Medicine for treating acute kidney injury caused by sepsis

Abstract

The invention discloses a medicine for treating sepsis acute kidney injury. Active ingredients of the medicine are substances for promoting Sigma-1 receptor expression, substances for up-regulating Sigma-1 receptor expression level or substances for enabling individuals to express Sigma-1 receptors. The invention also discloses application of the Sigma-1 receptor as a drug target in development of a sepsis acute kidney injury treatment drug and application of the Sigma-1 receptor as a biomarker in diagnosis of sepsis acute kidney injury. The invention provides a new way for diagnosis and treatment of sepsis acute kidney injury.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and particularly relates to a drug for treating sepsis-induced acute kidney injury (AKI), the application of Sigma-1 receptor (σ-1R) in the development of drugs for treating sepsis-induced acute kidney injury, and the use of Sigma-1 receptor or its gene in the preparation of diagnostic reagents for sepsis-induced acute kidney injury. Background Art

[0002] Sepsis-induced acute kidney injury (AKI) is a common disease involving multiple interdisciplinary fields. Its symptom is a rapid decline in renal function, mainly manifested as a sudden decrease in glomerular filtration rate, leading to the accumulation of nitrogenous compounds and a rapid imbalance in water, electrolyte, and acid-base levels, triggering systemic complications. AKI has multiple inducing factors, including physical injury, reduced renal blood flow (with or without cell damage), tubular toxicity, ischemia or blockage, tubulointerstitial inflammation and swelling, and potential glomerular diseases, all of which can lead to a decrease in glomerular filtration rate. Sepsis AKI is a common disease in sepsis shock caused by severe sepsis. More than 50% of AKI cases in the intensive care unit (ICU) are caused by sepsis. Sepsis is characterized by organ dysfunction, resulting from an imbalanced response to infection, and is a common severe disease in the ICU, with a high incidence and mortality in the clinical setting. It is worth noting that sepsis AKI is different from non-sepsis AKI and has a unique pathophysiological mechanism. Therefore, sepsis AKI poses a major challenge to medical staff and has attracted increasing attention in the medical community.

[0003] Some researchers have attempted to use gene therapy to treat AKI. It has been reported that silent information regulator 2-related enzyme Sirt1 (a member protein of the Sirtuins family) has a protective effect on sepsis-induced acute kidney injury. Sirtl may reduce apoptosis in renal tissue by downregulating the expression of Caspase-3, thereby achieving the purpose of protecting renal function. However, Caspase-3 is not the only pathway, and other apoptotic pathways may also be involved.

[0004] Recent studies have shown that autophagy has a protective effect on AKI. During AKI, tubular epithelial cells will trigger autophagy. Inhibiting autophagy may exacerbate AKI, while promoting autophagy can alleviate AKI. However, the complex regulatory process of autophagy in sepsis AKI remains unclear. Summary of the Invention

[0005] In our study on autophagy in sepsis-induced AKI, we noticed that the sigma-1 receptor (σ-1R) is associated with autophagy in sepsis-induced AKI. The σ-1R is a non-opioid molecular chaperone protein (Hanner M et al. Proc Natl Acad Sci U S A. 1996;93(15):8072-8077), mainly located at the junction of mitochondria and endoplasmic reticulum, as well as in subcellular membrane components, and plays a role in various cells and tissues, including the heart, brain, liver, and lungs. In neurodegenerative diseases, the role of σ-1R in activating autophagy to eliminate damaged mitochondria or remove abnormal protein aggregates to prevent cell death has been widely studied. The role of σ-1R in autophagy regulation has been confirmed. High levels of σ-1R can cause lysosomal damage and promote autophagy, suggesting that σ-1R can be an effective molecule for autophagy activation. From the comparison of the sera of patients with common sepsis without AKI, normal healthy individuals, and patients diagnosed with sepsis acute kidney injury (AKI), we found that the level of σ-1R in the sera of AKI patients was lower than that of sepsis patients and much lower than that of normal individuals. At the same time, the serum levels of inflammatory cytokines IL-1β, IL-6, and TNF-α in AKI patients were higher than those of sepsis patients and much higher than those of normal individuals. This unexpected finding indicates that the Sigma-1 receptor may be used as a biomarker and drug target for sepsis acute kidney injury for the diagnosis of AKI and the development of therapeutic drugs for AKI. Then we used lipopolysaccharide (LPS) to induce HK-2 cells and confirmed the phenotypic functions of σ-1R, IL-1β, IL-6, and TNF-α for sepsis acute kidney injury (AKI) at the cellular level. We then treated HK-2 cells with the antagonist BD-1047 dihydrobromide of the σ-1R gene, the small molecule agonist PRE-084 hydrochloride, and the expression plasmid p-σ-1R of the σ-1R-encoding gene, and observed that the antagonist BD-1047 dihydrobromide downregulated the expression of σ-1R in HK-2 cells; the agonist PRE-084 hydrochloride and the expression plasmid p-σ-1R promoted the expression of σ-1R in HK-2 cells; the study also confirmed that σ-1R plays a crucial role in the autophagy process of sepsis AKI and may promote autophagy partly through the AMPK / mTOR signaling pathway, suggesting that agonists of the σ-1R gene and the σ-1R-encoding gene may be used to treat sepsis acute kidney injury. Based on the above research findings, the present invention includes the following technical solutions.

[0006] The first aspect of the present invention provides the use of the Sigma-1 receptor (σ-1R) in the development of therapeutic drugs for sepsis acute kidney injury, wherein the Sigma-1 receptor or its expression gene can be used as a drug target.

[0007] The second aspect of the present invention provides a drug for treating septic acute kidney injury, wherein the active pharmaceutical ingredient (API) is a substance that promotes the expression of Sigma-1 receptor, a substance that up-regulates the expression level of Sigma-1 receptor, or a substance that enables an individual to express Sigma-1 receptor.

[0008] Preferably, the above-mentioned active pharmaceutical ingredient has the function of increasing the autophagy level in septic acute kidney injury cells, and / or has the function of reducing the level of inflammatory cytokines in septic acute kidney injury cells.

[0009] Optionally, the above-mentioned active pharmaceutical ingredient is a chemical drug or a genetically engineered drug, including a Sigma-1 receptor gene agonist, a Sigma-1 receptor gene, a Sigma-1 receptor gene mRNA (the DNA sequence is shown in SEQ ID NO: 1), an expression plasmid containing the Sigma-1 receptor gene, or an expression plasmid containing the coding region (SEQ ID NO: 1) of the Sigma-1 receptor gene.

[0010] The vector of the above-mentioned expression plasmid can be any eukaryotic expression vector as long as it can mediate the expression of the target gene. The eukaryotic overexpression plasmid is, for example, pcDNA3.1.

[0011] In one embodiment, the above-mentioned active pharmaceutical ingredient is a chemical drug, a small molecule agonist PRE-084 hydrochloride (PRE-084 hydrochloride, CAS No.: 75136-54-8) of the Sigma-1 receptor gene,

[0012]

[0013] In another embodiment, the above-mentioned active pharmaceutical ingredient is a genetically engineered drug, a Sigma-1 receptor gene mRNA expression plasmid p-σ-1R with a nucleotide sequence shown in SEQ ID NO: 2.

[0014] Furthermore, the above-mentioned drug is a pharmaceutical composition, which, in addition to containing a therapeutically effective amount of the active pharmaceutical ingredient, also contains a pharmaceutically acceptable carrier.

