Synthetic lethal gene interacting with NF2 gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to application of a synthetic lethal gene interacting with an NF2 gene, and particularly discloses a medicine for treating tumors, the medicine comprises sgRNA sequences targeting the NF2 gene and an STK11 gene respectively, and the sgRNA sequences can knock out or silence the NF2 gene and the STK11 gene; wherein the sgRNA sequence of the targeted NF2 is selected from one or more of SEQ ID No: 1-2; and the sgRNA sequence of the targeted STK11 is selected from one or more of SEQ ID No: 3-6. When the NF2 gene and the STK11 gene in cancer cells are jointly knocked out or silenced, the viability (namely synthetic lethal effect) of the cells is remarkably inhibited, specific drugs such as kinase inhibitors, RNAi and ASO can be developed based on the synthetic lethal effect of the NF2 and the STK11, and the problem of drug resistance of advanced melanoma to treatment of verofenib can be solved; and a broad-spectrum and accurate treatment method can be provided for clinical treatment of NF2 mutant tumors.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to the application of a synthetic lethal gene interacting with the NF2 gene. Background Art

[0002] The synthetic lethal gene interaction was first discovered by Calvin Bridge in yeast and Drosophila, referring to a special gene interaction relationship; when two genes are mutated simultaneously, it will lead to cell death, while the survival ability of cells is not affected when a single gene is mutated. Similarly, there is also a synthetic lethal phenomenon in cancer cells. For example, when a single gene mutation has no significant effect on cell activity, but when two genes are mutated simultaneously, the cells will die. This phenomenon is usually caused by the simultaneous inactivation of genes with complementary functions. With the in-depth study, the genomic events causing synthetic lethality are no longer limited to gene mutations, but also include gene low expression, gene copy number variation, and abnormal gene methylation, etc. For example: CDK2 is overactivated in BRAF-mutated melanoma, and inhibiting the expression of CDK12 can act together with the BRAF mutation to cause the death of melanoma cells. In many cancer types, the amplification of the CCNE1 gene and the inhibition of the PKMYT1 gene will produce a synthetic lethal effect; in glioblastoma, the methylation of VRK2 and the inhibition of VRK1 will lead to a decrease in cancer cell activity.

[0003] In the field of cancer treatment, synthetic lethality refers to the phenomenon of cell death caused by the inactivation of one gene and the inhibition of another gene by a drug. In addition, synthetic lethality is environmentally dependent, and cancer heterogeneity, tumor microenvironment, and external stimuli will all affect the synthetic lethal interaction. For example, the deletion of the 53BP1 gene can inhibit the synthetic lethal interaction between PARP1 and BRCA1. Synthetic lethality is a new cancer treatment strategy, and this strategy has made important progress in cancer research since the 21st century.

[0004] NF2 is a key tumor suppressor gene located on chromosome 22q12.2, encoding the tumor suppressor protein Merlin (Moesin-ezrin-radixin-like protein), which contains an N-terminal FERM domain, a middle α-helical domain, and a C-terminal domain. Among them, the highly conserved FERM domain consists of three structural modules, F1, F2, and F3, which is the key site for the binding of Merlin protein to the cytoplasmic membrane and plays an important role in anti-tumor. As a scaffolding protein, Merlin regulates multiple signaling pathways and integrates extracellular signals to regulate morphology, motility, proliferation, and survival. Merlin has multiple biological functions: as an important regulator of cell growth, it regulates proliferation-related pathways such as MAPK, PI3K / AKT, and Rac; directly regulates the transcriptional co-activators in the YAP / TAZ-Hippo pathway through AMOT / LATS or DCAF1; as an upstream factor for nucleic acid sensing, it inhibits the anti-tumor immunity initiated by cGAS-TING in cancer cells; and is a "mediator" of the downstream signals of intracellular VEGFR2, regulating angiogenesis and strengthening the anti-cancer defense line.

