A carbon quantum dot, a preparation method thereof, and an application thereof in delivering nucleic acid molecules

Abstract

The present invention belongs to the technical field of gene delivery vectors, and particularly relates to a carbon quantum dot, a preparation method thereof, and an application thereof in delivering nucleic acid molecules. The preparation method of the carbon quantum dot comprises: S1. heating a saccharide compound to melt at 120-155 °C, and then adding an aqueous solution of dimethyldiallylammonium chloride according to a mass ratio of the saccharide compound to dimethyldiallylammonium chloride of 1:0.129-1.291, and keeping the temperature at 150-180 °C for 30-240 min; S2. cooling the reaction product to room temperature, adding deionized water to dissolve it, then centrifuging to collect the supernatant, and obtaining the carbon quantum dot through filtration, dialysis and freeze drying. The carbon quantum dot of the present invention has good water solubility and dispersibility, carries a positive charge, can efficiently bind to RNA molecules and protect the RNA molecules from being degraded by nucleases, is beneficial to greatly improving the stability and effectiveness of nucleic acid molecules, and has excellent nucleic acid delivery ability, and has broad application prospects in the fields of nucleic acid delivery and gene therapy.

Description

Technical Field

[0001] The present invention relates to the technical field of gene delivery vectors, and particularly relates to a carbon quantum dot, a preparation method thereof, and an application thereof in delivering nucleic acid molecules. Background Art

[0002] In the fields of gene transfection and gene therapy, it is crucial for the realization of the functions of genetic materials to safely and effectively deliver exogenous genetic materials, such as nucleic acid molecules like deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), to specific cells. Currently, the mainstream gene delivery vectors mainly include viral vectors such as adeno-associated virus (AAV) vectors and lentivirus (LV) vectors, and non-viral vectors such as lipid nanoparticles (LNP) and cationic polymers. Viral vectors package exogenous genes into the outer shells of natural viruses and introduce the exogenous genes into cells by utilizing the infectivity of the viruses to host cells; viral vectors are widely used due to their high transduction efficiency and expression efficiency, but their antigenicity and potential tumorigenic risks limit their widespread application. Non-viral gene delivery vectors not only possess the safety and stability that viral vectors do not have, but also have advantages such as being easy to prepare and having a high ability to carry target genes. For example, polymers can effectively condense DNA through strong electrostatic interactions to form relatively stable polyelectrolyte complexes (PECs), and these PECs are easy to internalize into cells and can effectively protect DNA from degradation by DNase. As another approach for delivering exogenous genetic materials, non-viral vectors have increasingly attracted the attention of researchers.

[0003] Short non-coding RNA is a type of RNA that is no longer than 40 nt and does not participate in protein coding. Although short non-coding RNA molecules are small, they are involved in the regulation and control of almost all life activities, including cell proliferation, differentiation, apoptosis, cell metabolism, and body immunity, and play a vital role in living organisms. Common short non-coding RNAs include microRNA (miRNA) and small interfering RNA (siRNA), which can regulate target genes in cells. For example, siRNA specifically degrades mRNA synthesized by specific proteins, thereby accurately inhibiting or shutting down specific gene expression, making siRNA extremely promising in the field of life science research and clinical treatment of diseases such as cancer. However, since miRNA and siRNA are negatively charged, they cannot directly enter the target cell through the cell membrane to function, and their structural stability is poor, making them more easily degraded by nucleases that are widely present in organisms. In order to improve the stability of siRNA, siRNA is usually chemically modified at multiple sites, but chemically modified siRNA has disadvantages such as metabolic instability and increased toxic side effects. At present, delivery systems based on non-viral vectors have shown very broad application prospects in small molecule RNA delivery. Among them, nanoparticle materials have attracted great attention due to their unique characteristics such as small size (particle size is usually 0.1-100nm), strong chemical inertness, low toxicity, good biocompatibility and easy functionalization. However, due to the lack of gene packaging ability, nanoparticle materials are difficult to be directly used in gene carriers. Therefore, it is of great significance to develop new small molecule RNA nanoparticle delivery carriers to achieve efficient RNA loading and transport it into cells while improving RNA stability and extending half-life. Summary of the invention