[0015] Optionally, the above-mentioned drug is a pharmaceutical composition, which, in addition to containing a therapeutically effective amount of the above-mentioned active pharmaceutical ingredient, also contains one or more other drug ingredients for treating septic acute kidney injury.

[0016] The dosage form of the above-mentioned drug can be an injection dosage form or an oral preparation.

[0017] The third aspect of the present invention provides a Sigma-1 receptor gene expression plasmid, the nucleotide sequence of which is shown in SEQ ID NO: 2 and is named p-σ-1R herein.

[0018] The fourth aspect of the present invention provides the use of the Sigma-1 receptor gene expression plasmid p-σ-1R in the preparation of a drug for increasing the autophagy level in sepsis acute kidney injury cells and / or reducing the level of inflammatory cytokines in sepsis acute kidney injury cells.

[0019] The fifth aspect of the present invention provides the use of the Sigma-1 receptor or its gene in the preparation of a diagnostic reagent for sepsis acute kidney injury, wherein the Sigma-1 receptor or its expressed gene is used as a biomarker for judging sepsis acute kidney injury.

[0020] As a preferred embodiment of the use, when the level (concentration / content) of the Sigma-1 receptor or its gene in the biological sample of the subject to be tested is more than 17% lower than the level of the Sigma-1 receptor or its gene in non-AKI sepsis individuals, it indicates that the subject to be tested has sepsis acute kidney injury (AKI).

[0021] Further, in the above use, inflammatory cytokines IL-1β, IL-6 and / or TNF-α are also included as biomarkers for judging sepsis acute kidney injury.

[0022] Specifically, when the level (concentration / content) of IL-1β in the biological sample of the subject to be tested is more than 70% higher than the level of IL-1β in non-AKI sepsis individuals, and / or when the level (concentration / content) of IL-6 in the biological sample of the subject to be tested is more than 33% higher than the level of IL-6 in non-AKI sepsis individuals, and / or when the level (concentration / content) of TNF-α in the biological sample of the subject to be tested is more than 30% higher than the level of TNF-α in non-AKI sepsis individuals, it indicates that the subject to be tested has sepsis acute kidney injury (AKI).

[0023] The above biological sample can be selected from the following group: whole blood, plasma, serum, saliva, oral mucosa, nasopharyngeal secretion, tissue fluid, body fluid, urine, and serum is more preferred.

[0024] The sixth aspect of the present invention provides a diagnostic kit for sepsis acute kidney injury for implementing the above-mentioned use, wherein the detection target is the Sigma-1 receptor (σ-1R) in the biological sample.

[0025] The detection method of the above diagnostic kit is to measure the protein content or gene level of the Sigma-1 receptor (σ-1R) in the biological sample.

[0026] In a preferred embodiment, the above AKI diagnostic kit measures the content of antigen Sigma-1 receptor (σ-1R) in a biological sample by using the principle of antibody-antigen affinity binding, including:

[0027] (1) An antibody capable of binding to Sigma-1 receptor (σ-1R); and

[0028] (2) A standard sample composed of a solution containing a known amount of Sigma-1 receptor (σ-1R), wherein the Sigma-1 receptor (σ-1R) is Sigma-1 receptor (σ-1R) protein extracted from humans or mammals or recombinant Sigma-1 receptor (σ-1R) protein produced by fermentation of genetically engineered bacteria.

[0029] Optionally, the above AKI diagnostic kit is a latex immunoturbidimetry kit, a magnetic particle chemiluminescence kit, a radioimmunoassay kit, or an immunochromatographic test strip.

[0030] Further, the above AKI diagnostic kit further includes: (3) A labeled antibody capable of binding to Sigma-1 receptor (σ-1R) when Sigma-1 receptor (σ-1R) binds to the antibody defined in (1).

[0031] In one embodiment, the above AKI diagnostic kit is a sandwich ELISA kit and can be selected from the following methods:

[0032] A. An enzyme-linked immunosorbent assay kit;

[0033] B. A magnetic particle chemiluminescence kit;

[0034] C. An immunochromatographic test strip.

[0035] Preferably, the above-mentioned any kit further includes an instruction manual.

[0036] The above instruction manual can be written on bottles, test tubes and the like, plates, or on a separate piece of paper, or on the outside or inside of the container, for example, a paper piece with a QR code for downloading an operation demonstration video APP. The instruction manual can also be in a multimedia form, such as a CD, a USB flash drive, a network disk, etc.

[0037] The present invention first discovers that Sigma-1 receptor is closely related to sepsis-induced acute kidney injury (AKI) and can be used as a biomarker for this disease. At the same time, based on this discovery, Sigma-1 receptor has the potential to be used as a drug target for developing drugs for the treatment of sepsis-induced acute kidney injury, providing a new approach for the diagnosis and treatment of sepsis-induced acute kidney injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1Shows the statistical results of detecting the levels of σ-1R and inflammatory cytokines in sepsis and sepsis AKI patients by enzyme-linked immunosorbent assay (ELISA). Among them, A - D are the serum levels of σ-1R, IL-1β, IL-6, and TNF-α respectively; *P < 0.05, **P < 0.01.

[0039] Figure 2 Shows the expression of σ-1R and inflammatory cytokines in LPS (lipopolysaccharide)-induced HK-2 cells. Among them, (A) qRT-PCR was used to detect the mRNA level of σ-1R; (B) Western blot was used to detect the protein level of σ-1R; (C - E) ELISA was used to detect the levels of IL-1β, IL-6, and TNF-α; *P < 0.05, **P < 0.01, compared with the control group (Ctrl, HK-2 cells not treated with LPS).

[0040] Figure 3 Shows the regulation of σ-1R expression by siRNA or overexpression plasmid p-σ-1R in LPS-induced HK-2 cells. Among them, (A) qRT-PCR was used to detect the inhibitory effect of siRNA (si-σ-1R-1, si-σ-1R-2, and si-σ-1R-3) on the mRNA level of σ-1R, **P < 0.01, compared with cells transfected with si-NC. (B) Western blot was used to detect the inhibitory effect of si-σ-1R on the protein level of σ-1R, *P < 0.05, compared with cells transfected with si-NC. (C) qRT-PCR was used to detect the upregulation of the mRNA level of σ-1R by overexpression plasmid p-σ-1R, **P < 0.01, compared with HK-2 cells transfected with p-NC. (D) Western blot was used to detect the upregulation of the protein level of σ-1R by p-σ-1R, **P < 0.01, compared with cells transfected with p-NC.

[0041] Figure 4 Shows the statistical results of ELISA detecting the regulation of inflammatory cytokine levels by σ-1R in LPS-induced HK-2 cells. Among them, (A - C) are the levels of IL-1β, IL-6, and TNF-α, **P < 0.01, compared with cells transfected with si-NC, # P < 0.05, ## P < 0.01, compared with cells transfected with p-NC.

[0042] Figure 5Shows the effect of σ-1R on the proliferation of LPS-induced HK-2 cells. Among them, (A) CCK8 method was used to detect the regulation of cell viability by si-σ-1R or p-σ-1R; *P<0.05, **P<0.01 compared with si-NC transfected cells; # P<0.05, ## P<0.01, compared with p-NC transfected cells. (B) Edu labeling method was used to detect the regulation of cell proliferation ability by si-σ-1R or p-σ-1R; scale bar = 20μm, **P<0.01.

[0043] Figure 6 Shows the regulation of LPS-induced apoptosis of HK-2 cells by σ-1R. Among them, (A) FCM was used to detect the effect of si-σ-1R or p-σ-1R on cell apoptosis, **P<0.01. (B) TUNEL staining was used to detect the effect of si-σ-1R or p-σ-1R on cell apoptosis; scale bar = 20μm, *P<0.05, **P<0.01.