[0005] Although NF2 mutations are not common in common human malignancies, when present, they can affect disease progression, treatment methods, or prognosis. Loss-of-function mutations or deletions of NF2 lead to NF2-related schwannomatosis (NF2), a disease characterized by the development of multiple tumors in the nervous system, characterized by the development of bilateral vestibular schwannomas. NF2 patients may also develop schwannomas such as meningiomas and ependymomas on other cranial nerves and peripheral nerves. The only possible treatment is surgery / radiosurgery, which usually results in the loss of related nerve functions. For this disease caused by genetic abnormalities, there are currently no highly effective targeted drugs and gene therapy strategies.

[0006] In addition, NF2 mutations are also associated with drug resistance in melanoma. Existing FDA-approved drugs such as vemurafenib (PLX4032) are small molecule biologic inhibitors targeting BRAF mutations and are first-line treatment drugs for advanced melanoma internationally, with an average duration of effectiveness of only 6 months, and patients quickly develop acquired drug resistance. Treating the human melanoma cell line A375 (which carries the BRAF V600E mutation) with vemurafenib, genes involved in the development of drug resistance in surviving cells can be screened by negative selection using the new CRISPR-Cas9 technology. Among the 18,080 genes screened in the genome-scale CRISPR-Cas9 knockout (GeCKO) library, NF2 was found to play an important role in vemurafenib resistance. Through experiments comparing drug resistance between NF2-knockout and non-knockout cells treated with vemurafenib, it was demonstrated that the deletion of Merlin (the protein encoded by NF2) is necessary for the development of resistance, and even at very low levels of Merlin expression, its presence is sufficient to maintain cell sensitivity to vemurafenib. Whole-exome sequencing and pharmacological response analysis of 60 cell lines from the National Cancer Institute (NCI-60) showed that cancer cell lines carrying NF2 mutations are resistant to vemurafenib treatment. In summary, these data indicate that NF2 mutations are associated with the development of melanoma drug resistance. Summary of the Invention

[0007] In this application, a CRISPR-Cas9 library screening was used to explore the synthetic lethal genes of NF2, and it was found that in cells where NF2 had already been knocked out, further knocking out STK11 significantly restricted cell proliferation; indicating a synthetic lethal effect between STK11 and NF2. Based on this, the present invention was completed.

[0008] In a first aspect, the present invention provides a drug for tumor treatment, the drug comprising sgRNA sequences respectively targeting the NF2 and STK11 genes, and the sgRNA sequences can achieve knockout or silencing of the NF2 or STK11 genes; wherein the sgRNA sequence targeting NF2 is selected from one or more of SEQ ID No: 1-2; the sgRNA sequence targeting STK11 is selected from one or more of SEQ ID No: 3-6.

[0009] Furthermore, the sgRNA sequences targeting the NF2 or STK11 genes are expressed by a vector or other means.

[0010] Furthermore, the sgRNA sequences can be co-expressed by the same plasmid or vector or separately expressed on different plasmids or vectors.

[0011] Even further, the plasmid or vector can enter tumor cells simultaneously or successively to exert its effect.

[0012] Furthermore, the ways for the sgRNA sequence to enter cells include, but are not limited to, direct injection of sgRNA and Cas9 protein, nanoagent-assisted delivery, and viroid particle delivery.

[0013] In one embodiment, the sgRNA sequence is introduced into tumor cells by lentivirus.

[0014] Furthermore, the tumors include, but are not limited to, liver cancer, lung cancer, pancreatic cancer, gastric cancer, colorectal cancer, glioblastoma, clear cell renal carcinoma, meningioma, ependymoma, neurofibroma, melanoma, Hodgkin lymphoma, non-Hodgkin lymphoma, breast cancer, ovarian cancer, pancreatic cancer, head and neck malignancies, urinary system malignancies, endometrial cancer, cervical cancer, osteosarcoma, chondrosarcoma, Ewing's sarcoma, thyroid cancer, and hepatoblastoma.

[0015] Furthermore, the anti-tumor drug further includes, but is not limited to, small molecule inhibitors, antisense oligonucleotides (ASO) or RNA interference reagents (RNAi), and the small molecule inhibitors, antisense oligonucleotides (ASO) or RNA interference reagents (RNAi) can directly inhibit the expression of NF2 or STK11 genes or their protein products.

