is NM_172773; the species is Mouse.

[0042] 1 Experimental materials:

[0043] 1.1 The main reagents are shown in Table 1.

[0044] Table 1 Main reagents

[0045] Reagent Name Reagent Source Product Number 1kp DNA ladder Marker Fermentas #SM0311 250bp DNA ladder Marker Jierui DL250+, 100T Agarose Saibaisheng GA4-100 <![CDATA[In-Fusion TM PCR Cloning Kit]]> clontech 639626 Taq polymerase SinoBio E001-02B dNTP Takara D4030A Primer Jierui Bio / Restriction Endonuclease NEB / Plasmid Extraction Kit Promega A1460 Agarose Gel DNA Recovery Kit Tiangen Biochemical DP209-03

[0046] 1.2 The main instruments and equipment are shown in Table 2.

[0047] Table 2 Main instruments and equipment

[0048]

[0049]

[0050] 2 Vector digestion

[0051] The vector is named GV503 and is purchased from Shanghai Genechem Co., Ltd. The vector construction method is as follows:

[0052] First, the element order on the vector is hSyn promoter - EGFP - MCS - SV40 PolyA, the cloning sites are NheI / HindIII, and the number is CON323.

[0053] The GV503 vector was digested with Nhe I and HindIII at 37°C for 1 hour.

[0054] 3. Acquisition of target gene fragments

[0055] Upstream primer Slc17a5 (95020-1)-p1: 5'-ACGAGCTGTACAAGGCTAGCATGAGGCCCCTGCTTCGGGG-3' (SEQ ID NO: 1); downstream primer Slc17a5 (95020-1)-p2: 5'-CG ATAACCGGTTTAAAGCTTTCAGTTTCTGTGTCCGTGGTGGTC-3' (SEQ ID NO: 2).

[0056] Primer description: The above primers contain exchange pairing bases, restriction sites, and partial sequence of the 5' end of the target gene for PCR to fish for the target gene.

[0057] The cDNA template of Slc17a5 was PCR amplified using the upstream primer Slc17a5(95020-1)-p1 and the downstream primer Slc17a5(95020-1)-p2 to obtain the PCR amplification product, and the obtained amplification product was detected by gel electrophoresis. The results are as follows Figure 1 As shown, the left lane is the target fragment, and the right lane represents the Marker, and the Markers from top to bottom are: 5kb, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp and 100bp.

[0058] Depend on Figure 1 It can be concluded that the size of the PCR amplification product is 1528bp.

[0059] 4. Recombinant plasmid construction

[0060] 4.1 Product exchange into linearized expression vector: The PCR amplification product obtained in step 3 is inserted into the linear expression vector obtained in step 2 through product exchange to obtain a recombinant plasmid vector.

[0061] 4.2 PCR identification primers

[0062] KL95020-p3: 5'-GCTTCTTACCATTTCCTATG-3' (SEQ ID NO: 3); KL95020-p4: 5'-AGCGTAAAAGGAGCAACATAG-3' (SEQ ID NO: 4).

[0063] 4.3 PCR identification results

[0064] The recombinant plasmid vector obtained in step 4.1 was identified by PCR amplification using the PCR identification primers in step 4.2, with ddH 2 O as the blank control and the self-ligation of the empty vector as the negative control. The gel electrophoresis results obtained are as Figure 2 shown, where lane 1 represents the blank control (ddH 2 O); lane 2 represents the negative control (self-ligation of the empty vector); lane 3 represents the positive control (GAPDH); lane 4 represents the Marker, from top to bottom are 5 kb, 3 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp and 100 bp; lanes 5-12 represent the transformants of No. 1-8.

[0065] It can be seen that the size of the PCR product of the positive transformant is 992 bp.

[0066] 5 Sequencing results and result analysis of positive clones

[0067]

[0068] The sequencing results were confirmed to be correct by sequencing alignment, and a recombinant expression vector containing the Slc17a5 gene was obtained.