[0004] In view of the above problems of the prior art, the present invention provides a carbon quantum dot and a method for preparing the same, and provides the use of the aforementioned carbon quantum dots as a carrier in the delivery of nucleic acid molecules. The carbon quantum dots provided by the present invention have good water solubility and dispersibility, carry positive charges, can efficiently bind to RNA molecules and protect RNA molecules from being degraded by nucleases, which is beneficial to greatly improve the stability and effectiveness of nucleic acid molecules, and have excellent nucleic acid delivery capabilities, and have broad application prospects in the fields of nucleic acid delivery and gene therapy. To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0005] The first aspect of the present invention provides a method for preparing carbon quantum dots, comprising the following steps:

[0006] S1. Heat the saccharide compound to 120 - 155 °C to melt the saccharide compound, then add an aqueous solution of dimethyldiallylammonium chloride, and keep it at 150 - 180 °C for 30 - 240 min. The mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.129 - 1.291;

[0007] S2. Cool the reaction product of step S1 to room temperature, add deionized water to dissolve the reaction product, then centrifuge to collect the supernatant. The supernatant is filtered, dialyzed, and freeze-dried to obtain the carbon quantum dots.

[0008] Further, in step S1, the mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.645.

[0009] Further, in step S1, the mixed reaction system of the saccharide compound and the aqueous solution of dimethyldiallylammonium chloride is kept at 150 °C for 180 min.

[0010] Further, the saccharide compound is selected from at least one of glucose, xylose, arabinose, fructose, and mannose.

[0011] Further, the saccharide compound is selected from glucose, and the glucose is heated and melted at 150 °C for 30 min.

[0012] Furthermore, heat glucose at 150 °C for 30 min to melt it, then add an aqueous solution of dimethyldiallylammonium chloride, and keep it at 150 °C for 180 min. The mass ratio of the glucose to the dimethyldiallylammonium chloride is 1:0.645.

[0013] The second aspect of the present invention provides carbon quantum dots prepared by the preparation method of the carbon quantum dots as described above.

[0014] The third aspect of the present invention provides the application of the carbon quantum dots as described above as a carrier in delivering nucleic acid molecules.

[0015] Further, the nucleic acid molecule is a small molecule RNA; furthermore, it is siRNA.

[0016] Further, the combination of the carbon quantum dots and the nucleic acid molecule includes the following steps: dissolve the carbon quantum dots in nuclease-free water, and ultrasonically disperse to obtain a carbon quantum dot solution; add the nucleic acid molecule to the carbon quantum dot solution, mix well, and let it stand at room temperature to form a carbon quantum dot-nucleic acid complex.

[0017] Further, the mass ratio of the nucleic acid molecule to the carbon quantum dots is 1:1.

[0018] Furthermore, the concentration of the carbon quantum dot solution is 0.5 - 2 mg / mL.

[0019] The advantages and positive effects of the present invention are as follows:

[0020] 1. The carbon quantum dots prepared by the present invention have good water solubility and dispersibility, carry a positive charge after synthesis, can efficiently bind to RNA molecules to form stable complexes, can effectively resist nuclease degradation when incubated with nucleases at 10 - 100 μg / mL for 60 min, achieve the protection of RNA molecules, maintain their structural integrity, significantly improve the stability of nucleic acid molecules, and can achieve efficient delivery of nucleic acid molecules. Moreover, they have low cytotoxicity and can desorb in the cell physiological environment to exert the specific functions of RNA; they have broad application prospects in the fields of nucleic acid delivery and gene therapy.

[0021] 2. The method for preparing carbon quantum dots in the present invention is simple, and a large amount of carbon quantum dots can be obtained at one time only through steps such as melting and heating the reaction substrate, washing with water, and dialysis. Description of the Drawings

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0023] Figure 1 It is the transmission electron microscope inspection image of the carbon quantum dots prepared in the embodiment of the present invention, and the scale bar in the figure is 20 nm;

[0024] Figure 2 It is the particle size distribution diagram of the carbon quantum dots prepared in the embodiment of the present invention;

[0025] Figure 3 It is the infrared spectrum diagram of the carbon quantum dots prepared in the embodiment of the present invention;

[0026] Figure 4 It is the diagram of the color change of the reaction product solution and the precipitation situation after the reaction product solution is centrifuged at 12000 rpm for 10 min under different addition amounts of dimethyldiallylammonium chloride in the embodiment of the present invention;

[0027] Figure 5 It is the production diagram of carbon quantum dots under different addition amounts of dimethyldiallylammonium chloride in the embodiment of the present invention;