[0044] Figure 7 Shows the regulation of autophagy level and AMPK / mTOR signaling pathway by down-regulation of σ-1R in LPS-induced HK-2 cells. Among them, (A) Western blot was used to detect the protein expression levels of σ-1R, LC3-II / LC3-I, Beclin 1, AMPK, mTOR, ULK1 and phosphorylated AMPK, mTOR and ULK1, with β-actin as an internal reference and BD1047 as a positive control for σ-1R inhibition. (B-D) Effects of si-σ-1R on the protein levels of LC3-II / LC3-I and Beclin 1. (E-G) Effects of si-σ-1R on the protein phosphorylation levels of AMPK, mTOR and ULK1, **P<0.01, compared with cells transfected with si-NC.

[0045] Figure 8 Shows the regulation of autophagy level and AMPK / mTOR signaling pathway by up-regulation of σ-1R in LPS-induced HK-2 cells. Among them, (A) Western blot was used to detect the protein expression levels of σ-1R, LC3-II / LC3-I, Beclin 1, AMPK, mTOR, ULK1 and phosphorylated AMPK, mTOR and ULK1, with β-actin as an internal reference and PRE-084 as a positive control for σ-1R up-regulation. (B-D) Effects of p-σ-1R on the protein expression levels of LC3-II / LC3-I and Beclin 1. (E-G) Effects of p-σ-1R on the protein expression levels of AMPK, mTOR and ULK1, **P<0.01, compared with p-NC transfected cells.

[0046] Figure 9 Shows the structural map of the overexpression plasmid p-σ-1R. Specific implementation manners

[0047] Our study on the internal relationship between Sigma-1 receptor (σ-1R) and sepsis-induced acute kidney injury (AKI) indicates that σ-1R plays a crucial role in the autophagy process of sepsis-induced AKI, may promote autophagy through the AMPK / mTOR signaling pathway, and σ-1R can be used as a biomarker for AKI. At the same time, there are also significant differences in the serum levels of inflammatory cytokines IL-1β, IL-6, and TNF-α among AKI patients, non-AKI general sepsis patients, and normal healthy individuals. Therefore, the combination of σ-1R level and the levels of inflammatory cytokines IL-1β, IL-6, and / or TNF-α can be effectively used for the diagnosis of sepsis-induced acute kidney injury.

[0048] It should be understood that the terms "and / or", "and / or" used in phrases such as "A and / or B" herein are intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0049] In view of the use of σ-1R as a biomarker for AKI, it is obvious to those skilled in the art that various types of reagent products such as test kits can be developed as auxiliary diagnostic tools for AKI. For example, the forms of test kits that can be developed include, but are not limited to: latex immunoturbidimetry test kits containing only one σ-1R antibody (monoclonal antibody or polyclonal antibody, preferably monoclonal antibody), chemiluminescence test kits such as magnetic particle chemiluminescence test kits, radioimmunoassay test kits; enzyme-linked immunosorbent assay (ELISA) test kits, magnetic particle chemiluminescence test kits, immunochromatographic test strips containing two different σ-1R antibodies (monoclonal antibody and / or polyclonal antibody), etc.

[0050] The σ-1R used in the preparation of AKI detection reagents can be a natural σ-1R protein extracted from humans or mammals, or a recombinant human-derived σ-1R protein produced by fermentation of genetically engineered bacteria. Preferably, the amino acid sequence of the σ-1R protein is identical to that of the human-derived σ-1R protein and retains the same antigen recognition epitope / antigen determinant.

[0051] The σ-1R monoclonal antibody and the σ-1R polyclonal antibody can be commercially available antibodies or can be prepared by conventional techniques, for example, prepared using σ-1R, preferably human σ-1R, as an antigen. Typically, monoclonal antibodies can be prepared by immunizing an animal with σ-1R protein. The steps include: after thoroughly mixing the protein σ-1R as an immunogen with an equal volume of Freund's complete adjuvant, immunizing an animal such as a mouse by multi-point subcutaneous injection; measuring the serum titer several weeks later, selecting mice with good immunoreactivity and boosting the immunization multiple times, and then fusing splenocytes with myeloma cells by PEG-mediated fusion in a conventional method and culturing them in a HAT conditioned medium; after fusion, culturing in a CO 2 incubator at 37 °C for 9-11 days, and large cell clones appear in the wells; starting from the 11th day, screening is carried out by indirect ELISA; the wells positive in the primary screening are subjected to 4 rounds of cloning culture by the limiting dilution method to allow the screened cells to divide and multiply in large numbers, and then the cells are amplified, cryopreserved, and ascites are prepared; the mice are treated with pristane, and after one week, hybridoma cells are intraperitoneally inoculated, and ascites are collected 10 days later. The titer of the monoclonal antibody is measured by the indirect ELISA method to obtain a monoclonal antibody with a titer meeting the requirements; after ammonium sulfate precipitation, it is further purified by Protein G affinity chromatography, and the monoclonal antibody is separated and purified, and after being aliquoted, it is freeze-dried and stored at low temperature.

[0052] Similarly, polyclonal antibodies can be prepared by immunizing an animal with σ-1R protein. The steps include: selecting a rabbit as the immunized animal; in the primary immunization, mixing the σ-1R protein as an immunogen with an equal volume of Freund's complete adjuvant, fully emulsifying it, and then performing multi-point subcutaneous injection on the back of the rabbit; boosting the immunization once every 4 weeks, fully emulsifying the antigen with incomplete Freund's adjuvant and then performing multi-point subcutaneous injection on the back; bleeding from the carotid artery 10 days after the last boost immunization, and separating the serum; measuring the titer of the prepared polyclonal antibody by the indirect ELISA method to obtain a polyclonal antibody with a titer meeting the requirements, cannulating the carotid artery to draw blood, and separating the serum; after ammonium sulfate precipitation, it is further purified by Protein G affinity chromatography, and the monoclonal antibody is separated and purified, and after being aliquoted, it is freeze-dried and stored at low temperature.

[0053] Detecting the antigen σ-1R protein in a biological sample using the σ-1R monoclonal antibody and the σ-1R polyclonal antibody is based on immunological techniques. There are various detection means for immunological techniques well-known in the field of clinical medicine. Generally speaking, the σ-1R level (content) in a biological sample can be measured using a method selected from the following group: Western blot; immunoprecipitation; enzyme-linked immunosorbent assay (ELISA); radioimmunoassay (RIA); sandwich assay; fluorescence in situ hybridization (FISH); immunohistological staining; immunofluorescence assay; mass spectrometry; fluorescence-activated cell sorting (FACS); immunoelectrophoresis assay. In some embodiments, the antibody or its antigen-binding portion is detectably labeled or generates a detectable signal.

[0054] In some embodiments, the antibody reagent may be detectably labeled. In some embodiments, the antibody reagent may be attached to a solid support (e.g., bound to a solid support). In some embodiments, the solid support may comprise particles (including but not limited to agarose or latex beads or particles or magnetic particles), beads, nanoparticles, polymers, substrates, slides, coverslips, plates, culture dishes, wells, membranes, and / or gratings. The solid support may include many different materials, including but not limited to polymers, plastics, resins, polysaccharides, silicon- or silica-based materials, carbon, metals, inorganic glasses, and membranes.