[0069] 6 The Slc17a5 gene was inserted into the AAV9 expression vector to package the recombinant expression vector containing the Slc17a5 gene obtained in step 5, and an adeno-associated virus with neuron-specific overexpression of the Slc17a5 gene (AAV-Slc17a5) was obtained.

[0070] 7 The viral titer of the adeno-associated virus with neuron-specific overexpression of the Slc17a5 gene in step 6 was measured by fluorescence quantitative PCR (Real-Time PCR), and the result showed that the titer was 6.23E+13 v.g. / mL.

[0071] Example 2

[0072] The construction method of the Sialin Gln325 mutant lentivirus is as follows:

[0073] Gene name: SLC17A5, accession number in NCBI is NM_012434.5 (Q325A), species is Human.

[0074] 1 The experimental materials are the same as those in Example 1.

[0075] 2 Vector digestion

[0076] The vector name is defined as the GV492 vector, purchased from Shanghai GeneChem Co., Ltd. The construction method is as follows:

[0077] First, the element order on the vector is Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin, the cloning sites are the BamH I / Age I vector, and the number is CON335.

[0078] The GV492 vector was digested. The digestion sites were BamH I and Age I, and the digestion condition was 37 °C for 1 hour. The digested vector was run on an electrophoresis for identification to obtain the digested linear expression vector.

[0079] 3 Obtaining the target gene fragment

[0080] Upstream primer SLC17A5(103509-1)-p1: 5′-AGGTCGACTCTAGAGGATCCCGCCACCATGAGGTCTCCGGTTCGAGAC-3′ (SEQ ID NO: 6); downstream primer SLC17A5(103509-1)-p2: 5′-TCCTTGTAGTCCATACCGGTGTGTCTGTGTCCATGGTGATCAT TG-3′ (SEQ ID NO: 7).

[0081] Primer description: The above primers contain exchange pairing bases, restriction sites, and partial sequence of the 5' end of the target gene for PCR to fish for the target gene.

[0082] The SLC17A5 cDNA template was amplified by PCR using the upstream primer SLC17A5(103509-1)-p1 and the downstream primer SLC17A5(103509-1)-p2 to obtain the PCR amplification product.

[0083] 4. Recombinant plasmid construction

[0084] 4.1 Product exchange into linearized expression vector: The PCR amplification product obtained in step 3 is inserted into the linear expression vector obtained in step 2 through product exchange to obtain a recombinant plasmid vector.

[0085] 4.2 PCR identification primers

[0086] KL103509-p3: 5'-ACTTCTTAGCATTCATATG-3' (SEQ ID NO: 8); KL103509-p4: 5'-CTATTGGCGTTACTATTGACG-3' (SEQ ID NO: 9).

[0087] 4.3 PCR identification

[0088] Perform PCR amplification and identification of the recombinant plasmid vector obtained in step 4.1 using the PCR identification primers in step 4.2.