[0028] Figure 6This is the electrophoresis diagram of siRNA in the embodiments of the present invention incubated with different concentrations of nuclease RNase A for different times. Among them, Figure A shows incubation with 10 μg / mL RNase A for 10 min, Figure B shows incubation with 10 μg / mL RNase A for 60 min, Figure C shows incubation with 100 μg / mL RNase A for 10 min, and Figure D shows incubation with 100 μg / mL RNase A for 60 min;

[0029] Figure 7 This is the relative expression diagram of the green fluorescent protein gene after the siRNA is targeted and delivered into cells by carbon quantum dots in the embodiments of the present invention. Detailed implementation manners

[0030] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0031] Based on the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for schematically illustrating specific aspects of the present invention. In fact, various changes that can be made by those skilled in the art in the relevant field to the embodiments of the present invention are all covered by the scope of the appended claims.

[0032] In order to better understand the present invention rather than limit its scope, all numbers representing amounts, percentages and other numerical values used in the present invention should be understood as being modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should at least be regarded as obtained according to the reported significant figures and by the conventional rounding method.

[0033] In addition, it should be noted that unless otherwise defined, scientific and technical terms used in the context of the present invention should have the meanings commonly understood by those of ordinary skill in the art. The meanings of terms such as "comprising", "including", "containing", "having" and the like are non-restrictive, that is, other steps and other components can be added without affecting the results.

[0034] To make the above objectives, features and advantages of the present invention more obvious and understandable, the present invention will be described in detail below.

[0035] As a new type of zero-dimensional nanomaterial, carbon quantum dots have the characteristics of high water solubility, excellent biocompatibility, and easy functionalization, and are applied in the fields of bioimaging, energy storage, photocatalysis, biochemistry, etc. Preparing carbon quantum dots from low-cost and renewable biomass resources helps to reduce costs and increase efficiency. Carbohydrates are a rich, readily available, and low-cost biomass carbon source. The C=C formed by the dehydration of its molecules is the basic structural unit of graphene. Preparing carbon quantum dots with it as the precursor has great economic advantages. However, the existing carbon quantum dots are usually negatively charged after synthesis and cannot directly and effectively load nucleic acid molecules, which restricts their application in the field of nucleic acid delivery. It needs to be modified with PEI, amino groups, etc. to bind to nucleic acid molecules such as siRNA. However, the modification process of carbon quantum dots is complex, the preparation and production are difficult, and it is easy to have an adverse impact on the structure and cytotoxicity of quantum dots.

[0036] Based on this, the present invention provides a new type of carbon quantum dot that specifically solves the above-mentioned disadvantages. Its preparation method includes the following steps:

[0037] S1. Heat the carbohydrate compound to 120 - 155 °C to melt the carbohydrate compound, and then add an aqueous solution of dimethyldiallylammonium chloride. Keep it at 150 - 180 °C for 30 - 240 min. The mass ratio of the carbohydrate compound to the dimethyldiallylammonium chloride is 1:0.129 - 1.291;

[0038] S2. Cool the reaction product of step S1 to room temperature, add deionized water to dissolve the reaction product, and then centrifuge to collect the supernatant. The supernatant is filtered, dialyzed, and freeze-dried to obtain the carbon quantum dots.

[0039] The present invention uses a saccharide compound as a carbon source precursor, heats it to melt into a homogeneous phase, and then adds dimethyldiallylammonium chloride. It is kept warm at the melting temperature for a period of time. Dimethyldiallylammonium chloride is a strong cationic polyelectrolyte, and each molecule carries a positive charge. It has excellent solubility and the solution is weakly acidic (pH is about 4 - 7). Its weak acidity can play an acidic catalytic role to accelerate the carbonization of the saccharide compound, and at the same time, a relatively high density of positive charges can be modified on the surface of the carbon quantum dots. After the heat preservation is completed, the product is dispersed in deionized water, the precipitate and the supernatant are separated, and the supernatant is filtered and dialyzed to obtain positively charged carbon quantum dots. These carbon quantum dots have good dispersibility and can quickly form a complex with negatively charged small molecule RNA through electrostatic adsorption, playing a role in protecting the RNA molecule, effectively avoiding the rapid degradation of the RNA molecule in a high-concentration nuclease environment, and improving its stability and effectiveness in a complex environment, greatly extending the half-life. Moreover, after the carbon quantum dots of the present invention are loaded with RNA molecules, they can be efficiently delivered into cells without affecting the biological activity of the RNA. Taking siRNA as an example, after being delivered by the carbon quantum dots of the present invention, siRNA can be effectively desorbed and exert RNA interference activity in the biological environment. In short, the carbon quantum dots prepared by the present invention have good water solubility and dispersibility, carry positive charges after synthesis, and can efficiently bind to RNA molecules and form stable complexes without the need for additional chemical modification, achieving the protection of RNA molecules, maintaining their structural integrity, and enabling the efficient delivery of RNA molecules. Moreover, they have low cytotoxicity, have little impact on the normal physiological characteristics of cells, can be efficiently desorbed in the cell physiological environment to exert the specific functions of RNA, and have broad application prospects in the fields of nucleic acid delivery and gene therapy. In addition, the method for preparing carbon quantum dots in the present invention is simple, and a large amount of carbon quantum dots can be obtained at one time.