[0055] In one embodiment, the assays, methods, and / or systems described herein may include ELISA. In an exemplary embodiment, a first antibody reagent may be immobilized on a solid support (typically a polystyrene microtiter plate). The solid support may be contacted with a sample obtained from a subject, and the antibody reagent will bind (“capture”) its specific antigen (σ-1R). The solid support may then be contacted with a second labeled antibody reagent (e.g., a detection antibody reagent). The detection antibody reagent may, for example, comprise a detectable signal, be covalently linked to an enzyme, or itself may be linked to an enzyme via bioconjugation for detection by a secondary antibody. The presence of the signal indicates that both the first antibody reagent immobilized on the support and the second “detection” antibody reagent have bound to the antigen, i.e., the presence of the signal indicates the presence of σ-1R molecules. Between each step, the plate is typically washed with a mild detergent solution to remove any non-specifically bound proteins or antibodies. After the final wash step, the plate is developed by adding an enzyme substrate to produce a visible signal that indicates the amount of σ-1R in the sample. Older ELISAs used chromogenic substrates, but newer assays use fluorescent substrates with higher sensitivity. There are also other different forms of ELISA, which are well known to those skilled in the art.

[0056] On the other hand, the close relationship between the Sigma-1 receptor and sepsis-induced acute kidney injury, as well as the increase in Sigma-1 receptor gene expression levels leading to an increase in autophagy levels and a decrease in inflammatory cytokines in AKI cells, make the Sigma-1 receptor or its gene suitable as a drug target for developing drugs for the treatment of sepsis-induced acute kidney injury.

[0057] The terms "increase" or "rise" in "(Sigma-1 receptor level)" are both used herein to indicate a statistically significant increase. In some embodiments, "increase" or "elevation" or "rise" generally refers to an increase of at least 10% compared to a reference level (e.g., non-AKI sepsis), and may include, for example, an increase of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or more.

[0058] Similarly, the terms "decrease" or "fall" in "(inflammatory cytokine level)" are both used herein to indicate a statistically significant increase. In some embodiments, "decrease" or "fall" or "downregulation" generally refers to a decrease of at least 10% compared to a reference level (e.g., non-AKI sepsis), and may include, for example, a decrease of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or more.

[0059] The AKI therapeutic drug developed in the present invention belongs to a substance that promotes the expression of the Sigma-1 receptor, a substance that upregulates the expression level of the Sigma-1 receptor, or a substance that enables an individual to express the Sigma-1 receptor. This substance has the function of increasing the autophagy level in sepsis acute kidney injury cells, and / or has the function of reducing the inflammatory cytokine level in sepsis acute kidney injury cells. The drug can be either a chemical drug or a genetically engineered drug, including small molecule agonists of the Sigma-1 receptor gene such as PRE-084, the Sigma-1 receptor gene, the Sigma-1 receptor gene mRNA (the DNA sequence is shown as SEQ ID NO:1), an expression plasmid containing the Sigma-1 receptor gene, or an expression plasmid containing the coding region (SEQ ID NO:1) of the Sigma-1 receptor gene such as plasmid p-σ-1R with a nucleotide sequence of SEQ ID NO:2.

[0060] The drug can be a single-component drug containing a therapeutically effective amount of a drug active ingredient, or a pharmaceutical composition further containing other components such as a pharmaceutically acceptable carrier.

[0061] As used herein, the phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms that, within the scope of reasonable medical judgment, are suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable carriers are well known in the art and include liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the patient, including, for example, aqueous solutions (such as water or physiological buffer saline) or other solvents or vehicles (such as glycols, glycerol, oils (such as olive oil), or injectable organic esters). Excipients can be selected, for example, to achieve delayed release of the medicament or to selectively target one or more cells, tissues, or organs. Pharmaceutical compositions can be in the form of dosage units, such as tablets, capsules (including dispersed capsules and gelatin capsules), granules, powders, solutions, syrups, suppositories, injections, and the like.

[0062] As used herein, the term "effective amount" refers to the therapeutically effective amount required to alleviate at least one or more symptoms of a disease or condition and relates to an adequate amount of a drug that provides the desired effect. Thus, the term "therapeutically effective amount" refers to an amount of a therapeutic agent that, when administered to a typical subject, is sufficient to cause a particular effect. In various contexts, an effective amount as used herein also includes an amount sufficient to delay the development of a disease condition, alter the course of a disease condition (e.g., but not limited to, slowing the progression of a disease condition), or reverse a disease condition. It should be understood that there are many ways known in the art to determine an effective amount for a given application. For example, pharmacological methods for dose determination can be used in a therapeutic context. In the context of a therapeutic or prophylactic application, the amount of the composition administered to a subject will depend on the type and severity of the disease and the characteristics of the individual, such as general health status, age, sex, weight, and tolerance to the drug. It also depends on the extent, severity, and type of the disease. Those skilled in the art will be able to determine an appropriate dose based on these and other factors. For example, the therapeutically effective amounts of the agonist PRE-084 and the plasmid p-σ-1R can be determined with reference to their currently safe usage amounts when administered to AKI patients for the treatment of AKI and through clinical investigations. Appropriate effective dosing amounts also need to consider therapeutic factors such as the drug dosage form, the constitution, weight, age, disease progression, and administration site of the individual being administered the drug.

[0063] For chemical drugs for treating AKI, such as the agonist PRE-084, the pharmaceutical dosage form may contain, in addition to the main component PRE-084 hydrochloride, a pharmaceutically acceptable carrier. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars (such as lactose, glucose, and sucrose); (2) starches (such as corn starch and potato starch); (3) cellulose and its derivatives (such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate); (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients (such as cocoa butter and suppository wax); (9) oils (such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil); (10) diols (such as propylene glycol); (11) polyols (such as glycerol, sorbitol, mannitol, and polyethylene glycol); (12) esters (such as ethyl oleate and ethyl laurate); (13) agar; (14) buffering agents (such as magnesium hydroxide and aluminum hydroxide); (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer solution; and (21) other non-toxic compatible substances used in pharmaceutical preparations.

[0064] The pharmaceutical preparation can be administered to a subject by any of a number of administration routes, including, for example, injectables such as lyophilized powder for injection, oral administration (e.g., as a drench in an aqueous solution or non-aqueous solution or suspension, tablets, capsules (including dispersed capsules and gelatin capsules), boluses, powders, granules, pastes for application to the tongue); absorption through the oral mucosa (e.g., sublingually); subcutaneous; transdermal (e.g., as a patch applied to the skin); and topical (e.g., as a cream, ointment, or spray applied to the skin). PRE-084 can also be formulated for inhalation. In certain embodiments, PRE-084 can simply be dissolved or suspended in a sterile solvent.

[0065] For genetically engineered drugs for treating AKI, such as plasmid p-σ-1R, the pharmaceutical dosage form can be in various forms, as long as it is suitable for the administration of the corresponding disease and properly maintains the activity of the DNA molecule. For example, for an injectable drug delivery system, the dosage form can be a lyophilized powder. Optionally, any pharmaceutically acceptable carrier and adjuvant can be included in the above pharmaceutical dosage form, as long as it is suitable for the corresponding drug delivery system and properly maintains the activity of the DNA molecule.