[0089] 5. Sequencing results and analysis of positive clones

[0090] Sequence the positive clones obtained in step 4, and the result is shown in SEQ ID NO:10, specifically: 5'-CTTGGGCTGCAGGTCGACTCTAGAGGATCCCGCCACCATGAGGTCTC CGGTTCGAGACCTGGCCCGGAACGATGGCGAGGAGAGCACGGACCGCACGCCTCTTCTACCGGGCGCCCCACGGGCCGAAGCCGCTCCAGTGTGCTGCTCTGCTCGTTACAACTTAGCAATTTTGGCCTTTTTTGGTTTCTTCATTGTGTATGCATTACGTGTGAATCTGAGTGTTGCGTTAGTGGATATGGTAGATTCAAATACAACTTTAGAAGATAATAGAACTTCCAAGGCATGTCCAGAGCATTCTGCTCCCATAAAAGTTCATCATAATCAAACGGGTAAGAAGTACCAATGGGATGCAGAAACTCAAGGATGGATTCTCGGTTCCTTTTTTTATGGCTACATCATCACACAGATTCCTGGAGGATATGTTGCCAGCAAAATAGGGGGGAAAATGCTGCTAGGATTTGGGATCCTTGGCACTGCTGTCCTCACCCTGTTCACTCCCATTGCTGCAGATTTAGGAGTTGGACCACTCATTGTACTCAGAGCACTAGAAGGACTAGGAGAGGGTGTTACATTTCCAGCCATGCATGCCATGTGGTCTTCTTGGGCTCCCCCTCTTGAAAGAAGCAAACTTCTTAGCATTTCATATGCAGGAGCACAGCTTGGGACAGTAATTTCTCTTCCTCTTTCTGGAATAATTTGCTACTATATGAATTGGACTTATGTCTTCTACTTTTTTGGTACTATTGGAATATTTTGGTTTCTTTTGTGGATCTGGTTAGTTAGTGACACACCACAAAAACACAAGAGAATTTCCCATTATGAAAAGGAATACATTCTTTCATCATTAAGAAATCAGCTTTCTTCACAGAAGTCAGTGCCGTGGGTACCCATTTTAAAATCCCTGCCACTTTGGGCTATCGTAGTTGCACACTTTTCTTACAACTGGACTTTTTATACTTTATTGACATTATTGCCTACTTATATGAAGGAGATCCTAAGGTTCAATGTTGCCGAGAATGGGTTTTTATCTTCATTGCCTTATTTAGGCTCTTGGTTATGTATGATCCTGTCTGGTCAAGCTGCTGACAATTTAAGGGCAAAATGGAATTTTTCAACTTTATGTGTTCGCAGAATTTTTAGCCTTATAGGAATGATTGGACCTGCAGTATTCCTGGTAGCTGCTGGCTTCATTGGCTGTGATTATTCTTTGGCCGTTGCTTTCCTAACTATATCAACAACACTGGGAGGCTTTTGCTCTTCTGGATTTAGCATCAACCATCTGGATATTGCTCCTTCGTATGCTGGTATCCTCCTGGGCATCACAAATACATTTGCCACTATTCCAGGAATGGTTGGGCCCGTCATTGCTAAAAGTCTGACCCCTGATAACACTGTTGGAGAATGGCAAACCGTGTTCTATATTGCTGCTGCTATTAATGTTTTTGGTGCCATTTTCTTTACACTATTCGCCAAAGGTGAAGTACAAAACTGGGCTCTCAATGATCACCATGGACACAGACACACCGGTATGGACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAATGAGCTAGCA-3', The G base at the italicized position of 283 bp in SEQ ID NO: 10 was synonymously mutated to base A. The yellow annotation is the upstream primer SLC17A5(103509-1)-p1 sequence, and the green annotation is the reverse complementary pairing sequence of the downstream primer SLC17A5(103509-1)-p2. The amino acid sequence did not change.

[0091] The sequencing result was confirmed to be correct by sequencing alignment, and a recombinant expression vector containing the SLC17A5 gene was obtained.

[0092] Expression Detection of Recombinant Expression Vector Containing SLC17A5 Gene

[0093] 6.1 Western Blot Plasmid Expression Detection.

[0094] 6.2 Experimental Information

[0095] The target cells are 293T, and the culture medium is DMEM medium (containing 10% fetal bovine serum).

[0096] The antibodies used are shown in Table 3.

[0097] Table 3 Antibody Information

[0098] Serial Number Antibody Antibody Name Company Catalog Number Dilution Ratio 1 Primary Antibody FLAG Wuhan Dianan Bio 2064 1:2000 2 Secondary Antibody Mouse santa-cruz sc-2005 1:4000

[0099] 6.3 Western Blot Experimental Parameters

[0100] Concentration of SDS-PAGE separating gel: 10%; Protein loading amount: 20 μg; Color development system: ECL method combined with X-ray film.