[0040] Optionally, the saccharide substances described above include but are not limited to glucose, xylose, arabinose, fructose, and mannose. Their heating melting temperature is adaptively selected according to the type of the saccharide compound, as long as the saccharide compound reaches the molten state. For example, the melting point of glucose is about 146°C, the melting point of xylose is about 153°C, the melting point of arabinose is about 155°C, the melting point of fructose is about 110°C, and the melting point of mannose is about 133°C. Their heating melting temperature is in the range of 120°C - 155°C. Preferably, the melting temperature in step S1 is close to or equal to the melting point temperature of each saccharide compound.

[0041] The present invention first melts the saccharide compound into a homogeneous phase, which is beneficial to improving the consistency of the reaction and enabling it to undergo decomposition, condensation, carbonization and other reactions more uniformly. With the catalytic action of dimethyldiallylammonium chloride, carbon quantum dots can be prepared at 150-180 °C in an open system under normal pressure, thereby increasing the yield of quantum dots. When the melting temperature is relatively low, the time required for the saccharide compound to melt into a homogeneous phase is relatively long. Increasing the temperature can significantly shorten the melting time. However, when the temperature is much higher than the melting temperature, with continuous magnetic stirring, the saccharide compound closest to the heating medium first melts rapidly and then mixes with the unmelted saccharide compound far from the heating medium to form large lumps. This leads to slow heat transfer inside and may locally form carbon blocks. Therefore, increasing the temperature does not significantly shorten the complete melting time. In addition, when the temperature is too high, under the catalysis of dimethyldiallylammonium chloride, the rate of saccharide condensation and carbonization is too fast, and the reaction products are prone to polymerize into large solid insoluble substances, affecting the acquisition of carbon quantum dots.

[0042] Generally, the prices of xylose, arabinose, fructose and mannose are much higher than that of glucose. Considering the ease of obtaining raw materials and economy, the present invention preferably uses glucose as the carbon source for preparing carbon quantum dots, and preferably heats and melts glucose at 150 °C for 30 min.

[0043] In a preferred embodiment, in step S1, the mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.645. The addition amount of dimethyldiallylammonium chloride is controlled according to the concentration and addition volume of the dimethyldiallylammonium chloride aqueous solution. Generally, the mass concentration (wt) of the dimethyldiallylammonium chloride aqueous solution is 60-65%. For example, a dimethyldiallylammonium chloride aqueous solution with a mass percentage of 62.05 (wt)% is prepared. At this time, 1 g of the saccharide compound corresponds to the addition of 1 mL of 62.05 (wt) dimethyldiallylammonium chloride aqueous solution.

[0044] In the present invention, dimethyldiallylammonium chloride serves as a catalyst for the synthesis of carbon quantum dots on the one hand and modifies the surface of carbon quantum dots with positive charges on the other hand. By exploring the generation and properties of carbon quantum dots within the range of the mass ratio of sugar to dimethyldiallylammonium chloride from 1:0.129 to 1.291, it is found that when the amount of the catalyst dimethyldiallylammonium chloride is low (for example, without adding a catalyst or the catalyst amount is lower than 1:0.129), when the reaction is carried out under normal pressure, even if the reaction time is extended to more than 240 min, it is difficult for sugar compounds to be carbonized to form carbon quantum dots, which will lead to a low preparation reaction rate of carbon quantum dots and few positive charges on the surface of the synthesized carbon quantum dots, possibly reducing the binding stability with negatively charged nucleic acid molecules; however, when the amount of dimethyldiallylammonium chloride increases, it will lead to an excessively fast reaction rate, easily polymerizing to form large insoluble solid particles, resulting in a decrease in the yield of carbon quantum dots. In addition, the zeta potential of the obtained carbon quantum dots is too high, making the nucleic acid bound to it not easily dissociated, affecting the exertion of the biological activity of RNA molecules. Therefore, considering the generation efficiency and charge property of carbon quantum dots, the present invention preferably selects the mass ratio of sugar compounds to dimethyldiallylammonium chloride as 1:0.645.