[0016] In a second aspect, the present invention provides the application of an sgRNA sequence targeting NF2 and STK11 genes in the treatment of tumors, and the sgRNA sequence can achieve knockout or silencing of NF2 or STK11 genes; wherein the sgRNA sequence targeting NF2 is selected from one or more of SEQ ID No: 1-2; the sgRNA sequence targeting STK11 is selected from one or more of SEQ ID No: 3-6.

[0017] Furthermore, the sgRNA sequence targeting NF2 and STK11 genes is expressed by a vector or other means.

[0018] Furthermore, the sgRNA sequence can be co-expressed by the same plasmid or vector or separately expressed on different plasmids or vectors.

[0019] Even further, the plasmid or vector enters tumor cells simultaneously or successively to exert its function.

[0020] Furthermore, the ways for the sgRNA sequence to enter cells include, but are not limited to, direct injection of sgRNA and Cas9 protein, nanoagent-assisted delivery, and viroid particle delivery.

[0021] In one embodiment, the sgRNA sequence is introduced into tumor cells by lentivirus.

[0022] Further, the tumors include, but are not limited to, liver cancer, lung cancer, pancreatic cancer, gastric cancer, colorectal cancer, glioblastoma, clear cell renal cell carcinoma, meningioma, ependymoma, neurofibroma, melanoma, Hodgkin lymphoma, non-Hodgkin lymphoma, breast cancer, ovarian cancer, pancreatic cancer, head and neck malignancies, urinary system malignancies, endometrial cancer, cervical cancer, osteosarcoma, chondrosarcoma, Ewing's sarcoma, thyroid cancer, and hepatoblastoma.

[0023] In a third aspect, the present invention provides the use of a synthetic lethal interaction gene pair in screening anti-tumor drugs, wherein the synthetic lethal interaction gene pair is the NF2 gene and the STK11 gene, the NF2 gene sequence is SEQ ID No:7, and the STK11 gene is SEQ ID No:8; when the drug can directly inhibit the expression of the NF2 gene and the STK11 gene or their protein products, the drug can be used as an anti-tumor drug.

[0024] Further, the anti-tumor drugs include, but are not limited to, small molecule inhibitors, antisense oligonucleotides (ASO), or RNA interference reagents (RNAi).

[0025] Further, the tumors include, but are not limited to, liver cancer, lung cancer, pancreatic cancer, gastric cancer, colorectal cancer, glioblastoma, clear cell renal cell carcinoma, meningioma, ependymoma, neurofibroma, melanoma, Hodgkin lymphoma, non-Hodgkin lymphoma, breast cancer, ovarian cancer, pancreatic cancer, head and neck malignancies, urinary system malignancies, endometrial cancer, cervical cancer, osteosarcoma, chondrosarcoma, Ewing's sarcoma, thyroid cancer, and hepatoblastoma.

[0026] In a fourth aspect, the use of the STK11 gene as a synthetic lethal interaction gene of the NF2 gene in screening tumor inhibitors, wherein the STK11 gene sequence is as shown in SEQ ID No:8.

[0027] In a fifth aspect, the present invention provides an inhibitor for treating tumors based on NF2 gene deletion, wherein the inhibitor contains an sgRNA sequence targeting STK11, and the sgRNA sequence targeting STK11 is as shown in SEQ ID No:3-6.

[0028] Further, the tumors with NF2 gene deletion include mesothelioma, glioblastoma multiforme, breast cancer, colorectal cancer, skin cancer, clear cell renal cell carcinoma, liver cancer, prostate cancer, and neurofibroma, etc.

[0029] Beneficial effects

[0030] The present invention discovers that single knockout of the NF2 or STK11 gene has no obvious effect on cell growth; however, in cells where NF2 has already been knocked out, further knockout of STK11 significantly restricts cell proliferation; indicating that there is a synthetic lethality between STK11 and NF2 in A375 cells. Based on the synthetic lethality effect of NF2 and STK11, specific drugs such as kinase inhibitors, RNAi, ASO, etc. can be developed to improve the problem of resistance of advanced melanoma to vemurafenib treatment; it also provides a broad-spectrum and precise treatment method for the clinical treatment of NF2 mutant tumors. The advantage of this treatment method is that it selectively kills tumor cells without affecting normal somatic cells, which is a new method for more precise tumor treatment. Brief Description of the Drawings

[0031] Figure 1 . Construction of the NF2 KO cell line.