[0101] 6.4 Western Blot Experiment

[0102] The specific steps are as follows: Add the protein sample into the wells of the gel (GenScript, M00666), perform electrophoresis at a voltage of 80V - 120V for 1 - 2 hours until the dye front approaches the bottom of the gel. Subsequently, place the gel and PVDF membrane (Millipore, IPVH00010) in the transfer buffer (Beyotime, P0021A), and assemble them in the order of "black (negative electrode) - sponge - filter paper - gel - membrane - filter paper - sponge - red (positive electrode)". Transfer conditions: 100V, 1 hour. Next, block the membrane with western blocking solution (Beyotime, P0023B) and incubate at room temperature for 1 hour. Primary antibody incubation: Dilute the primary antibody with TBST buffer (Beyotime, ST673) according to the antibody instruction manual and incubate at 4°C for 8 - 12 hours. The next day, wash the membrane 3 times with TBST washing buffer, 10 minutes each time. Secondary antibody incubation: Add the secondary antibody (Beyotime, A0208 and A0216) matching the primary antibody and incubate at room temperature for 1 hour. Wash again: Wash the membrane 3 times with TBST, 10 minutes each time. Finally, incubate the membrane with ECL reagent (Millipore, WBKLS0500) and then put it into the exposure machine for imaging.

[0103] 6.5 Experimental Results

[0104] 6.5.1 Fluorescence Observation of Cells after Transfection

[0105] Fluorescence expression result: strong; Explanation of fluorescence expression result: After transfection, obvious fluorescence can be observed in the cells, indicating that the transfection of the target plasmid is normal and the fluorescence-labeled gene of the target plasmid is expressed normally.

[0106] 7 Insert the SLC17A5 gene into the AAV9 expression vector to package the recombinant expression vector containing the SLC17A5 gene, and obtain the Sialin Gln325 mutant lentivirus (LV-sialin-p.Q325A).

[0107] 8 Use fluorescence quantitative PCR (Real-Time PCR) to measure the virus titer of the Sialin Gln325 mutant lentivirus in step 6. The results show that its titer is 1E+9 TU / mL.

[0108] Example 3

[0109] 1 Experimental animals:

[0110] AD model mice: APP / PS1 mice, male mice at 8-9 months old, purchased from Beijing SPF Biotechnology Co., Ltd.;

[0111] Wild-type (WT) mice: C57BL / 6, male mice at 8-9 months old, purchased from Beijing SPF Biotechnology Co., Ltd.

[0112] 2 Experimental grouping:

[0113] AAV-Vec1 group: Inject the empty vector AAV (AAV-Vec1) into wild-type (WT) mice;

[0114] AAV-Slc17a5 group: Inject AAV-Slc17a5 into wild-type (WT) mice;

[0115] APP / PS1 + AAV-Vec1 group: Inject the empty vector AAV into APP / PS1 (AD model) mice;

[0116] PP / PS1 + AAV-Slc17a5 group: Inject AAV-Slc17a5 into APP / PS1 (AD model) mice.

[0117] There are 6-10 biological replicates in each experimental group;

[0118] The injection dose for each mouse is 1×10 13 (titer), 1 μL.

[0119] 3 Inject the AAV-Slc17a5 prepared in Example 1 or the empty vector AAV into the hippocampus of AD model mice or WT mice. The specific steps are as follows: Anesthetize and fix each group of mice on a stereotaxic apparatus for the brain, incise the scalp of the head to expose the bregma, and locate, with reference to the George Paxinos mouse brain atlas, at 2.0 mm posterior to the bregma, 1.5 mm lateral to the left and right, and a vertical depth of 2.0 mm, which is the CA1 region of the hippocampus. Slowly inject AAV-Slc17a5 with a micro syringe. After the injection is completed, stop the needle for 10 min, then slowly withdraw the needle, and suture the incision, as Figure 3 shown in A of

[0120] Perform immunofluorescence detection on the mice in the AAV-Slc17a5 group. The results are as Figure 3 shown in B of Figure 3 It can be concluded from B of

[0121] Perform fluorescence quantitative detection on the mice in the AAV-Vec1 group and the AAV-Slc17a5 group. The primer sequences used are:

[0122] 1-Slc17a5 upstream primer: 5'-GAAACGACGATGAGGAGAGC-3' (SEQ ID NO: 11); 2-Slc17a5 downstream primer: 5'-AACCACAGAACGCCAAAATC-3' (SEQ ID NO: 12). The results are as Figure 3 shown in C of Figure 3 It can be concluded from C of

[0123] Perform immunofluorescence detection on the mice in the AAV-Vec1 group and the AAV-Slc17a5 group. The results are as Figure 3 shown in D of Figure 3 It can be concluded from D of

[0124] Based on the comprehensive Figure 3 results above, it can be concluded that the specific overexpression of Slc17a5 in neurons is successful, and its overexpression efficiency and neuron specificity are both high.