[0066] The preparation of pharmacological compositions containing the active ingredient p-σ-1R dissolved or dispersed therein is well known in the art and does not require limitation based on formulation. Generally, such compositions are prepared as injectable liquid solutions or suspensions. However, solid forms of solutions or suspensions suitable for being placed in a liquid before use can also be prepared. The preparation can also be emulsified or exist in the form of liposomal compositions. The active ingredient can be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient, and in an amount suitable for use in the treatment methods described herein. Suitable excipients include, for example, water, saline, glucose, glycerol, ethanol, etc. and combinations thereof. In addition, if necessary, the composition can contain small amounts of auxiliary substances, such as wetting agents or emulsifying agents, pH buffering agents, etc., which enhance or maintain the effectiveness of the active ingredient. An exemplary liquid carrier is a sterile aqueous solution that contains no substances other than the active ingredient p-σ-1R and water, or contains a buffer such as sodium phosphate at physiological pH, physiological saline, or both, such as phosphate-buffered saline. Further, the aqueous carrier can contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, glucose, polyethylene glycol, and other solutes. In addition to water, the liquid composition can also contain a liquid phase. Examples of such other liquid phases are glycerol, vegetable oils (such as cottonseed oil), and water-oil emulsions. The amount of the active agent, such as p-σ-1R, used effectively to treat AKI in the present invention will depend on the nature of the disease or disorder and can be determined by standard clinical techniques.

[0067] The above-mentioned medicaments can be administered by subcutaneous injection, intramuscular injection, intravenous injection, or intravenous infusion gradually over time. The appropriate formulation for a given route, for example, the medicaments that can be used in the methods and compositions described herein can be administered intravenously, intranasally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, intracavitary, and if necessary, can be delivered by means of a peristaltic pump, a venous port, or other means known to those skilled in the art. Intravenous or intramuscular administration is preferred for patients with AKI to be treated.

[0068] The individual or subject receiving this treatment for AKI is any animal in need, including primates (especially humans) and other mammals (such as horses, cows, pigs, sheep, cats, and dogs).

[0069] To make the present invention more clearly understandable, preferred embodiments are described in detail below in conjunction with the accompanying drawings. Those skilled in the art should understand that the following embodiments are only used to clarify the present invention and are not intended to limit the present invention.

[0070] Examples

[0071] The siRNA and PCR primers in the examples were synthesized by BioMac Biotechnology Co., Ltd.

[0072] In the embodiments of the present invention, if there is no specific description on the experimental operation temperature, the temperature generally refers to room temperature (10-30° C.).

[0073] This article involves the addition amount, content and concentration of various substances, and the percentages mentioned here refer to the mass percentages unless otherwise specified.

[0074] Statistical analysis: All data in the examples are expressed as mean ± standard deviation (SD), and statistical analysis was performed using GraphPad Prism 8.0. The differences between two groups were compared using Student's t test, and the differences between three or more groups were compared using one-way analysis of variance (ANOVA) and Tukey's multiple comparison test. Intergroup P values ​​less than 0.05 were considered statistically significant.

[0075] Example 1

[0076] Downregulation of σ-1R and upregulation of inflammatory cytokines in sepsis and septic AKI

[0077] 1. Human serum samples

[0078] In the study of Nantong Science and Technology Plan Project Fund No. JCZ2022020, we collected serum samples from 20 patients diagnosed with sepsis or sepsis-related AKI in the emergency department of Nantong University Affiliated Hospital from January to December 2022. According to the guidelines of the 2012 Kidney Disease Improving Global Outcomes (KDIGO), all patients were diagnosed with sepsis or sepsis-related AKI. In addition, serum samples from 10 healthy volunteers were collected as normal controls.

[0079] 2. Enzyme-linked immunosorbent assay (ELISA)

[0080] The levels of σ-1R and inflammatory cytokines (including IL-1β, IL-6, and TNF-α) in the sera of patients were detected by ELISA. Blood samples were collected from patients diagnosed with sepsis or sepsis-induced AKI and placed in serum separator tubes, left to stand overnight at 4°C, and centrifuged at 1,000×g for 20 min to obtain the supernatant, which was then stored at -80°C. In addition, the cell culture supernatant was obtained by centrifuging at 1,000×g for 20 min. According to the kit instructions (Shanghai Enzyme-linked Biotechnology), 50 μL of the above-separated samples were taken for ELISA detection. A standard regression curve was constructed using the standard samples provided in the kit to calculate the concentration of each sample. The optical density (OD) value of each well at 450 nm was detected using an enzyme-linked immunosorbent assay reader (Bio-Tek, USA).

[0081] 3. Statistical analysis

[0082] All data in this article were expressed as mean ± standard deviation (SD) and statistically analyzed using GraphPad Prism 8.0. The Student's t-test was used to compare the differences between two groups, and one-way analysis of variance (ANOVA) and Tukey's multiple comparison test were used to compare the differences between three or more groups. A P-value less than 0.05 between groups was considered statistically significant.

[0083] 4. Result analysis

[0084] The main indication of sepsis is inflammation caused by elevated levels of inflammatory cytokines. The levels of σ-1R and inflammatory cytokines (including IL-1β, IL-6, and TNF-α) in sepsis and sepsis-induced AKI were detected by ELISA. A total of 30 serum samples were collected, including samples from 10 patients with sepsis, 10 patients with sepsis-induced AKI, and 10 healthy volunteer controls. The results showed that, statistically according to the σ-1R level, the σ-1R level in the sera of AKI patients was 62.8 pg / ml, 76.2 pg / ml in sepsis patients, and 125 pg / ml in the normal population; statistically according to the IL-1β level, the IL-1β level in the sera of AKI patients was 26.1 pg / ml, 15.1 pg / ml in sepsis patients, and 6.0 pg / ml in the normal population; statistically according to the IL-6 level, the IL-6 level in the sera of AKI patients was 16.2 pg / ml, 12.2 pg / ml in sepsis patients, and 4.1 pg / ml in the normal population; statistically according to the TNF-α level, the TNF-α level in the sera of AKI patients was 17.0 pg / ml, 12.9 pg / ml in sepsis patients, and 6.8 pg / ml in the normal population.

[0085] Compared with the control group (normal population), the σ-1R levels in patients with sepsis AKI and in patients with ordinary sepsis were significantly decreased, while the levels of IL-1β, IL-6, and TNF-α were increased. Notably, the σ-1R level in sepsis AKI was lower than that in sepsis, while the levels of IL-1β, IL-6, and TNF-α were all higher than those in sepsis( Figure 1 ). The research results indicate that both sepsis and sepsis AKI are associated with a decrease in σ-1R level and an increase in the level of inflammatory cytokines. Compared with patients with simple sepsis, the inflammatory response in patients with sepsis AKI is more obvious.

[0086] Example 2

[0087] The σ-1R was decreased and the levels of inflammatory cytokines were increased in LPS-induced HK-2 cells

[0088] 1. Cell culture and treatment

[0089] Human kidney-2 (HK-2) renal tubular epithelial cells obtained from ATCC were cultured in Dulbecco's Modified Eagle Medium (DMEM) (ThermoFisher Scientific, USA) containing 10% fetal bovine serum (FBS) in a 37°C / 5% CO 2 incubator.

[0090] An in vitro model of sepsis AKI was constructed according to the previously reported method (Zhang Y et al. Drug Des Devel Ther. 2021;15:5123-5132.). HK-2 cells in the logarithmic growth phase were seeded into 12-cm cell culture dishes at a density of 2×10 5 cells per well and cultured in a 37°C / 5% CO 2 incubator for 24 h. Subsequently, the original medium was replaced with fresh DMEM containing 10% FBS and 1 μg / mL lipopolysaccharide (LPS) (Sigma-Aldrich, USA). The cells were further cultured in a 37°C / 5% CO 2 incubator for 24 h. BD-1047 dihydrobromide and PRE-084 hydrochloride (both purchased from MedChemExpress) were used as an antagonist and an agonist of σ-1R, respectively. The cells were treated with BD-1047 (10 μM) and PRE-084 (10 μM) for 48 h.