[0032] Figure 2 . Verification of the successful construction of the A375-Cas9 and NF2 KO-Cas9 cell lines.

[0033] Figure 3 . Enrichment and deletion of sgRNA by high-throughput screening.

[0034] Figure 4 . Verification of the effect of STK11 knockout on the proliferation of NF2 WT and NF2 KO melanoma cells.

[0035] Figure 5 . Verification of the synthetic lethality between NF2 and STK11 in A549 cells. Detailed Embodiments

[0036] The following further describes the detailed embodiments of the present invention. It should be noted here that the description of these embodiments is for helping to understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the following described embodiments can be combined with each other as long as they do not conflict with each other.

[0037] The experimental methods in the following examples are all conventional methods unless otherwise specified, and the test materials used in the following examples are all commercially available through conventional channels unless otherwise specified.

[0038] Table 1 SEQ ID No: 1-2 sequences

[0039]

[0040] Table 2 SEQ ID No: 3-6 sequences

[0041]

[0042] NF2 gene sequence:

[0043] atggccggggccatcgcttcccgcatgagcttcagctctctcaagaggaagcaacccaagacgttcaccgtgaggatcgtcaccatggacgccgagatggagtt

[0044] caattgcgagatgaagtggaaagggaaggacctctttgatttggtgtgccggactctggggctccgagaaacctggttctttggactgcagtacacaatcaaggac

[0045] acagtggcctggctcaaaatggacaagaaggtactggatcatgatgtttcaaaggaagaaccagtcacctttcacttcttggccaaattttatcctgagaatgctgaa

[0046] gaggagctggttcaggagatcacacaacatttattcttcttacaggtaaagaagcagattttagatgaaaagatctactgccctcctgaggcttctgtgctcctggcttc

[0047] ttacgccgtccaggccaagtatggtgactacgaccccagtgttcacaagcggggatttttggcccaagaggaattgcttccaaaaagggtaataaatctgtatcaga

[0048] tgactccggaaatgtgggaggagagaattactgcttggtacgcagagcaccgaggccgagccagggatgaagctgaaatggaatatctgaagatagctcagga

[0049] cctggagatgtacggtgtgaactactttgcaatccggaataaaaagggcacagagctgctgcttggagtggatgccctggggcttcacatttatgaccctgagaaca

[0050] gactgacccccaagatctccttcccgtggaatgaaatccgaaacatctcgtacagtgacaaggagtttactattaaaccactggataagaaaattgatgtcttcaagtt

[0051] taactcctcaaagcttcgtgttaataagctgattctccagctatgtatcgggaaccatgatctatttatgaggagaaggaaagccgattctttggaagttcagcagatga

[0052] aagcccaggccagggaggagaaggctagaaagcagatggagcggcagcgcctcgctcgagagaagcagatgagggaggaggctgaacgcacgagggat

[0053] gagttggagaggaggctgctgcagatgaaagaagaagcaacaatggccaacgaagcactgatgcggtctgaggagacagctgacctgttggctgaaaaggcc

[0054] cagatcaccgaggaggaggcaaaacttctggcccagaaggccgcagaggctgagcaggaaatgcagcgcatcaaggccacagcgattcgcacggaggagg

[0055] agaagcgcctgatggagcagaaggtgctggaagccgaggtgctggcactgaagatggctgaggagtcagagaggagggccaaagaggcagatcagctgaa

[0056] gcaggacctgcaggaagcacgcgaggcggagcgaagagccaagcagaagctcctggagattgccaccaagcccacgtacccgcccatgaacccaattccag

[0057] caccgttgcctcctgacataccaagcttcaacctcattggtgacagcctgtctttcgacttcaaagatactgacatgaagcggctttccatggagatagagaaagaaa

[0058] aagtggaatacatggaaaagagcaagcatctgcaggagcagctcaatgaactcaagacagaaatcgaggccttgaaactgaaagagagggagacagctctgga