[0125] 4 Novel object recognition (NOR) test

[0126] One day before the experiment, the mice were first placed in a novel object recognition box (50 cm × 50 cm × 50 cm) without objects and allowed to freely explore for 10 min. On the second day, the formal experiment was carried out. First, two objects with exactly the same size, shape, material, etc. were placed in the novel object recognition box, and the mice were allowed to freely explore for 10 min. After 1 - 2 h, one of the objects was replaced with an object of different shape but the same other traits. The mice were then continued to be placed in the box and allowed to freely explore for 5 min. The exploration time of the animals for the new and old objects, as well as the animal trajectories, were recorded. The test results were expressed by the discrimination index (DI), and DI = (exploration time of new object - exploration time of old object) / (exploration time of new object + exploration time of old object).

[0127] The mice in each group in step 2 were subjected to the NOR test according to the above steps, and the results were as Figure 4 shown in A and B in

[0128] 5 Y - Maze test

[0129] Install the Y - Maze device (3 equal - length arms and an intermediate area), and then the animals were placed in it for the spontaneous alternation experiment. Each mouse was placed in from the same arm and allowed to perform spontaneous alternation for 8 min. The spontaneous alternation rate was detected: alternation rate % = number of alternations / (total number of entries - 2) %. After each mouse finished, it was put back into the cage, and at the same time, the Y - Maze was wiped with 75% alcohol to remove the odor. The smart 3.0 software was used to collect images and analyze data.

[0130] The mice in each group in step 2 were subjected to the Y - Maze test according to the above steps, and the results were as Figure 4 shown in C in

[0131] 6 Western blot detection

[0132] The hippocampal tissues of the mice were added to RIPA tissue lysate supplemented with protease inhibitors and protein phosphatase inhibitors, homogenized and sonicated, and then the tissue lysates were centrifuged at 4℃ and 12500 rpm for 30 min. The supernatant was transferred to a new tube, and the total protein concentration was analyzed using the BCA protein assay kit from Thermo Fisher Scientific, and then boiled at 100℃. The protein concentration was measured, and equal amounts of samples were separated by 8% - 10% SDS - PAGE.

[0133] Next, the protein samples were transferred to PVDF membranes. After a 10 - min blocking step with a rapid blocking solution, the membranes were incubated with the primary antibody oAβ at 4℃ 1-42(CST, 14974), MOG (CST, 96457), and MBP (CST, 78896) were incubated overnight. Subsequently, the membrane was washed three times with TBST and then incubated with an HRP-conjugated secondary antibody for 1 hour. The membrane was washed three times again with TBST, and then protein bands were visualized using an enhanced chemiluminescence detection reagent and a Bio-Rad Gel Doc XR+ system (Bio-Rad). oAβ 1-42 , MOG, and MBP were quantified. The ratio of the band density value to the corresponding β-actin level was used as the final value for the band.

[0134] The mice in each group in step 2 were subjected to the above steps, and the results were as Figure 4 shown in D - G below.

[0135] Based on the test results in steps 4 - 6, it can be concluded that overexpression of Sialin can improve the cognitive behavioral disorders in AD model mice, including improving the DI value of NOR and the free alternation rate in the Y-Maze; at the same time, overexpression of Sialin can also improve the pathological features such as the reduction of myelin proteins MBP and MOG and the increase of Aβ in AD model mice. It can be seen that the present invention has discovered a new function of Sialin protein in improving cognitive impairment in AD model mice.