[0045] It should be noted that the aqueous solution of dimethyldiallylammonium chloride needs to be slowly added to the molten glucose to avoid the boiling over of the mixed solution in an open normal pressure reaction system.

[0046] Preferably, in step S1, the mixed reaction system of sugar compounds and the aqueous solution of dimethyldiallylammonium chloride is kept at 150 °C for 180 min.

[0047] More preferably, the present invention includes: heating glucose to melt at 150 °C for 30 min, then adding the aqueous solution of dimethyldiallylammonium chloride, and keeping it at 150 °C for 180 min, and the mass ratio of the glucose to the dimethyldiallylammonium chloride is 1:0.645. The glucose-based carbon quantum dots (NGCDs) prepared in this way have a higher yield of carbon quantum dots and better ability to protect RNA molecules against nuclease degradation, and can achieve long-term protection of siRNA in a high-concentration nuclease environment.

[0048] Optionally, in step S2, the dissolved reaction product is centrifuged at 12000 rpm for 10 min, the supernatant is collected, filtered through a 0.22 μm aqueous filter membrane, and the filtrate is dialyzed and purified with a dialysis bag with a molecular cut-off of 1000 Da for 48 h, and the dialysis solution is changed every 4 h during this period. The dialysis solution can be selected from deionized water. After dialysis is completed, the retentate in the dialysis bag is collected and freeze-dried to obtain the carbon quantum dots.

[0049] Another embodiment of the present invention provides carbon quantum dots prepared by the preparation method of the carbon quantum dots as described above.

[0050] The carbon quantum dots prepared based on the above method have good water solubility and dispersibility, and can achieve long-term protection of siRNA in a high-concentration nuclease environment. When incubated with 10-100 μg / mL nuclease for 60 minutes, they can effectively resist nuclease degradation, maintain the integrity of the nucleic acid structure, improve the stability and effectiveness of nucleic acid molecules, greatly extend the half-life, and have excellent nucleic acid delivery capabilities.

[0051] Another embodiment of the present invention provides the use of the carbon quantum dots as described above as carriers in delivering nucleic acid molecules, especially in delivering small molecule RNA, where the small molecule RNA can be siRNA, and the siRNA can be in double-stranded or single-stranded form.

[0052] The use of the carbon quantum dots as carriers in delivering nucleic acid molecules has the same advantages as those of the carbon quantum dots over the prior art as described above, and will not be repeated here.

[0053] Specifically, the carbon quantum dots are combined with the nucleic acid molecules, including the following steps: dissolving the carbon quantum dots in nuclease-free water, ultrasonically dispersing, and obtaining a carbon quantum dot solution; adding the nucleic acid molecule to the carbon quantum dot solution, mixing well, and standing at room temperature to form a carbon quantum dot-nucleic acid complex.

[0054] Optionally, the mass ratio of the nucleic acid molecules to the carbon quantum dots is 1:1.

[0055] Optionally, the concentration of the carbon quantum dot solution is 0.5-2 mg / mL. The carbon quantum dots are dissolved in nuclease-free water and ultrasonically dispersed at room temperature for 10-30 min to form a uniform carbon quantum dot solution.

[0056] Optionally, the standing time at room temperature generally needs to be greater than 30 min to ensure sufficient binding of the nucleic acid molecules to the carbon quantum dots.

[0057] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples without specifying specific conditions are generally carried out according to the conditions recommended by the manufacturer.

[0058] In the following examples, the carbon source used to prepare carbon quantum dots was selected from glucose, and the aqueous solution of dimethyldiallylammonium chloride was purchased from Aladdin.