[0059] tattctgcacaatgagaactccgacaggggtggcagcagcaagcacaataccattaaaaagctcaccttgcagagcgccaagtcccgagtggccttctttgaagagctc(SEQ ID No:7)

[0060] STK11 gene sequence:

[0061] atggaggtggtggacccgcagcagctgggcatgttcacggagggcgagctgatgtcggtgggtatggacacgttcatccaccgcatcgactccaccgaggtcat

[0062] ctaccagccgcgccgcaagcgggccaagctcatcggcaagtacctgatgggggacctgctgggggaaggctcttacggcaaggtgaaggaggtgctggactc

[0063] ggagacgctgtgcaggagggccgtcaagatcctcaagaagaagaagttgcgaaggatccccaacggggaggccaacgtgaagaaggaaattcaactactgag

[0064] gaggttacggcacaaaaatgtcatccagctggtggatgtgttatacaacgaagagaagcagaaaatgtatatggtgatggagtactgcgtgtgtggcatgcaggaa

[0065] atgctggacagcgtgccggagaagcgtttcccagtgtgccaggcccacgggtacttctgtcagctgattgacggcctggagtacctgcatagccagggcattgtg

[0066] cacaaggacatcaagccggggaacctgctgctcaccaccggtggcaccctcaaaatctccgacctgggcgtggccgaggcactgcacccgttcgcggcggac

[0067] gacacctgccggaccagccagggctccccggctttccagccgcccgagattgccaacggcctggacaccttctccggcttcaaggtggacatctggtcggctgg

[0068] ggtcaccctctacaacatcaccacgggtctgtaccccttcgaaggggacaacatctacaagttgtttgagaacatcgggaaggggagctacgccatcccgggcga

[0069] ctgtggccccccgctctctgacctgctgaaagggatgcttgagtacgaaccggccaagaggttctccatccggcagatccggcagcacagctggttccggaaga

[0070] aacatcctccggctgaagcaccagtgcccatcccaccgagcccagacaccaaggaccggtggcgcagcatgactgtggtgccgtacttggaggacctgcacgg

[0071] cgcggacgaggacgaggacctcttcgacatcgaggatgacatcatctacactcaggacttcacggtgcccggacaggtcccagaagaggaggccagtcacaat

[0072] ggacagcgccggggcctccccaaggccgtgtgtatgaacggcacagaggcggcgcagctgagcaccaaatccagggcggagggccgggcccccaaccctgcccgcaaggcctgctccgccagcagcaagatccgccggctgtcggcctgcaagcagcag(SEQ ID No:8)

[0073] Example 1: High-throughput screening of synthetic lethal kinase genes of NF2 in melanoma cells by CRISPR / Cas9 Screen

[0074] (1) Construction of A375 cells with NF2 KO:

[0075] By traditional CRISPR-Cas9 gene editing technology, monoclonal cells with NF2 knockout were obtained and strictly verified at the gene and protein levels (see Figure 1 ).

[0076] (2) Construction of stable Cas9 cell line:

[0077] Stable cells expressing Cas9 were established by introducing the LentiV_Cas9_puro vector (Addgene: #108100). First, Cas9 was integrated into the genome of NF2 KO cells at a high copy number. The integration process included the following steps: ① Lentivirus packaging - The lentivirus system used a three-plasmid system of Cas9, psPAX2, and pMD2.G. The plasmids were mixed at a mass ratio of 3:2:1 and transiently transfected into HEK293T cells using lipo3000. After gently mixing, the cells were cultured in an incubator for 24 h, and the virus supernatant was collected after filtration through a 0.45 μm pore size filter membrane. ② Infection: Cells were counted one day before virus infection, and approximately 2×10 5 cells were seeded in a 24-well plate. After culturing overnight, 500 μL of the virus stock solution was added. After 48 h of virus infection, 1 μg / mL puromycin was added to screen the cells for approximately 1 week to obtain a cell line stably expressing Cas9.