[0091] 2. Real-time quantitative PCR (RT-qPCR)

[0092] QRT-PCR was used to detect the mRNA expression level of the target gene. According to the kit instructions, total RNA was extracted from cells using RNA reagent (ThermoFisher Scientific, USA), and the extracted total RNA was diluted in 50 μL of RNase-free ddH 2 O. The qRT-PCR reaction was performed using a one-step SYBR Green qRT-PCR kit (ThermoFisher Scientific, USA) according to the kit instructions. The 2 -△△Ct -method was used to analyze the changes in the mRNA expression of the target gene between the control group and each experimental group, with β-actin as the internal reference gene. The qPCR primer sequences were as follows: σ-1R, upstream: 5′-ATCTCGGATACCATCATCTC-3′, downstream: 5′-TGGGTAGAAGACCTCACT-3′; β-actin, upstream: 5′-AGCGAGCATCCCCCAAAGTT-3′, downstream: 5′-GGGCACGAAGGCTCATCATT-3′.

[0093] 3. Western blot

[0094] The protein expression level of the gene was detected by Western blot. Total cellular proteins were extracted on ice using RIPA lysis buffer (Promega), and centrifuged at 12,000 rpm for 20 min at 4°C. After protein quantification using the BCA method (Biosharp), 30 μg of protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a polyvinylidene difluoride (PVDF) membrane (Merck). After incubation in 5% BSA for 1 h at room temperature, the PVDF membrane was incubated with primary antibodies overnight at 4°C. The primary antibodies were: σ-1R (1:1,000 dilution; #15168-1-AP) (Proteintech) and β-actin (1:5,000 dilution; #66009-1lg) (Proteintech). After washing three times for 10 min each in Tris-buffered saline with Tween 20 (TBST), the PVDF membrane was incubated at 37°C with horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG H&L (1:1,000 dilution, #A0208) (Beyotime) or HRP-labeled goat anti-mouse IgG H&L (1:1,000 dilution, #A0216) (Beyotime). Finally, the protein blot bands were scanned and analyzed using Image J software.

[0095] 4. Result analysis

[0096] σ-1R was decreased while inflammatory cytokine levels were increased in LPS-induced HK-2 cells. To clarify the role of σ-1R in septic AKI, an in vitro model of septic AKI was constructed using LPS-induced HK-2 cells. QRT-PCR and Western blot were used to detect σ-1R mRNA and protein levels, and ELISA was used to detect inflammatory cytokine levels. The results showed that compared with HK-2 cells without LPS induction (Ctrl), the mRNA and protein expression levels of σ-1R were significantly decreased in LPS-induced HK-2 cells ( Figure 2 in A and B). ELISA results showed that compared with the control group, the levels of inflammatory cytokines IL-1β, IL-6, and TNF-α were increased in LPS-induced HK-2 cells ( Figure 2In (C-E). The results showed that LPS induced an increase in the levels of inflammatory cytokines in HK-2 cells, demonstrating the successful establishment of an in vitro model of septic AKI.

[0097] Example 3

[0098] Regulation of σ-1R expression in LPS-induced HK-2 cells by siRNA or overexpression plasmid

[0099] 1. Cell culture and treatment

[0100] Same as Example 2.

[0101] 2. Design of small interfering RNA (siRNA)

[0102] To downregulate the expression of endogenous σ-1R in cells, siRNAs targeting σ-1R were designed. Based on the σ-1R mRNA sequence in the NCBI database (Accession no. NM_005866), siRNAs were designed, namely si-σ-1R-1, si-σ-1R-2, and si-σ-1R-3. An siRNA sequence non-homologous to human genes was used as a negative control (siRNA negative control, si-NC), and the sequences are as follows:

[0103] si-σ-1R-1,

[0104] Sense strand: 5′-GGCUUGAGCUCACCACCUAdTdT-3′;

[0105] Antisense strand 5′-UAGGUGGUGAGCUCAAGCCdTdT-3′.

[0106] si-σ-1R-2,

[0107] Sense strand: 5′-GCGAAGAGAUAGCGCAGUUdTdT-3′;

[0108] Antisense strand 5′-AACUGCGCUAUCUCUUCGCdTdT-3′.

[0109] si-σ-1R-3,

[0110] Sense strand: 5′-CUUCCAGCGCGAAGAGAUAdTdT-3′;

[0111] Antisense strand 5′-UAUCUCUUCGCGCUGGAAGdTdT-3′.

[0112] si-NC,

[0113] Sense strand: 5′-UUCUCCGAACGUGUCACGUdTdT-3′;

[0114] Antisense strand: 5′-ACGUGACACGUUCGGAGAAdTdT-3′.

[0115] 3. Construction of the plasmid for overexpressing σ-1R

[0116] To up-regulate the expression of endogenous σ-1R in cells, a plasmid for overexpressing σ-1R was designed and constructed. Primers were designed according to the coding region sequence of σ-1R in the NCBI database (Accession no. NM_005866). The plasmid for overexpressing σ-1R was constructed by Beijing OligoBio Co., Ltd. on the pcDNA3.1 vector (p-σ-1R), and the empty vector pcDNA3.1 was used as a negative control (plasmid negative control, p-NC).

[0117] The DNA sequence of σ-1R (the coding sequence of σ-1R) used for constructing into the overexpression plasmid vector is as follows:

[0118] ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTC GCAGCGGTGCTGACCCAGGTCGTCTGGCTCTGGCTGGGTACGCAGAGCTTCGTCTTCCAGCGCGAAGAGATAGCGCAGTTGGCGCGGCAGTACGCTGGGCTGGACCACGAGCTGGCCTTCTCTCGTCTGATCGTGGAGCTGCGGCGGCTGCACCCAGGCCACGTGCTGCCCGACGAGGAGCTGCAGTGGGTGTTCGTGAATGCGGGTGGCTGGATGGGCGCCATGTGCCTTCTGCACGCCTCGCTGTCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGCTCCCGCGGCCACTCGGGGCGCTACTGGGCTGAGATCTCGGATACCATCATCTCTGGCACCTTCCACCAGTGGAGAGAGGGCACCACCAAAAGTGAGGTCTTCTACCCAGGGGAGACGGTAGTACACGGGCCTGGTGAGGCAACAGCTGTGGAGTGGGGGCCAAACACATGGATGGTGGAGTACGGCCGGGGCGTCATCCCATCCACCCTGGCCTTCGCGCTGGCCGACACTGTCTTCAGCACCCAGGACTTCCTCACCCTCTTCTATACTCTTCGCTCCTATGCTCGGGGCCTCCGGCTTGAGCTCACCACCTACCTCTTTGGCCAGGACCCTTAA(SEQ ID NO:1).

[0119] The PCR amplification primers include:

[0120] σ-1R forward primer:

[0121] 5’-TTGGTACCGAGCTCGGATCCGCCACCATGCAGTGGGCCGTGGGCCG-3’,

[0122] σ-1R reverse primer:

[0123] 5’-ACCGTCATGGTCTTTGTAGTCCTCGAGAGGGTCCTGGCCAAAGAGGT-3’.

[0124] The nucleotide sequence of the overexpression plasmid p-σ-1R is shown in SEQ ID NO:2.