[0136] 7 COIP experiment

[0137] Hippocampal tissues of mice in the WT group were obtained, lysed and homogenized with lysis buffer, and incubated overnight at 4°C with a Sialin antibody (Thermo Fisher, PA5-30517). The next day, the protein-antibody complex obtained from the incubation was incubated with magnetic beads at 4°C for 1 h to bind the magnetic beads to the protein-antibody complex. Then, it was washed 3 times with the elution buffer, and the magnetic beads and the protein-antibody complex were separated. SDS polyacrylamide gel electrophoresis was used to detect the expression of p-Tppp, and the results were as Figure 5 shown below.

[0138] 8. Detection of p-TPPP

[0139] Since there is no commercial p-Tppp antibody on the market, in this example, a phosphorylated gel was used to detect the brain tissues of WT mice. When preparing the gel, 50 μmol / L Phos-tag Acrylamide and 0.1 mmol / L MnCl 2Before transferring the gel, it is necessary to wash the gel in the electrotransfer solution containing 10 mmol / L EDTA on a shaker for 10 min / 3 times to remove manganese ions from the gel, so as to improve the transfer efficiency of phosphorylated and non-phosphorylated proteins to the PVDF membrane. After blocking, incubate with the anti-Tppp primary antibody (abcam, ab92305), and incubate with the secondary antibody the next day. When exposing, the target proteins with a molecular weight greater than 25 kD (the molecular weight of non-phosphorylated Tppp is 25 kD) are phosphorylated Tppp. The results are as Figure 5 shown.

[0140] It can be Figure 5 concluded that since p-TPPP can be incubated in the IP: Sialin group, it can be proved that Sialin protein can interact with p-TPPP.

[0141] Example 4

[0142] Construction of the 1AD cell model:

[0143] Add the lentivirus (LV-sialin-p.Q325A) with the Sialin Gln325 mutation constructed in Example 2 into the human neuroblastoma cell (SY5Y) cell line, and perform Aβ treatment (MCE, HY-P1363) to construct the AD cell model. Specifically: add 1 mM / L of Aβ to the SY5Y cell line transfected with the lentivirus and treat for 24 h to obtain the AD cell model (the construction of the AD cell model refers to the following literature

pubmed number PMID: 37355221

[0144] 2 Application of machine learning to predict the binding site between Sialin and p-TPPP

[0145] To predict the interaction sites between Sialin and TPPP, this example adopted a method that combines deep learning and multiple sequence alignment (MSA), called DeepMSA2 (Reference [Zheng, W., Wuyun, Q., Li, Y., Zhang, C., Freddolino, P. L., and Zhang, Y. (2024). Improving deep learning protein monomer and complex structure prediction using DeepMSA2 with huge metagenomics data. NAT METHODS 21, 279 - 289.]), and an integrated geometric deep learning model called ScanNet (Reference [Tubiana, J., Schneidman - Duhovny, D., and Wolfson, H. J. (2022). ScanNet: an interpretable geometric deep learning model for structure - based protein binding site prediction. NAT METHODS 19, 730 - 739.]).

[0146] To describe the binding sites within proteins, this example performed iterative alignment searches on genomic and metagenomic sequence databases. This ultimately constructed multiple sequence alignments of single - chain and multi - chain proteins. Subsequently, the MSA construction of DeepMSA2 was combined with the direct three - dimensional structure learning of ScanNet to improve the accuracy of binding site prediction. ScanNet is based on the spatial arrangement of atoms and amino acids, representing an end - to - end interpretable deep learning paradigm. The inputs of this example include primary sequences, tertiary structures, and optionally position - weight matrices from multiple sequence alignments of evolutionarily related proteins, aiming to predict the precise localization of binding sites. To optimize the design of the model in this example, the selection of DeepMSA2 results and the ScanNet filter were fine - tuned to improve the prediction accuracy. This fusion method utilized the advantages of both methods to create a robust and interpretable model for predicting protein functional sites, such as Figure 6 shown.

[0147] Through the above machine - learning method, it was found that the Gln325 site of the Sialin protein interacts with p - TPPP.

[0148] 3 Perform immunofluorescence detection on the AD cell model constructed in step 1, and the results are as Figure 7 shown.