[0078] A375 wild-type cells and NF2 KO cells were respectively infected with a high concentration of Cas9 virus, and stable cell lines of A375-Cas9 and NF2 KO-Cas9 were obtained through continuous screening with 1 μg / mL puromycin. By using Negative sgRNA (GACCGGAACGATCTCGCGTA) that did not target any site and sgRNA targeting ZNF410

[0079] The editing efficiency of (GAACCACCAGATGTTTTCGG) was used to verify the successful construction of the Cas9 stable cell line (see Figure 2 ).

[0080] (3) Construction of sgRNA vector

[0081] The sgRNA library targeting the human kinase domain (Addgene #117725), which includes kinase domain-targeting sgRNAs and positive / negative control sgRNAs, was cloned into the BsmB1-digested LRG2.1 vector (Addgene: #108098) by PCR reaction.

[0082] 1 μL and 10 μL of the bacterial liquid mixture were taken respectively for plating, and the total number of colonies that could be produced in one experiment was estimated by the number of growing colonies, so as to judge whether the number of mutants required for the experiment was obtained, and the remaining bacterial liquid was expanded and cultured and then the plasmid was extracted.

[0083] (4) Amplicon sequencing: The plasmid library was subjected to amplicon sequencing to detect the coverage of sgRNAs.

[0084] (5) Lentivirus packaging: The constructed lentiviral vector LRG2.1 containing the sgRNA library and the packaging plasmid were co-transfected into HEK-293T cells to package the virus. The virus stock solution was collected, ultrafiltered and concentrated, and the titer was measured;

[0085] (6) Cell infection: The target cells were serially diluted and infected with the packaged lentivirus (expressing sgRNA and the screening marker green fluorescent protein GFP). When the MOI was 0.3, the infection efficiency was about 30%; specifically, a virus volume of 120 μL was used to achieve this MOI value.

[0086] (7) Construction of sgRNA stable transfected cell line: On the first day, 1×10 6 A375-Cas9 and NF2 KO-Cas9 cells were seeded in 6-well plates respectively, and 120 μL of virus was added. A total of 10 wells were replicated; 48 h after infection, the cells in the 10 wells were mixed together, and the GFP + positive cells were sorted by flow cytometry to obtain a stable cell line expressing the sgRNA library.

[0087] (8) High-throughput screening: After flow cytometry sorting, half of the cells (about 2.25×10 6 ) from the stable cell population were taken as the cells of the 0th generation (P0), and their gDNA was collected. At the same time, the other half of the cells were seeded in a 10-cm culture dish and continued to be cultured until the dish was fully confluent. At this time, the first passage operation was carried out, and during the passage, 5×10 6Cells were used as the first-generation cells (P1), and 3×10 6 cells were seeded in a 10-cm culture dish to allow the cells to continue growing. When these cells reached confluence again, the second passage operation was performed. Similarly, during the passage process, 5×10 6 cells were collected as the second-generation cells (P2), and 3×10 6 were seeded in a new culture dish for continued cultivation. When the cells reached confluence, the passage operation was performed again, and so on to obtain cells of subsequent passages such as P3, P4, etc.

[0088] (9) Next-generation sequencing: Using the above gDNA as a template, the sgRNA region was amplified targetedly, and the enrichment and deletion of sgRNA were detected by amplicon sequencing (see Figure 3 A). In the amplicon sequencing data analysis process, bbmerge, cutadapt, and starcode software were used. The main function of bbmerge is to fuse the paired sequences obtained during the sequencing process into a complete sequence, thereby improving the quality and analyzability of the sequence; cutadapt is used to remove adapters and low-quality parts in the sequence to improve the accuracy of subsequent analysis; starcode is used to classify the processed sequences and count the number of times each variant appears in the library, thereby achieving precise measurement of the coverage and frequency changes of sgRNA variants.

[0089] Experimental results: Through CRISPR / Cas9 Screen high-throughput screening, it was found that STK11 is the synthetic lethal kinase gene of NF2 in A375 cells (see Figure 3 B).

[0090] Example 2 Verification of the synthetic lethal gene of NF2 in melanoma A375 cells

[0091] Verify the synthetic lethal gene STK11 identified by the above high-throughput screening in A375 cells (melanoma).