[0125] The PCR primers for plasmid identification include:

[0126] Forward primer: 5’-CGCAAATGGGCGGTAGGCGTG-3’,

[0127] Reverse primer: 5’-AAGGCGGTGCCGAAGAGCAGCAC-3’.

[0128] The structural map of the σ-1R overexpression plasmid p-σ-1R (pCMV-SIGMAR1(human)-3×FLAG-SV40-Neo) is shown in Figure 9 .

[0129] 4. siRNA and overexpression plasmid transfection of cells

[0130] According to the kit instructions, use 2000 (ThermoFisher Scientific, USA) to transfect siRNA and plasmid into cells.

[0131] 5. Result analysis

[0132] To regulate the change of σ-1R level in LPS-induced HK-2 cells, specific targeting siRNAs (si-σ-1R-1, si-σ-1R-2 and si-σ-1R-3) targeting σ-1R were designed. qRT-PCR was used to screen the inhibitory effect of siRNA on σ-1R expression in LPS-induced HK-2 cells. The results showed that in LPS-induced HK-2 cells, compared with the si-NC transfection group, all siRNAs effectively inhibited the σ-1R mRNA level ( Figure 3 A in), among which si-σ-1R-1 had the best silencing effect and was selected as the object for subsequent research. In addition, Western blot showed that the σ-1R protein level in si-σ-1R-transfected cells was significantly reduced compared with that in cells transfected with si-NC ( Figure 3 B in). In addition, the σ-1R overexpression plasmid (p-σ-1R) was transfected into LPS-induced HK-2 cells. The results showed that compared with the cells treated with the empty plasmid negative control (p-NC), the plasmid p-σ-1R significantly promoted the σ-1R mRNA and protein expression levels ( Figure 3 C). The results indicate that si-σ-1R and p-σ-1R can regulate the expression of σ-1R in LPS-induced HK-2 cells.

[0133] Example 4

[0134] Effect of σ-1R regulation on the expression of inflammatory cytokines in LPS-induced HK-2 cells

[0135] 1. Cell culture and treatment

[0136] Same as Example 2.

[0137] 2. ELISA

[0138] The levels of σ-1R and inflammatory cytokines (including IL-1β, IL-6, and TNF-α) in the serum of patients were detected by ELISA. Blood samples were collected from patients diagnosed with sepsis or septic AKI and placed in serum separator tubes, left to stand overnight at 4 °C, centrifuged at 1,000×g for 20 min to obtain the supernatant, and then stored at -80 °C. In addition, the cell culture supernatant was obtained by centrifuging at 1,000×g for 20 min. According to the kit instructions (Shanghai Enzyme-linked Biotechnology), 50 μL of the above-separated samples were taken for ELISA detection. Standard regression curves were constructed using the standard samples provided in the kit to calculate the concentration of each sample. The optical density (OD) value of each well at 450 nm was detected using a microplate reader (Bio-Tek, USA).

[0139] 3. Result analysis

[0140] To investigate the effect of σ-1R regulation on the levels of inflammatory cytokines, the expression of σ-1R in LPS-induced HK-2 cells was regulated by si-σ-1R and p-σ-1R, and the levels of IL-1β, IL-6, and TNF-α were evaluated by ELISA. Compared with the cells transfected with si-NC, si-σ-1R promoted the levels of IL-1β, IL-6, and TNF-α in the cells. On the contrary, compared with the cells transfected with p-NC, p-σ-1R inhibited the levels of IL-1β, IL-6, and TNF-α in the cells ( Figure 4 ). The results indicate that σ-1R may regulate the levels of inflammatory cytokines during sepsis or septic AKI.

[0141] Example 5

[0142] Effect of σ-1R regulation on the proliferation and apoptosis of LPS-induced HK-2 cells

[0143] 1. Cell culture and treatment

[0144] Same as Example 2.

[0145] 2. CCK-8 assay

[0146] The CCK-8 assay was used to evaluate the cell viability. According to different experimental groups, HK-2 cells in the logarithmic growth phase were seeded at 1×10 4Cells were seeded onto 96-well culture plates at a density of [number] cells / well, and then cultured in an incubator at 37°C / 5% CO 2 for 24 h. After the experimental group cells were stimulated with LPS for 24 h, the cells were transfected with siRNA or plasmid for 6 h. After replacing 100 μL of fresh DMEM, the cells were cultured for an additional 24 h, 48 h, 72 h, and 96 h. Subsequently, 10 μL of CCK-8 solution (5 mg / mL) (Beyotime) was added to each well, and the mixture was incubated at 37°C in the dark for 1 h. The OD values of the cells at different time points were measured using an enzyme-linked immunosorbent assay reader at 450 nm.

[0147] 3. Edu assay

[0148] The cell proliferation ability was detected by Edu labeling. According to different experimental groups, HK-2 cells in the logarithmic growth phase were seeded into 96-well plates at a concentration of 1×10 4 cells / well and cultured in an incubator at 37°C / 5% CO 2 for 24 h. The experimental group cells were stimulated with LPS for 24 h and then transfected with siRNA or plasmid for 6 h. After replacing 100 μL of fresh DMEM, the cells were cultured for an additional 48 h. According to the kit instructions, the cells were stained with an Alexa Fluor 555-labeled Edu cell proliferation kit (Beyotime). The cells were incubated with Click solution in the dark at room temperature for 30 min, and then stained with 1× Hoechst 33342 solution in the dark at room temperature for 30 min. Subsequently, the number of Edu-positive (Edu + ) cells was observed and photographed using a fluorescence microscope (Olympus), and the cell proliferation rate was calculated.

[0149] 4. Flow cytometry (FCM)

[0150] FCM was used to detect cells double-stained with Annexin V-FITC and PI using an Annexin V-FITC / PI apoptosis detection kit (Beyotime). According to different experimental groups, HK-2 cells in the logarithmic growth phase were seeded onto 6-well plates at a density of 2×10 5 cells / well and cultured in an incubator at 37°C / 5% CO 2 for 24 h. The experimental group cells were stimulated with LPS for 24 h and then transfected with siRNA or plasmid for 6 h. After adding 100 μL of fresh DMEM, the cells were cultured for an additional 72 h. Approximately 5×10 4Cells were then added with 5 μL of Annexin V-FITC and 10 μL of PI to each well, and incubated at 37 °C in the dark for 10 min. Finally, the cells were detected using a flow cytometer (BD).

[0151] 5. TUNEL Assay

[0152] The apoptosis index of cells was detected by the TUNEL method. According to different experimental groups, HK-2 cells in the logarithmic growth phase were seeded into 96-well plates at a density of 1×10 4 cells / well and cultured in an incubator at 37 °C / 5% CO 2 for 24 h. The cells in the experimental groups were stimulated with LPS for 24 h and then transfected with siRNA or plasmid. After 6 h of cell transfection, 100 μL of fresh DMEM was replaced, and the cells were further cultured for 72 h. After washing with phosphate-buffered saline (PBS), the cells were fixed in 4% paraformaldehyde solution for 30 min, then washed with PBS, and incubated with 0.3% Triton X-100 solution at room temperature for 5 min. After washing twice with PBS, the cells were incubated with 50 μL of TUNEL detection solution (Beyotime) containing 45 μL of fluorescent labeling solution and 5 μL of labeling enzyme at 37 °C in the dark for 60 min. After washing three times with PBS, the apoptosis of cells was observed and photographed using a fluorescence microscope (Olympus).