[0059] The small interfering RNA (siRNA) used to verify carbon quantum dots as a delivery vector for nucleic acid molecules has a length of 21 base pairs. It is obtained by in vitro transcription to form a double-stranded structure. During in vitro transcription, the sense strand template of the siRNA molecule transcribes a sense RNA single-stranded molecule, and the antisense strand template transcribes an antisense RNA single-stranded molecule. The sense and antisense RNA transcripts are mixed and annealed to form a double-stranded siRNA molecule. The relevant sequence information is as follows:

[0060] Sense strand template (5'-3'):

[0061] TAATACGACTCACTATAGGGGGTGATGCAACATACGGAATT (see SEQ ID NO.1);

[0062] AATTCCGTATGTTGCATCACCCCCTATAGTGAGTCGTATTA (see SEQ ID NO.2);

[0063] Antisense strand template (5'-3'):

[0064] TAATACGACTCACTATAGGGTTCCGTATGTTGCATCACCTT (see SEQ ID NO.3);

[0065] AAGGTGATGCAACATACGGAACCCTATAGTGAGTCGTATTA (see SEQ ID NO.4);

[0066] The siRNA sequence is:

[0067] Sense strand: GGUGAUGCAACAUACGGAAUU (see SEQ ID NO.5);

[0068] Antisense strand: UUCCGUAUGUUGCAUCACCUU (see SEQ ID NO.6).

[0069] Example 1 Glucosylated carbon quantum dots and their preparation

[0070] A method for preparing glucosylated carbon quantum dots, comprising the following steps:

[0071] S1. Weigh 5 g of glucose and place it in a flask. Heat it to melt at 150 °C for 30 min, and then add 5 mL of an aqueous solution of dimethyldiallylammonium chloride (obtained commercially, with a batch quality percentage of 62.05% (wt)). React at 150 °C for 180 min. The mass ratio of glucose to dimethyldiallylammonium chloride is 1:0.645;

[0072] S2. Cool the reaction product of step S1 to room temperature, add 50 mL of deionized water to dissolve the reaction product, centrifuge at 12,000 rpm for 10 min, collect the supernatant, then filter the supernatant through a 0.22 μm aqueous filter membrane, and purify the filtrate by dialysis with a dialysis bag with a molecular cut-off of 1000 Da for 48 h. During this period, change the deionized water every 4 h. Take out the retained matter in the dialysis bag, perform freeze-drying, and obtain glucosyl carbon quantum dots (NGCDs).

[0073] Dissolve the freeze-dried NGCDs in deionized water to prepare an NGCDs solution with a concentration of 0.5 mg / mL, and ultrasonically disperse it for 10 min. When preparing the sample, drop the NGCDs solution on the copper grid, let it dry naturally, and then put the copper grid with NGCDs attached into a transmission electron microscope (TEM) to observe the morphology of the glucosyl carbon quantum dots (NGCDs) prepared in the above examples. The microscopy results are as Figure 1 (The scale bar is 20 nm) shown. According to the microscopy results, use Image J software to count the particle size. Count no less than 100 NGCDs, and use the true scale of the TEM as the reference length for calculating the particle size to obtain the particle size distribution of NGCDs, and finally obtain the percentage of NGCDs with different particle sizes, as Figure 2 shown. The abscissa is the percentage of particles with different particle sizes (%), and the ordinate is the particle size (nm). It can be seen that the NGCDs of the present invention have a small particle size, are distributed in the range of 3 - 5 nm, and are evenly dispersed in the solution.

[0074] In addition, measure the infrared spectrum of the freeze-dried powder of NGCDs, and the results are shown in Figure 2 . The infrared spectrum shows that a carbon-carbon double bond structure (1641 cm -1 represents C=C) that does not exist in the glucose precursor is formed in the glucosyl carbon quantum dots, which may be the structure retained from the carbonization and condensation of glucose and dimethyldiallylammonium chloride, or both, and a quaternary ammonium group (1473 cm -1 ) is formed, which is the reason for its positive charge.

[0075] Further, by adjusting the dosage of dimethyldiallylammonium chloride, explore the effect of the change in the mass ratio of dimethyldiallylammonium chloride to glucose on the synthesis of carbon quantum dots. Add 1, 5, or 10 mL of dimethyldiallylammonium chloride aqueous solution (60% wt) to the reaction system, and adjust the mass ratio of dimethyldiallylammonium chloride to glucose to 1:0.129, 1:0.645, 1:1.291 respectively. React at 150 °C for 180 min, and observe the changes in the reaction products.