[0092] (1) Construction of sgRNA vector: First, single-stranded DNA oligos of the gRNA sequence were synthesized, then annealed and paired to generate double-stranded DNA, and then directly ligated into the digested LRG2.1 lentiviral vector through the restriction enzyme sites contained at both ends; the ligation product was transferred into Stbl3 competent cells, and the grown monoclonal colonies were identified by Tn5 sequencing, and the clones with correct alignment were the successfully constructed vectors.

[0093] (2) Lentivirus packaging: Package the sgRNA virus targeting STK11 according to the method in Example 1.

[0094] (3) Construction of Cas9 stable cell lines: According to the method in Example 1, stable cell lines integrating the above sgRNAs were constructed in A375-Cas9 and NF2 KO-Cas9 cells respectively.

[0095] (4) Flow cytometry detection of GFP + Proportion change of cells: 48 hours after the cells were infected with sgRNA, half of the cells were taken out as the 0th generation cells (P0), and flow cytometry was performed to detect the proportion of GFP + cells. At the same time, the other half of the cells were continuously cultured under appropriate conditions. After they grew to confluence, the first passage operation was performed. During the passage process, a part of the cells was taken out as the 1st generation cells (P1) for flow cytometry detection of GFP + proportion, and the remaining cells were continuously cultured for subsequent experiments. Then, according to the same passage and detection process, flow cytometry detections of cells of subsequent generations such as P2, P3, P4, etc. were carried out in turn. After each passage, attention should be paid to observing and recording the change situation of the GFP + cell proportion. If the proportion of GFP + cells gradually decreases with the increase of the passage number, this may indicate that there is a synthetic lethality between the gene targeted by this sgRNA and NF2. On the contrary, if the proportion of GFP + cells does not change significantly or the proportion is getting higher and higher, this may indicate that there is no significant synthetic lethality between the gene targeted by this sgRNA and NF2. To verify the reliability of the experimental results, cells were infected with Negative sgRNA without any targeting effect, and flow cytometry was also performed to detect the change of the GFP + cell proportion.

[0096] Experimental results: In A375 wild-type cells, single knockout of NF2 or STK11 gene had no obvious effect on cell growth; but in cells with NF2 already knocked out, further knockout of STK11 significantly restricted cell proliferation (as Figure 4 shown); indicating that there is a synthetic lethality between STK11 and NF2 in A375 cells.

[0097] Example 3 Verification of synthetic lethality of NF2 / STK11 in lung adenocarcinoma A549 cells

[0098] Verification of the synthetic lethality between NF2 and STK11 in lung adenocarcinoma A549 cells. To ensure the accuracy and repeatability of the experimental results, 2 kinds of sgRNAs were used to target the NF2 gene, and 4 kinds of sgRNAs were designed to target the STK11 gene, and their sequences are shown in Tables 1 and 2.

[0099] (1) Construction of Cas9 stable cell line: The A549-Cas9 stable cell line was constructed according to the method in Example 1, and the concentration of puromycin screening was 1 μg / mL.

[0100] (2) Construction of sgRNA vector: The sgRNA plasmid was constructed according to the method in Example 2. Different from the previous one, the GFP on LRG2.1 was replaced with mCherry, and then the sgRNA targeting NF2 was ligated to the LRG2.1-mCherry vector, while the sgRNA targeting STK11 was ligated to the LRG2.1-GFP vector.

[0101] (3) Lentivirus packaging: The sgRNA viruses targeting NF2 and STK11 were packaged according to the method in Example 1.

[0102] (4) Construction of sgRNA stable cell line: The sgRNA virus (mCherry) targeting NF2 and the sgRNA virus (GFP) targeting STK11 were freely combined and added to A549-Cas9 cells to obtain a stable cell line expressing sgRNA.