[0153] 6. Result Analysis

[0154] Cell proliferation was evaluated by CCK-8 and EdU labeling assays, and cell apoptosis was detected by FCM and TUNEL staining assays. The results of CCK-8 showed that si-σ-1R significantly inhibited cell growth compared with cells transfected with si-NC. In contrast, p-σ-1R significantly promoted cell growth compared with cells transfected with p-NC ( Figure 5 in A). Similar results of cell proliferation were obtained by the EdU labeling assay ( Figure 5 in B). The results of FCM showed that si-σ-1R significantly promoted cell apoptosis compared with cells transfected with si-NC, while p-σ-1R significantly inhibited cell apoptosis compared with cells transfected with p-NC ( Figure 6 in A). The apoptosis results were also confirmed by TUNEL staining ( Figure 6 in B).

[0155] Example 6

[0156] σ-1R Regulates Cell Autophagy through the AMPK / mTOR Signaling Pathway

[0157] 1. Cell Culture and Treatment

[0158] Same as Example 2.

[0159] 2. Western blot

[0160] The protein expression levels of the genes were detected by Western blot. Total cellular proteins were extracted on ice using an RIPA extraction kit (Promega), and centrifuged at 12,000 rpm for 20 min at 4°C. After protein quantification using the BCA method (Biosharp), 30 μg of protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene difluoride (PVDF) membrane (Merck). After incubation in 5% BSA at room temperature for 1 h, the PVDF membrane was incubated overnight at 4°C with primary antibodies, including σ-1R (1:1,000 dilution; #15168-1-AP) (Proteintech), LC3 (1:2,000 dilution; #14600-1AP) (Proteintech), Beclin 1 (1:1,000 dilution; #11306-1-AP) (Proteintech), AMPK (1:1,000 dilution; #10929-2-AP) (Proteintech), phosphorylated AMPK1 (p-AMPK1) (1:1,000 dilution; #BM4718) (Boster), mTOR (1:5,000 dilution; #66888-1-Ig) (Proteintech), phosphorylated mTOR (p-mTOR) (1:5,000 dilution, #67778-1-Ig) (Proteintech), ULK1 (1:1,000 dilution, #20986-1-AP) (Proteintech), phosphorylated ULK1 (p-ULK1) (1:2,000 dilution; #80218-1-RR) (Proteitech), and β-actin (1:5,000 dilution; #66009-1lg) (Proteintech). After washing three times for 10 min each in Tris-buffered saline with Tween 20 (TBST), the PVDF membrane was incubated at 37°C with horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG H&L (1:1,000 dilution, #A0208) (Beyotime) or HRP-labeled goat anti-mouse IgG H&L (1:1,000 dilution, #A0216) (Beyotime). Finally, the protein blot bands were scanned and analyzed using Image J software.

[0161] 3. Result Analysis

[0162] Recent research results have shown that autophagy plays a protective role in AKI, and σ-1R is related to autophagy regulation. The AMPK / mTOR signaling pathway is involved in the regulation of autophagy in sepsis. To evaluate the autophagy process, the expression levels of autophagy-related proteins light chain 3 (LC3) and Beclin 1 were detected. Compared with the cells transfected with si-NC, the protein expressions of LC3-II / LC3-I and Beclin-1 were significantly decreased in the cells transfected with si-σ-1R. The σ-1R specific antagonist BD-1047 also effectively inhibited the protein levels of LC3-II / LC3-I and Beclin 1. The phosphorylation levels of ULK1, mTOR, and AMPK in the AMPK / mTOR signaling pathway were detected, and the results showed that compared with the si-NC transfected cells, si-σ-1R significantly inhibited the phosphorylation levels of AMPK and ULK1, while promoting the phosphorylation level of mTOR. BD-1047 showed similar results( Figure 7 ).

[0163] In addition, in LPS-induced HK-2 cells treated with p-σ-1R, p-σ-1R significantly promoted the expressions of LC3 and Beclin 1. The σ-1R specific agonist PRE-084 also promoted the expression levels of LC3-II / LC3-I and Beclin 1. In addition, compared with the cells transfected with p-NC, p-σ-1R promoted the phosphorylation levels of AMPK and ULK1, while inhibiting the phosphorylation level of mTOR. PRE-084 showed similar results( Figure 8 ). These results indicate that σ-1R plays a crucial role in the autophagy process of septic AKI and may promote autophagy partially through the AMPK / mTOR signaling pathway.

[0164] As can be seen from the above experiments, the agonist PRE-084 for upregulating the expression of σ-1R and the overexpression plasmid p-σ-1R showed high efficiency in upregulating the expression activity of σ-1R, significantly promoted the autophagy level in septic acute kidney injury cells, and significantly inhibited the expression levels of inflammatory cytokines. Therefore, upregulating the expression of σ-1R has the potential to be applied in the treatment of septic acute kidney injury.

[0165] In addition, the expression of σ-1R mediated by the overexpression plasmid p-σ-1R is due to the overexpression plasmid p-σ-1R being further transcribed into mRNA after being transfected into cells through a transfection reagent to play a role. It can be speculated that the mRNA form of σ-1R is also an effective way to effectively upregulate the expression of σ-1R in cells. The mRNA of σ-1R is also one of the effective components for the treatment of septic acute kidney injury.

Claims

1. Application of Sigma-1 receptor in developing therapeutic drugs for acute kidney injury caused by sepsis, characterized in that: Sigma-1 receptor or its expression gene as a drug target.

2. A drug for treating acute kidney injury caused by sepsis, characterized in that: The active ingredient of the drug is a substance that promotes the expression of Sigma-1 receptor, a substance that upregulates the expression level of Sigma-1 receptor, or a substance that causes an individual to express Sigma-1 receptor.

3. The drug according to claim 2, characterized in that The active pharmaceutical ingredient has the function of increasing the autophagy level of sepsis acute kidney injury cells and / or has the function of reducing the level of inflammatory cytokines in sepsis acute kidney injury cells.

4. The drug according to claim 2, characterized in that The active ingredient of the medicine is a Sigma-1 receptor gene agonist, a Sigma-1 receptor gene, a Sigma-1 receptor gene mRNA (DNA sequence is shown in SEQ ID NO: 1), an expression plasmid containing the Sigma-1 receptor gene, or an expression plasmid containing the Sigma-1 receptor gene coding region (SEQ ID NO: 1).

5. The drug according to claim 4, characterized in that The active ingredient of the medicine is the Sigma-1 receptor gene agonist PRE-084 hydrochloride, or the Sigma-1 receptor gene mRNA expression plasmid p-σ-1R whose nucleotide sequence is shown in SEQ ID NO:

2.

6. The drug according to claim 2, characterized in that The medicine is a pharmaceutical composition, which contains not only a therapeutically effective amount of active pharmaceutical ingredients but also a pharmaceutically acceptable carrier.

7. A Sigma-1 receptor gene expression plasmid, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

2.

8. Use of the Sigma-1 receptor gene expression plasmid according to claim 7 in the preparation of a drug for increasing the level of autophagy in sepsis-induced acute kidney injury cells and / or reducing the level of inflammatory cytokines in sepsis-induced acute kidney injury cells.

9. Use of Sigma-1 receptor or its gene in the preparation of a diagnostic reagent for acute kidney injury caused by sepsis, characterized in that: Sigma-1 receptor or its expressed gene serves as a biomarker for judging acute kidney injury in sepsis.

10. A diagnostic kit for acute kidney injury caused by sepsis, for implementing the use as claimed in claim 9, characterized in that: The detection target is the Sigma-1 receptor in biological samples.

Images