[0076] Figure 4The color change of the reaction product solution at different addition amounts of dimethyldiallylammonium chloride (upper figure) and the precipitation situation of the reaction product solution after centrifugation at 12,000 rpm for 10 min (lower figure) are shown. From left to right, they are 1, 5, and 10 mL in sequence. Figure 5 The yields of glucosyl carbon quantum dots (NGCDs) at different addition amounts of dimethyldiallylammonium chloride are shown. The yield is the mass of NGCDs obtained based on 5 g of glucose substrate. The specific operation is as follows: The NGCDs solution after dialysis purification through a 1000 Da dialysis bag for 48 h is freeze-dried, and then the mass is weighed. Each group of preparation experiments is repeated no less than 5 times, and the average mass of the NGCDs obtained 6 times is statistically analyzed. It can be seen from the figure that the degree of carbonization of the 1 mL glucose group is relatively low, and fewer carbon dots are generated. While in the 10 mL group, the carbonization reaction is intense, and it is easy to polymerize to form large water-insoluble solid particles, which are centrifuged down, resulting in a significant reduction in the yield of carbon quantum dots.

[0077] Example 2 Application analysis of glucosyl carbon quantum dots loaded with siRNA against nuclease degradation

[0078] Dissolve NGCDs in nuclease-free water and bath-ultrasonic for 10 min at room temperature to obtain a light yellow carbon quantum dot solution; add siRNA to the carbon quantum dot solution at a mass ratio of siRNA to NGCDs of 1:1, pipette 10 times, and let stand at room temperature for 30 min to form an NGCDs-siRNA complex. Add 10 - 100 μg / mL of nuclease RNase A to the above NGCDs-siRNA complex, incubate for 10 - 60 min, and then add proteinase K to terminate the degradation reaction of RNase A. React the termination product at 95 °C for 1 h under the conditions of 2% SDS and 1.5 M NaCl to desorb the siRNA on the NGCDs, and then perform agarose gel electrophoresis to detect the molecular size of the siRNA and clarify the protective effect of NGCDs on siRNA.

[0079] Figure 6The electrophoretogram of siRNA incubated with different concentrations of nuclease RNase A for different times is shown. Among them, Figure A is the result of incubation with 10 μg / mL RNase A for 10 min, Figure B is the result of incubation with 10 μg / mL RNase A for 60 min, Figure C is the result of incubation with 100 μg / mL RNase A for 10 min, and Figure D is the result of incubation with 100 μg / mL RNase A for 60 min. In the figures, the lane "Marker" represents the molecular marker, the lane "naked siRNA" represents the siRNA without incubation with RNase A, which serves as the control group, the lane "siRNA+RNase A" represents the siRNA incubated with RNase A, and the lane "siRNA on NGCDs+RNase A" represents the siRNA loaded on NGCDs incubated with RNase A. It can be seen from the figures that after the action of low and high concentrations of RNase A for 10 - 60 min, the electrophoretic bands of siRNA protected by NGCDs remain intact, while the naked siRNA without the protection of NGCDs is completely degraded after treatment with low concentration of RNase A for 10 min. The results show that NGCDs can effectively protect the loaded siRNA from external damage and degradation by nucleases, and can achieve long-term protection of siRNA in a high-concentration nuclease environment. It should be noted that the weakening of the lane brightness of some NGCDs loaded with siRNA may be due to the influence of the high-salt environment of the 2% SDS and 1.5 M NaCl desorption treatment and incomplete desorption of siRNA.

[0080] Example 3 Application analysis of glucosylated carbon quantum dots as carriers for delivering siRNA

[0081] The siRNA used was obtained by in vitro transcription as described above, and the target of siRNA was the leaves of GFP transgenic Nicotiana benthamiana. The siRNA solution was dropped into NGCDs, and the mass ratio of the two was 1:1, and the siRNA concentration was 100 nM. After standing at room temperature for 30 min, the NGCDs-siRNA complex was formed. 100 μL of the above-mentioned NGCDs-siRNA complex was gently injected into the leaves of GFP transgenic Nicotiana benthamiana cultured in the greenhouse for 28 - 32 days (culture temperature 22 - 26 °C, light 16 hours, darkness 8 hours) using a 1 mL needleless syringe. The concentration of free siRNA was also 100 nM, and the injection volume was 100 μL. The injection method was the same as described above. After injection, the Nicotiana benthamiana was returned to the greenhouse and cultured for another 24 hours.

[0082] The mechanism of action of siRNA lies in its ability to cause the degradation of target gene mRNA. Therefore, the mRNA level of the GFP gene in Nicotiana benthamiana is direct evidence of the action of siRNA. By detecting the expression level of GFP gene mRNA, the silencing effect of siRNA can be reflected. Specifically: Use the GREENspin ultra-fast plant RNA extraction kit (purchased from Zhuangmeng Biotech, product number ZP432) to extract the total RNA of Nicotiana benthamiana leaves, and use the highly efficient second-generation full-length cDNA first-strand synthesis kit (genome-free) (purchased from Novizan, product number R212) to reverse transcribe the RNA into cDNA. Using cDNA as a template, use the universal high-sensitivity dye-based quantitative PCR detection kit (purchased from Novizan, product number Q711) for qPCR, with the Actin gene as an internal reference.