[0149] From Figure 7 it can be concluded that the lentivirus with Sialin Gln325 mutation (LV-sialin-p.Q325A) was successfully transfected into the SY5Y cell line.

[0150] 4 Refer to the test steps in Steps 7-8 of Example 3 to detect the AD cell model, and the results are as Figure 8 shown, where A is the detection result of the COIP experiment, and B and C are the detection results of p-TPPP. From Figure 8 it can be concluded that the Sialin protein at the Gln325 site can bind to phosphorylated TPPP (p-TPPP) and reduce the phosphorylation of TPPP.

[0151] 5 Add SPY555-tubulin probe (Cytoskeleton, CY-SC203) to the culture medium of each group of SY5Y cells, with a final concentration reaching 500 nM, and perform live cell staining for 30 min. Then, change to fresh SY5Y cell culture medium and add hoechst for nuclear staining for 30 min. Then, change to normal medium and perform confocal microscopy imaging. For cytoskeletonization, use imageJ software. First, convert the image to 8-bit, and then perform cytoskeletonization. Specifically, apply progress—binary—skeletonize for cytoskeletonization and export the image. The results are as Figure 9 shown.

[0152] From Figure 9 it can be concluded that the mutation at the Gln325 site of the Sialin protein causes cytoskeleton collapse.

[0153] 6 Refer to Step 6 in Example 3 to perform Western blot detection on the AD cell model, and the results are as Figure 10 shown, where LV-Slc17a5+Aβ represents the treatment with lentivirus overexpressing Slc17a5 plus Aβ, and LV-si alin-p.Q325A+Aβ represents the treatment with lentivirus overexpressing the Sialin Gln325 mutation + Aβ. From Figure 10 it can be concluded that the mutation at the Gln325 site of the Sialin protein exacerbates the reduction of myelin basic protein MBP and the increase of p-TPPP in the AD cell model.

[0154] From the above examples, it can be concluded that the Sialin protein or the Gln325 site of the Sialin protein described in the present invention can be used as a therapeutic target for treating Alzheimer's disease, and overexpression of the Sialin protein can improve various characteristic pathologies such as cognitive impairment, myelin reduction, and increased Aβ in Alzheimer's disease.

[0155] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all of them. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of Sialin protein in preparing a drug for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

2. Use of an agent targeting the Gln325 site of the Sialin protein in the preparation of a drug for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

3. The use according to claim 1 or 2, characterized in that: The drugs include drugs having the function of improving one or more pathological functions of cognitive impairment, myelin reduction and Aβ increase in Alzheimer's disease.

4. Use of a reagent for overexpressing Sialin protein in the preparation of a drug for treating Alzheimer's disease; the accession number of the Sialin protein in the UniProt database is Q8BN82.

5. The use according to claim 4, characterized in that: The reagent for overexpressing the Sialin protein comprises a recombinant plasmid containing the Slc17a5 gene and / or an adeno-associated virus containing the Slc17a5 gene; the Slc17a5 gene is a gene encoding the Sialin protein.

6. The use according to claim 5, characterized in that: The initial plasmid of the recombinant plasmid containing the Slc17a5 gene includes an adeno-associated virus vector plasmid.

7. The use according to claim 6, characterized in that: The adeno-associated virus vector plasmid includes GV503, and the Slc17a5 gene is inserted between the Nhe I and HindIII restriction sites of the GV503.

8. The use according to claim 4, characterized in that: The drugs include drugs having the function of improving one or more pathological functions of cognitive impairment, myelin reduction and Aβ increase in Alzheimer's disease.

9. A drug for treating Alzheimer's disease, characterized in that: The active ingredients of the drug include an agent for overexpressing the Sialin protein and / or an agent for targeting the Gln325 site of the Sialin protein; the accession number of the Sialin protein in the UniProt database is Q8BN82.

10. The drug according to claim 9, characterized in that The reagent for overexpressing the Sialin protein comprises a recombinant plasmid containing the Slc17a5 gene and / or an adeno-associated virus containing the Slc17a5 gene; the Slc17a5 gene is a gene encoding the Sialin protein.

Images