[0103] (5) Flow cytometry detection of GFP + / mCherry + Proportion change of cells: 48 hours after the cells were infected with sgRNA, half of the cells were taken as the 0th generation cells (P0), and flow cytometry was performed to detect the proportion of GFP+ / mCherry+ double-positive cells. At the same time, the other half of the cells were continuously cultured under appropriate conditions. After they grew to confluence, the first passage operation was carried out. During the passage process, a part of the cells was taken as the 1st generation cells (P1) for flow cytometry to detect the GFP+ / mCherry+ proportion, and the remaining cells were continuously cultured for subsequent experiments. Then, according to the same passage and detection process, flow cytometry of cells of subsequent generations such as P3, P4, P5, etc. was carried out in turn. A decreasing GFP + / mCherry + proportion represents the existence of synthetic lethality between STK11 and NF2. An unchanged or increasing GFP + / mCherry + proportion represents the absence of synthetic lethality between STK11 and NF2, and the single transfection of NF2-sgRNA and STK11-sgRNA was used as a negative control.

[0104] Experimental results: In A549 cells, when knocking out the NF2 or STK11 gene alone, it was observed that the cell growth was inhibited to a certain extent; however, when both the NF2 and STK11 genes were knocked out simultaneously, the proliferation ability of the cells was significantly restricted (as Figure 5 shown).

[0105] The experimental results show that there is a synthetic lethal relationship between STK11 and NF2 in the context of lung adenocarcinoma A549 cells, that is, the simultaneous inactivation of the two genes reduces cell viability.

Claims

1. A drug for treating tumors, comprising sgRNA sequences targeting NF2 and STK11 genes, respectively, and the sgRNA sequences can achieve knockout or silencing of NF2 and STK11 genes; wherein the sgRNA sequence targeting NF2 is selected from one or more of SEQ ID No: 1-2; and the sgRNA sequence targeting STK11 is selected from one or more of SEQ ID No: 3-6.

2. The drug for treating tumors according to claim 1, characterized in that: The sgRNA sequences targeting NF2 and STK11 genes are expressed via a vector or other means.

3. The drug for treating tumors according to claim 1, characterized in that: The sgRNA sequences can be co-expressed by the same plasmid or vector or expressed separately on different plasmids or vectors.

4. The drug for treating tumors according to claim 1, characterized in that: The methods for the sgRNA sequence to enter the cell include, but are not limited to, direct injection of sgRNA and Cas9 protein, nanoagent-assisted delivery, and virus-like particle delivery.

5. The drug for treating tumors according to claim 1, characterized in that: The tumors include, but are not limited to, liver cancer, lung cancer, pancreatic cancer, gastric cancer, colorectal cancer, brain glioma, renal clear cell carcinoma, meningioma, ependymoma, neurofibroma, melanoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, breast cancer, ovarian cancer, pancreatic cancer, head and neck malignancies, urinary system malignancies, endometrial cancer, cervical cancer, osteosarcoma, chondrosarcoma, Ewing's sarcoma, thyroid cancer, and hepatoblastoma.

6. Application of sgRNA sequences targeting NF2 and STK11 genes in the treatment of tumors, wherein the sgRNA sequences can achieve knockout or silencing of NF2 and STK11 genes; wherein the sgRNA sequence targeting NF2 is selected from one or more of SEQ ID No: 1-2; and the sgRNA sequence targeting STK11 is selected from one or more of SEQ ID No: 3-6.

7. Use of a group of synthetic lethal interaction gene pairs in screening anti-tumor drugs, wherein the synthetic lethal interaction gene pair is NF2 gene and STK11 gene, the NF2 gene sequence is SEQ ID No: 7, and the STK11 gene is SEQ ID No: 8; wherein, When the drug can directly inhibit the expression of NF2 gene and STK11 gene or their protein products, the drug can be used as an anti-tumor drug.

8. Use of a set of synthetic lethal interaction gene pairs as claimed in claim 7 in screening anti-tumor drugs, characterized in that: The anti-tumor drugs include but are not limited to small molecule inhibitors, antisense oligonucleotides (ASOs) or RNA interference agents (RNAi).

9. Use of the STK11 gene as a synthetic lethal interaction gene of the NF2 gene in screening tumor suppressors, wherein the STK11 gene sequence is shown in SEQ ID No:

8.

10. An inhibitor for treating tumors based on NF2 gene deletion, wherein the inhibitor contains an sgRNA sequence targeting STK11, and the sgRNA sequence targeting STK11 is shown in SEQ ID No: 3-6.

Images