[0083] The specific primer pairs for detecting the target gene GFP and the internal reference gene Actin are as follows. F represents the upstream primer and R represents the downstream primer:

[0084] GFP-F: AGTGGAGAGGGTGAAGGTGATG (see SEQ ID NO.7);

[0085] GFP-R: GCATTGAACACCATAAGAGAAAGTAGTG (see SEQ ID NO.8);

[0086] Actin-F: GCCGAGCGGGAAATTGTTAG (see SEQ ID NO.9);

[0087] Actin-R: GGCAGCTCGTAGCTCTTCTC (see SEQ ID NO.10).

[0088] Adopt 2 -ΔΔCt method to calculate the relative expression level of the target gene GFP, and obtain the normalized GFP gene expression fold change relative to the Actin internal reference gene and the control sample. Figure 7 The figure shows the effect diagram of the expression level of the green fluorescent protein (GFP) gene after NGCDs targetedly deliver siRNA into the cells of Nicotiana benthamiana leaves. It can be seen from the figure that free siRNA (Free siRNA) cannot effectively play its RNA interference (RNAi) role in the plant system, and its GFP gene expression level is the same as that of the non-treated group (Non-treated). However, through the NGCDs of the present invention, which act as both a carrier and a protector, the delivery of siRNA can protect siRNA from degradation in the complex plant system, and can enable siRNA to efficiently enter the cells and effectively play the RNAi role of siRNA in intact plant cells, thereby leading to gene silencing, specifically manifested as a significant decrease in the expression level of the GFP gene.

[0089] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of carbon quantum dots as carriers in delivering nucleic acid molecules, characterized in that, The nucleic acid molecule is siRNA. The preparation method of the carbon quantum dots comprises the following steps: S1. Heat the saccharide compound to 120-155 °C to melt the saccharide compound, and then add an aqueous solution of dimethyldiallylammonium chloride. Keep the temperature at 150-180 °C for 30-240 min. The mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.129-1.291; S2. Cool the reaction product of step S1 to room temperature, add deionized water to dissolve the reaction product, and then centrifuge to collect the supernatant. The supernatant is filtered, dialyzed and freeze-dried to obtain the carbon quantum dots.

2. Use of the carbon quantum dots according to claim 1 as a carrier in delivering nucleic acid molecules, characterized in that, In step S1, the mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.

645.

3. Use of the carbon quantum dots according to claim 1 as a carrier in delivering nucleic acid molecules, characterized in that, In step S1, the mixed reaction system of the saccharide compound and the aqueous solution of dimethyldiallylammonium chloride is kept at 150 °C for 180 min.

4. Use of the carbon quantum dots according to claim 1 as a carrier in delivering nucleic acid molecules, characterized in that, The saccharide compound is selected from at least one of glucose, xylose, arabinose, fructose and mannose.

5. Use of the carbon quantum dots according to claim 4 as a carrier in delivering nucleic acid molecules, characterized in that, The saccharide compound is selected from glucose, and the glucose is heated and melted at 150 °C for 30 min.

6. Use of the carbon quantum dots according to claim 1 as a carrier in delivering nucleic acid molecules, characterized in that, Glucose is heated and melted at 150 °C for 30 min, and then an aqueous solution of dimethyldiallylammonium chloride is added. Keep the temperature at 150 °C for 180 min. The mass ratio of the glucose to the dimethyldiallylammonium chloride is 1:0.

645.

7. Use of the carbon quantum dots according to claim 1 as a carrier in delivering nucleic acid molecules, characterized in that The combination of the carbon quantum dots and the nucleic acid molecule comprises the following steps: Dissolve the carbon quantum dots in nuclease-free water and disperse them by ultrasonic wave to obtain a carbon quantum dot solution; add the nucleic acid molecule to the carbon quantum dot solution, mix well and let it stand at room temperature to form a carbon quantum dot-nucleic acid complex; Among them, the mass ratio of the nucleic acid molecule to the carbon quantum dots is 1:1, and the concentration of the carbon quantum dot solution is 0.5-2 mg / mL.

Images